Methods of treating metachromatic leukodystrophy

Abstract

Provided herein are expression components for expressing a transgene in a hepatocyte, wherein the transgene encodes an ARSA polypeptide. Also provided are methods of treating metachromatic white matter dystrophy (MLD). Further provided herein are vectors (e.g., rAAV vectors), viral particles, pharmaceutical compositions, and kits for expressing an ARSTA polypeptide in an individual in need thereof.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 342,590 filed on May 16, 2022 and U.S. Provisional Application No. 63 / 459,564 filed on April 14, 2023, the contents of each of which are incorporated by reference in their entirety. Reference Electronic Sequence Listing

[0002] The contents of the electronic sequence listing (159792018440seqlist.xml; size: 36,314 bytes; and creation date: May 8, 2023) are incorporated herein by reference in its entirety. Technical Field

[0003] The present disclosure relates to providing methods for treating metachromatic leukodystrophy (MLD) in a patient in need thereof, the methods comprising administering to the patient's cerebrospinal fluid (CSF) a recombinant adeno-associated virus (rAAV) viral particle comprising a vector encoding arylsulfatase A (ARSA). Background Art

[0004] Metachromatic leukodystrophy (MLD) is an autosomal recessive neurodegenerative disorder caused by mutations in arylsulfatase A (ARSA). Reduced levels of ARSA activity lead to toxic accumulation of sulfatides, which is characterized by degeneration of myelin-forming cells (oligodendrocytes and Schwann cells) in the central and peripheral nervous systems. This can lead to demyelination, dysfunction, neuronal degeneration and neuroinflammation (astrogliosis, microglial activation). Clinical manifestations are mainly in the nervous system, leading to intellectual disability, emotional and behavioral problems, loss of motor skills (movement, speech, swallowing), poor muscle function, as well as paralysis, blindness, hearing loss and epileptic seizures.

[0005] Current treatments for MLD include autologous hematopoietic stem cell transplantation (HSCT) and allogeneic bone marrow transplantation. Summary of the invention

[0006] In some aspects, the invention provides methods for treating metachromatic leukodystrophy (MLD) in a patient in need thereof, the methods comprising administering a recombinant adeno-associated virus (rAAV) viral particle to the patient's cerebrospinal fluid (CSF), the viral particle comprising a vector encoding arylsulfatase A (ARSA) (also referred to herein as an ARSA polypeptide). In some embodiments, the viral particle is administered directly to the CSF via intracerebroventricular (ICV) administration, direct cisternal (dCM) administration, or intrathecal microcatheter (IT-CM).

[0007] The present invention is based at least in part on the development of rAAV virus particles, which include: (a) rAAV vectors, the vectors including an expression component encoding an arylsulfatase A (ARSA) polypeptide, and (b) a capsid capable of transducing cells of the central nervous system (CNS). Administration of the virus particles to CSF ​​provides high expression levels of the ARSA protein in the brain. In certain embodiments, the expression component of the virus particles can drive transgenic expression in the central and peripheral nervous systems to treat MLD. In some embodiments, the expression component includes the ARSA gene of SEQ ID NO: 2. In some embodiments, the ARSA gene expresses an ARSA polypeptide with SEQ ID NO: 1.

[0008] In some aspects, the present invention provides a recombinant adeno-associated virus (rAAV) particle, the recombinant adeno-associated virus (rAAV) particle comprises a rAAV vector, wherein the rAAV vector comprises an expression component for expressing an ARSA polypeptide in the central and peripheral nervous systems, wherein the expression component comprises a transgene operably linked to a promoter and optionally to an enhancer, wherein the transgene encodes an ARSA polypeptide, and wherein the AAV virus particle comprises a capsid protein capable of transducing cells of the central nervous system (CNS). In some embodiments, the AAV capsid protein is an AAV9 capsid protein (SEQ ID NO: 9). In some embodiments, the capsid of rAAV is a modified AAV9 capsid protein. In some embodiments, the capsid of rAAV is an AAV.rh10 capsid protein. In some embodiments, the ARSA gene expresses an ARSA polypeptide with SEQ ID NO: 1.

[0009] In some embodiments, the present disclosure provides rAAV particles for administering ARSA polypeptides in CSF, and these rAAV particles include modified AAV9 capsid proteins, and the modified AAV9 capsid proteins include targeting peptides for targeting rAAV particles to the brain. This modified AAV9 capsid is described in International Publication No. WO 2021 / 102234 A1 (which is hereby incorporated by reference in its entirety). In a specific embodiment, the targeting peptide of the modified AAV9 capsid is inserted after residue 588 of the AAV9 structural protein. In some embodiments, the targeting peptide has SEQ ID NO: 10. In some embodiments, the targeting peptide is flanked by a joint sequence at the N-terminal and C-terminal sides of the targeting peptide. In some embodiments, the joint sequence on the N-terminal side has the sequence AAA. In some embodiments, the joint sequence on the C-terminal side is AS. In some embodiments, the complete sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO: 11. In some embodiments, the complete modified AAV9 capsid structural protein (VP1) has SEQ ID NO: 12. The capsid protein having SEQ ID NO: 12 is referred to herein as AAV1999. In some embodiments, the complete modified AAV9 capsid structural protein is at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 12, wherein the modified AAV9 structural capsid comprises a targeting peptide of SEQ ID NO: 10.

[0010] As disclosed herein, the rAAV particles comprising the modified AAV9 capsid protein include three structural capsid proteins VP1, VP2 and VP3. These three capsid proteins are alternative splicing variants. The full-length VP1 protein has the sequence of SEQ ID NO:9. The VP2 protein includes amino acids 138 to 736 of SEQ ID NO:9. The VP3 protein includes amino acids 203 to 736 of SEQ ID NO:9. In some embodiments, the targeting peptide (SEQ ID NO:10) is inserted into the AAV9 VP3 capsid protein in the rAAV particles. In some embodiments, the targeting peptide (SEQ ID NO:10) is inserted into the AAV9 VP2 capsid protein in the rAAV particles. In some embodiments, the targeting peptide (SEQ ID NO:10) is inserted into the AAV9 VP1 capsid protein in the rAAV particles. In some embodiments, the targeting peptide (SEQ ID NO:10) is inserted into the VP1, VP2 and VP3 capsid proteins in the rAAV particles. In some embodiments, the targeting peptide in the modified AAV9 capsid protein is flanked by linker sequences at the N-terminus and C-terminus of the targeting peptide. In some embodiments, the linker sequence on the N-terminal side has the sequence AAA. In some embodiments, the linker sequence on the C-terminal side is AS.

[0011] It has been found that rAAV particles comprising a modified AAV9 capsid protein (which comprises a targeting peptide of SEQ ID NO: 10) show very high transgene expression levels after administration to the brain of a subject (e.g., intra-CSF administration). For example, after intra-CSF administration of rAAV particles, rAAV particles comprising a modified VP1 capsid protein having SEQ ID NO: 12 (and / or a modified VP2 capsid protein having SEQ ID NO: 13 and / or a modified VP2 capsid protein having SEQ ID NO: 14) have higher transgene expression levels in the brain and spinal cord than rAAV particles comprising other capsids (e.g., AAV9 and AAV.rh10) capable of transducing cells of the CNS. In contrast, after intra-CSF administration of rAAV particles comprising a modified AAV9 capsid (which comprises a targeting peptide of SEQ ID NO: 10), the transgene levels expressed in other organs such as the heart and liver are significantly reduced. In addition, relative to rAAV particles containing other capsids (e.g., AAV9 and AAV.rh10) capable of transducing cells of the CNS, lower doses of rAAV particles containing modified AAV9 capsids (which contain the targeting peptide of SEQ ID NO: 10) can achieve high expression levels. Therefore, relative to rAAV particles containing AAV9 capsids or AAV.rh10 capsids, rAAV particles containing modified AAV9 capsid proteins (which contain the targeting peptide of SEQ ID NO: 10) have an improved therapeutic index.

[0012] Thus, in one aspect, the present invention provides methods for treating MLD in a patient in need thereof, the methods comprising administering to the patient's cerebrospinal fluid (CSF) a recombinant adeno-associated virus (rAAV) viral particle comprising (1) a vector encoding an ARSA polypeptide and (2) a modified AAV9 capsid protein, wherein the modified rAAV capsid protein comprises the targeting peptide of SEQ ID NO: 10. In some embodiments, the modified AAV9 capsid protein comprising SEQ ID NO: 10 is at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to the capsid protein having SEQ ID NO: 12. In some embodiments, the capsid protein has SEQ ID NO: 12.

[0013] In some embodiments of the above aspects, the rAAV particles include a vector comprising an expression assembly flanking one or more AAV inverted terminal repeat (ITR) sequences. In certain embodiments, the expression assembly flanks two AAV ITRs. In certain embodiments, these AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAV.rh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, cattle AAV or mouse AAV serotype ITRs. In certain embodiments, these AAV ITRs are AAV2 ITRs. In certain embodiments, the vector is a self-complementary vector. In certain embodiments, the vector includes a first nucleic acid sequence encoding an ARSA polypeptide and a second nucleic acid sequence encoding a complementary sequence of the ARSA polypeptide, wherein the first nucleic acid sequence can form an intrachain base pair with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence is linked to the second nucleic acid sequence via a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and comprises a mutation of a terminal resolution sequence.

[0014] In some aspects, the invention provides a composition comprising any of the rAAV particles described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0015] In some aspects, the invention provides a cell comprising any rAAV particles described herein. In some aspects, the invention provides a method for producing an ARSA polypeptide, the method comprising culturing a cell as described herein under conditions of producing an ARSA polypeptide. In some embodiments, these methods further comprise the step of purifying the ARSA polypeptide.

[0016] In some aspects, the present invention provides methods for treating MLD in an individual in need, comprising administering to the individual rAAV particles as described herein. In some aspects, the present invention provides methods for treating MLD in an individual in need, comprising administering to the individual a composition as described herein. In some embodiments, the present invention provides methods for treating MLD in an individual in need, comprising administering to the individual a cell as described herein. In some embodiments, the individual lacks ARSA activity.

[0017] In some embodiments, the present invention provides methods for increasing ARSA activity by at least about 5% in individuals in need, comprising administering rAAV particles as described herein to the individual. In other embodiments, the present invention provides methods for increasing ARSA activity by at least about 10% in individuals in need, comprising administering rAAV particles as described herein to the individual. In other embodiments, the present invention provides methods for increasing ARSA activity by at least about 20% in individuals in need, comprising administering rAAV particles as described herein to the individual. In other embodiments, the present invention provides methods for increasing ARSA activity by at least about 30% in individuals in need, comprising administering rAAV particles as described herein to the individual. In other embodiments, the present invention provides methods for increasing ARSA activity by at least about 50% in individuals in need, comprising administering rAAV particles as described herein to the individual.

[0018] The administration of rAAV particles can be carried out by various routes. In some embodiments, the administration includes direct spinal injection and / or intracerebral administration. In some embodiments, the administration is carried out at a site selected from the following: cerebrum, medulla, pons, cerebellum, intracranial cavity, meninges around the brain, dura mater, arachnoid, pia mater, cerebrospinal fluid (CSF) of the subarachnoid space around the brain, deep cerebellar nuclei of the cerebellum, ventricular system of the cerebrum, subarachnoid space, striatum, cortex, diaphragm, thalamus, hypothalamus and brain parenchyma. In some embodiments, the administration includes intraventricular injection into at least one lateral cerebral ventricle. In some embodiments, the administration includes intrathecal injection in the neck, chest and / or lumbar region. In some embodiments, the administration includes intrastriatal injection. In some embodiments, the administration includes intrathalamic injection.

[0019] In some embodiments of the above aspects, the rAAV particles are administered via direct injection into the spinal cord, by intrathecal injection, and / or by intracisternal injection. In some embodiments, the rAAV particles are administered to more than one location of the spinal cord or cisterns. In some embodiments, the rAAV particles are administered to more than one location of the spinal cord. In some embodiments, the rAAV particles are administered to one or more of the lumbar subarachnoid space, thoracic subarachnoid space, and cervical subarachnoid space of the spinal cord. In some embodiments, the rAAV particles are administered to the cisterns.

[0020] In some embodiments of the above aspects, rAAV particles are administered only once to a patient in need. In some embodiments, rAAV particles are administered multiple times to a patient in need (e.g., within a month or multiple months or years). In other embodiments, rAAV particles are administered once a year to a patient in need. In other embodiments, rAAV particles are administered twice a year to a patient in need.

[0021] In some embodiments, the invention provides a kit comprising any of the rAAV particles, compositions, or cells described herein. In some embodiments, the kit further comprises instructions for use; a buffer and / or a pharmaceutically acceptable excipient; and / or a bottle, vial, and / or syringe. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figures 1A-1C The results showed that the use of viral particles containing two different expression components can increase ARSA expression in vivo, thereby driving the expression of ARSA in MLD (ARSA - / - ) mouse model to better clear toxic sulfatide deposits (C24-ST). Figure 1A The expression modules used in the viral particles are shown, one with the WPRE element and one without the WPRE element. Figure 1B Shown are the expression levels of ARSA after bilateral retro-orbital injection of viral particles into mice. Figure 1C Shown are C24-ST levels after bilateral retro-orbital injection of viral particles into mice.

[0023] Figure 2 AAV.rh10-CBA-ARSA-WPRE was used to treat advanced MLD (ARSA - / - ) mice showed increased ARSA-mediated sulfatase activity in the brain, spinal cord, and liver.

[0024] Figure 3 Describes the treatment of advanced MLD (ARSA - / - ) mice showed a significant decrease in sulfatide levels in the brain and spinal cord 3 months after administration.

[0025] Figure 4 The results showed that in patients with advanced MLD (ARSA - / - ) mice brains.

[0026] Figure 5 The results showed that in patients with advanced MLD (ARSA - / -) mice brains were observed to have increased myelination and the number of mature oligodendrocytes.

[0027] Figure 6A-6B The results showed that in patients with advanced MLD (ARSA - / - ) The extent of ARSA protein cross-correction in the brain of mice. Fig. 6A Shown are signal overlays of matched sagittal brain half sections three months after administration of AAV.rh10-CBA-ARSA-WPRE. Figure 6B Heat map showing the cross-correction factors.

[0028] Figure 7A-7B The results show that AAV.rh10-CBA-ARSA-WPRE treated early MLD (ARSA - / - ) mice display widespread CNS human ARSA (hARSA) expression and increased ARSA-mediated sulfatase activity in the brain, spinal cord, dorsal root ganglia (DRG), and liver. Fig. 7A It is shown that at four months after dosing, widespread ARSA expression relative to human ARSA was observed by IHC in sagittal brain sections. Figure 7B It was shown that in animals treated with AAV.rh10-CBA-ARSA-WPRE, the brain, spinal cord, DRG, and liver exhibited a significant increase in ARSA activity.

[0029] Figures 8A-8D Shown in early (6 months) ARSA - / - After administration of AAV.rh10-CBA-ARSA-WPRE to mice, brain ( Fig. 8A ),liver( Figure 8B ),plasma( Figure 8C ) and CSF( Fig.8D ) sulfatide levels in the brain, spinal cord, liver, plasma, and CSF were significantly increased after administration of AAV.rh10-CBA-ARSA-WPRE.

[0030] Figures 9A-9C Treatment by AAV.rh10-ARSA-FLAG-WPRE administration was shown to result in a significant increase in sulfatase activity in the brain and spinal cord of non-human primates (NHPs) using low and high doses of viral particles. Fig. 9A Sulfatase activity in brain is shown. Fig. 9B Sulfatase activity in the spinal cord is shown. Fig. 9C Representative brain sections after administration of viral particles are shown.

[0031] Fig. 10A and 10BIt was shown that capsid AAV1999 showed higher transgene expression in the brain and spinal cord of NHPs compared to AAVrh.10. Fig. 10A Shown are the expression levels of green fluorescent protein (GFP) after administration of rAAV particles. Fig. 10B It was shown that across all samples, GFP expression in the brains of NHPs treated with AAV1999 was 93%-123% higher compared to NHPs treated with AAVrh.10.

[0032] Fig.11 Shown are heat maps of GFP expression in the brain following administration of AAV1999 or AAVrh.10 to NHPs.

[0033] Fig.12 Representative matched brain sections stained with antibodies against eGFP show robust expression in AAV1999-treated NHPs compared to AAVrh10, demonstrating superior biodistribution ( Fig.12 ).

[0034] Fig.13 Shown is GFP expression in the spinal cord and DRG of NHPs following administration of particles containing AAV1999-GFP.

[0035] Fig.14 It was shown that in treated NHPs, AAV1999-GFP expression was lower in the heart and liver compared to AAVrh10-GFP.

[0036] Figures 15A-15B Shown are AAVrh10 and AAV1999 vector genome loads in various tissues after administration of AAVrh10-GFP particles or AAV1999-GFP particles. Fig.15A Vector genome loads in brain, spinal cord, and DRG are shown. AAV1999 had lower vector genome loads in brain, spinal cord, and DRG than AAVrh10. Fig. 15B Shown are vector genome loads in the liver, heart, lung, kidney, and spleen following administration of AAVrh10-GFP or AAV1999-GFP.

[0037] Fig.16 A leftward shift in the correlation between GFP expression (y-axis) and tissue vector genomes (x-axis) is shown, with the correlation for AAV1999 (red) shifting to the left, indicating higher protein expression and lower tissue dose (approximately 10-fold) for the vector compared to AAVrh.10.

[0038] Fig.17 Vector maps showing specific plasmids used for rAAV particle production.

[0039] Fig.18Arsa KO mice treated with AAV1999-ARSA were shown to show sustained hARSA mRNA expression. Thirteen months after administration, Arsa KO mice were euthanized and brain and spinal cord samples were collected. RTdPCR was performed to quantify hARSA mRNA expression and normalized it to the mouse Hprt gene. Each data point represents a single animal. FB = formulation buffer. Error bars represent mean and standard error; statistical analysis: one-way ANOVA and Tukey's multiple comparison test. *<0.05; **<0.01; ***<0.001; ****<0.0001. WT+FB: formulation buffer was administered to wild-type mice; KO+FB: formulation buffer was administered to Arsa KO mice; KO+AAV: AAV1999-ARSA was administered to Arsa KO mice.

[0040] Fig.19 One Arsa KO mouse treated with AAV1999-ARSA is shown to show sustained ARSA-mediated sulfatase activity over time. Thirteen months after administration, Arsa KO mice were euthanized and brain, spinal cord, DRG, sciatic nerve, liver and plasma samples were collected. ARSA-mediated sulfatase activity was measured using a sulfatase activity assay; data were normalized to total protein measured by BCA assay. Each data point represents a single animal. Error bars represent mean and standard error; statistical analysis: one-way ANOVA and Tukey's multiple comparison test. *<0.05; **<0.01; ***<0.001; ****<0.0001.

[0041] Fig. 20 It is shown that the levels of lyso-sulfatide in the brain and spinal cord of 2 Arsa KO mice treated with AAV1999-ARSA were significantly increased. Thirteen months after administration, Arsa KO mice were euthanized and brain, spinal cord, DRG, sciatic nerve, liver, plasma and CSF samples were collected. Sulfatide levels were measured using LC-MS. The data were normalized to tissue weight: converted from ng / mL (50 μL) to μg / g. The data were converted from (30ul) ng / ml to ng / ml (plasma) and from ng / ml (5ul) to ng / ul (CSF). Each data point represents a single animal. Error bars represent mean and standard error; statistical analysis: one-way ANOVA and Tukey's multiple comparison test. *<0.05; **<0.01; ***<0.001; ****<0.0001.

[0042] Fig.21Arsa KO mice treated with AAV1999-ARSA were shown to show significant improvements in the expression of key inflammatory markers. Thirteen months after administration, Arsa KO mice were euthanized and brain and spinal cord samples were collected. RTdPCR was performed to quantify Gfap, Aif1 (Iba1 gene) and Lamp1 levels and normalized them to the mouse Hprt gene. Each data point represents a single animal. Error bars represent mean and standard error; Statistical analysis: one-way ANOVA and Tukey's multiple comparison test. *<0.05; **<0.01; ***<0.001; ****<0.0001.

[0043] Fig. 22 It is shown that long-term (13 months after administration) treatment of Arsa KO mice with AAV1999-hARSA significantly reduced plasma Nf-L levels. Thirteen months after administration, Arsa KO mice were euthanized and plasma samples were collected. Nf-L levels were measured by the Quanterix platform. Each data point represents a single animal. Error bars represent mean and standard error; Statistical analysis: one-way ANOVA and Tukey's multiple comparison test. *<0.05; **<0.01; ***<0.001; ****<0.0001.

[0044] Fig.23 Arsa KO mice show a gradual decline in hearing over time; treatment with AAV1999-ARSA prevents progression of the auditory phenotype: ABR measurements were recorded via electrodes placed on the scalp of anesthetized animals at 4, 7, 10, and 13 months after dosing. Error bars represent mean and standard error; Statistical analysis: two-way ANOVA and Tukey's multiple comparison test. Asterisks indicate KO+FB vs. KO+AAV groups. * = KO+FB vs. KO+AAV; * < 0.05; ** < 0.01; *** < 0.001; **** < 0.0001.

[0045] Figures 24A-24C Arsa KO mice treated with AAV1999-ARSA showed significant reversal of MLD-related pathology in the brain and spinal cord: Thirteen months after dosing, Arsa KO mice were euthanized and brains were collected ( Fig.24A ),spinal cord( Fig. 24B ) and DRG( Fig.24C ) samples were subjected to histopathological evaluation. Each data point represents a single animal. Error bars represent mean and standard error; Statistical analysis: one-way ANOVA and Tukey's multiple comparison test. *<0.05; **<0.01; ***<0.001; ****<0.0001

[0046] Figures 25A-25CArsa KO mice treated with AAV1999-ARSA showed sustained ARSA-mediated sulfatase activity over time. At one, two, three, and six months after dosing, Arsa KO mice were euthanized and brain samples were collected ( Fig.25A ). Digital PCR (dPCR) was performed to quantify the AAV1999-ARSA vector levels in each tissue and normalized them to the Rab1a gene. ( Fig.25B and Fig.25C ) ARSA-mediated sulfatase activity was measured using a sulfatase activity assay kit (ab204731); data were normalized to total protein measured by BCA assay. Each data point represents a single animal. Error bars represent mean and standard error; statistical analysis: two-way ANOVA and Tukey's multiple comparison test.

[0047] Figures 26A-26F Arsa KO mice treated with AAV1999-ARSA showed a gradual clearance of sulfatide isoforms over time. Arsa KO mice were euthanized and brain samples were collected at one, two, three, and six months after dosing. LC-MS was used to measure ( Fig.26A ) Lyso-sulfatide, ( Fig.26B )C16-sulfatide isoforms and ( Fig.26C )C18-sulfatide isoform. Data were normalized to tissue weight: converted from ng / mL (50 μL) to μg / g. ( Figures 26D-26F ) To illustrate the gradual elimination of sulfatide esters, Fig.26D ) Lysosulfatide, ( Fig.26E )C16-sulfatide isoforms and ( Fig.26F ) C18-sulfatide isoforms, data are presented as the percentage of ST remaining in KO+AAV animals relative to the mean ST remaining in KO+FB animals. Each data point represents a single animal. Error bars represent mean and standard error; Statistical analysis: two-way ANOVA with Tukey's multiple comparison test. *<0.05; **<0.01; ***<0.001; ****<0.0001.

[0048] Fig. 27It is shown that after treatment with AAV1999-ARSA, the total sulfatide levels in the CSF and plasma of Arsa KO mice showed a significant decrease. One month, two months, three months and six months after administration, Arsa KO mice were euthanized and CSF and plasma samples were collected. Sulfatide levels were measured using LC-MS. Data were converted from (30ul) ng / ml to ng / ml (plasma) and from ng / ml (5ul) to ng / ul (CSF). Each data point represents a single animal. Error bars represent mean and standard error; Statistical analysis: two-way ANOVA and Tukey's multiple comparison test.

[0049] Fig.28 The initial increase in plasma Nf-L levels was shown to be reduced 6 months after administration of AAV1999-ARSA compared to the KO+FB group. Arsa KO mice were euthanized and plasma samples were collected at one, two, three, and six months after administration. Nf-L levels were measured by the Quanterix platform. Each data point represents a single animal. Error bars represent the mean and standard error; Statistical analysis: one-way ANOVA and Tukey's multiple comparison test. *<0.05; **<0.01; ***<0.001; ****<0.0001.

[0050] Figures 29A-29D Microscopic observations of the lowest severity found in the brains of Arsa KO mice treated with AAV1999-ARSA are shown. Arsa KO mice were euthanized at one, two, three, and six months after dosing, and brain samples were collected for histopathological analysis. Each data point represents a single animal; observations are based on ( Fig.29A )Brainstem and cerebellar degeneration, ( Fig.29B )Vacuole formation, ( Fig.29C ) infiltration and ( Fig.29D ) The incidence and severity of hippocampal degeneration were classified. Error bars represent mean and standard error; Statistical analysis: two-way ANOVA and Tukey's multiple comparison test.

[0051] Figures 30A-30E Arsa KO mice treated with AAV1999-ARSA showed minimal to mild observations in DRG and peripheral nerves. At one, two, three, and six months after administration, Arsa KO mice were euthanized and DRG ( Figures 30A-30C ),spinal cord( Fig.30D ) and sciatic nerve ( Fig.30E ) for histopathological analysis. Each data point represents a single animal. Error bars represent mean and standard error; Statistical analysis: two-way ANOVA and Tukey's multiple comparison test.

[0052] Fig.31 Shown is a wide range of dose-dependent AAV1999-ARSA vector biodistribution in the NHP brain. Five weeks after administration of AAV1999-ARSA, NHPs were euthanized and samples were collected. The brain was cut in half and one of the hemispheres was quickly frozen; 64 tissue punches were collected from each hemisphere, representing gray matter (47 punches) and white matter (17 punches). Digital PCR (dPCR) was performed to quantify the AAV1999 vector concentration in each tissue punch sample and normalize it relative to the TUBB1 gene intron. Each data point represents the VG / cell exposure of the tissue punch sample, which is either (left) taken as the average of all NHPs in the group, or (right) presented by individual brain regions. Error bars represent mean and standard error; Statistical analysis: one-way ANOVA and Tukey's multiple comparison test. According to the dose of NHP.

[0053] Fig.32 Shown is a wide range of dose-dependent hARSA mRNA expression in 19 gray matter brain regions in NHP. Five weeks after administration, NHPs were euthanized and samples were collected. The brain was cut in half and one of the hemispheres was quickly frozen; 47 tissue ring samples were collected from each hemisphere, representing 19 gray matter regions. Reverse transcription digital PCR (RTdPCR) was performed to quantify hARSA mRNA expression, which was normalized relative to the cynomolgus monkey hypoxanthine phosphoribosyltransferase 1 (HPRT) gene. Each data point represents the normalized hARSA expression in the tissue ring sample, which is either (left) taken as the average of all NHPs in the group, or (right) presented by individual brain regions. Left: scatter plots represent medians; right: error bars represent mean and standard error; statistical analysis: one-way ANOVA and Tukey's multiple comparison test.

[0054] Figures 33A-33C Extensive dose-dependent hARSA protein expression in 19 gray matter brain regions in NHPs is shown. Five weeks after administration of AAV1999-ARSA, NHPs were euthanized and samples were collected. The brain was cut in half and one of the hemispheres was quickly frozen; 30 tissue ring samples were collected from each hemisphere, representing gray matter. LC-MS was performed to quantify human ARSA protein levels. Each data point represents the amount of human ARSA in the tissue ring sample, the average of three animals in the group, which is either presented as ( Fig.33A ) average, or ( Fig.33B ) according to the individual brain regions, or ( Fig.33C) is presented as the correlation with vector genome in these ring-cut samples. Error bars represent mean and standard error. Data from 1e10 VG / g (7.5e11 VG) and 3.3e10 VG / g (2.5e12 Vg) were below the detection limit and have been excluded. Left: Scatter plots represent medians; Right: Error bars represent mean and standard error; Statistical analysis: One-way ANOVA and Tukey's multiple comparison test.

[0055] Figures 34A-34B Uniform dose-dependent AAV1999 vector biodistribution and hARSA mRNA expression along the cranial-caudal axis of the spine are shown. Five weeks after administration of AAV1999-ARSA, NHPs were euthanized and samples were collected. Eight spinal cord segments with adjacent DRGs (two each in the cervical, upper thoracic, lower thoracic, and lumbar regions) were snap-frozen and DNA / RNA isolated. ( Fig.34A ) Digital PCR (dPCR) was performed to quantify AAV1999 vector concentration and normalized it to the TUBB1 gene intron. ( Fig.34B ) RTdPCR was performed to quantify hARSA mRNA expression and normalized it to the endogenous HPRT gene. Each data point represents the background of the sample minus VG / cell exposure or normalized hARSA expression, averaged across all NHPs in the group. Error bars represent mean and standard error.

[0056] Fig.35 The biodistribution of AAV1999-ARSA vectors in visceral organs and peripheral nerves is shown. Five weeks after administration, NHPs were euthanized and samples from visceral organs were collected. Digital PCR (dPCR) was performed to quantify the AAV1999 vector concentration in each tissue ring sample and normalized it to the TUBB1 gene intron. Each data point represents the VG / cell exposure of the tissue ring sample, averaged across all NHPs in the group. Error bars represent mean and standard error.

[0057] Fig.36It is shown that at 1e11 and 3.3e11 VG / g brain weight doses, human ARSA protein expression in NHP brains is likely to meet the therapeutic threshold. Five weeks after administration of AAV1999-ARSA, NHPs were euthanized and samples were collected. The brain was cut in half and one of the hemispheres was quickly frozen; 30 tissue ring samples were collected from each hemisphere, representing gray matter. LC-MS was performed to quantify human and endogenous cynomolgus monkey cyARSA protein levels and expressed as a percentage (huARSA / cyARSA). Each data point is represented as the ratio of hARSA to macaque cyARSA protein in the tissue ring sample, the average of three animals in the group, which is either presented as (left) the average of all NHPs in the group, or (right) presented according to individual brain regions. Error bars represent mean and standard error.

[0058] Figures 37A-37B It was shown that the effective dose of AAV1999-ARSA was of therapeutic significance. Fig.37A Shown is the implementation of LC-MS to quantify human ARSA protein levels in 12 brain regions from 7 healthy organ donors aged 3-8 years. Tissues were obtained from the National Institutes of Health (NIH) Brain Bank. Fig.37B Five weeks after administration, NHPs were euthanized and samples were collected. The brain was cut in half and one of the hemispheres was quickly frozen; 30 tissue ring samples were collected from each hemisphere, representing gray matter. LC-MS was performed to quantify human ARSA protein levels. The average ARSA protein in each group is presented. The sponsor presents the percentage of human ARSA in NHPs, which can be related to human ARSA in the brain of healthy organ donors. Error bars represent mean and standard error.

[0059] Fig.38 It is shown that no clinical symptoms (functional or behavioral deficits) were observed in NHPs in the first week or the fifth week (necropsy) after administration of AAV1999-ARSA in both dosing groups. 35 functional and behavioral parameters were tested for NHPs before dosing, on the 7th day after dosing, and before necropsy (5 weeks after dosing). Observations were scored as "within the normal range" or "abnormal clinical observations". The following figure shows the observations at necropsy. Functional and behavioral assessments were performed by CRL veterinarians.

[0060] Figures 39A-39C The results showed that intra-CM injection of AAV1999-ARSA was well tolerated and produced the expected increase in Nf-L; AAV1999-ARSA did not induce innate or cell-mediated immune responses. Fig.39A As shown, CSF was collected and analyzed for Nf-L levels by the Quanterix platform before dosing and at necropsy. Each data point represents the Nf-L level in that sample, which is the average of all NHPs in that group. Fig.39BPlasma was isolated prior to dosing, on days 2, -4, 7, 14 after dosing, and at necropsy as indicated. Concentrations of IL-1b, IL-1RA, IL-6, IL-10, IL-12 / 23 (p40), IL-15, IL-18, IFN-g, TNF-a, G-CSF, MCP-1, MIP-1b, GM-CSF, IL-2, IL-4, IL-5, IL-8, IL-13, and IL-17A were determined using the Luminex assay. Each data point represents the cytokine concentration in that sample, which is the average of all NHPs in that group. Fig.39C PBMCs isolated from animals in the 1e11 and 3.3e11 VG / g brain re-dosing groups were subjected to IFN-γ ELISpot as indicated. Error bars represent mean and standard error; Statistical analysis: One-way ANOVA with *Tukey and # Dunnett's multiple comparison test.

[0061] Fig.40 NHP treated with AAV1999-ARSA at four doses are shown to show mild microscopic observations in the brain. Five weeks after administration, NHPs were euthanized and samples were collected. The brain was cut in half and one hemisphere was fixed for histopathological evaluation. Each data point represents the incidence and severity of microscopic observations, which is the average of all animals in the dosing group, measured by mononuclear cell infiltration, neuronal or neurofibrillary degeneration and glial cell proliferation categories. Error bars represent mean and standard error.

[0062] Figures 41A-41B NHP treated with AAV1999-ARSA showed moderate microscopic observations in the spinal cord, radial nerve and femoral nerve of NHP; obvious observations were observed in the sciatic nerve. Five weeks after administration, NHP was euthanized and samples were collected for histopathological evaluation. Each data point represents the incidence and severity of microscopic observations, which is the average of all animals in the dosing group, measured by mononuclear cell infiltration, neuronal or neurofibrillary degeneration and glial cell proliferation categories. Error bars represent mean and standard error.

[0063] Figures 42A-42BIt is shown that when averaged in 8 segments along the cranial-caudal axis of the spine, NHPs treated with AAV1999-ARSA showed mild observations in the DRG. Five weeks after administration, the NHPs were euthanized and samples were collected for histopathological evaluation. In the left panel, each data point represents the average incidence and severity of microscopic observations averaged in DRGs from 8 spinal cord segments in all animals in the dosing group. In the right panel, each data point represents the incidence and severity of microscopic observations based on DRG, which is the average of all animals in the dosing group. The categories of measurement are ( Fig.42A ) degeneration and necrosis and ( Fig.42B ) Monocyte infiltration. Error bars represent mean and standard error. DETAILED DESCRIPTION

[0064] In some aspects, the present invention provides an expression assembly, a recombinant adeno-associated virus (rAAV) vector, and a viral particle and a pharmaceutical composition comprising a transgenic encoding an ARSA polypeptide. In other aspects, the present invention provides a method for treating metachromatic leukodystrophy (MLD), such as by the following means: increasing ARSA activity, reducing sulfatide accumulation in the brain, spinal cord, liver, plasma, and CSF, increasing myelination in the corpus callosum and normalizing it, increasing oligodendrocyte colonies in the brain, and improving CNS pathology, thereby removing sulfatide in the brain region. In yet other aspects, the present invention provides a kit for treating individual MLD using the expression assembly disclosed herein. definition

[0065] As used herein, "vector" refers to a recombinant plasmid or virus comprising a nucleic acid to be delivered to a host cell in vitro or in vivo.

[0066] The terms "polypeptide" and "protein" are used interchangeably and refer to polymers of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers and polymers of amino acid residues. Full-length proteins and fragments thereof are encompassed in this definition. These terms also include post-expression modifications of polypeptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. In addition, for the purposes of this disclosure, "polypeptide" refers to proteins including modifications to the native sequence, such as deletions, additions and substitutions (usually conservative in nature), as long as the protein maintains the desired activity. These modifications may be intentional, such as by site-directed mutagenesis, or may be accidental, such as by mutations of the host producing the protein or due to errors in PCR amplification.

[0067] "Recombinant viral vector" refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequences of non-viral origin). In the case of a recombinant AAV vector, the recombinant nucleic acid is flanked by at least one, and in embodiments, two inverted terminal repeats (ITRs).

[0068] "Recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector comprising one or more heterologous sequences (i.e., nucleic acid sequences from non-AAV sources), which are flanked by at least one and, in an embodiment, two AAV inverted terminal repeats (ITRs). When present in a host cell that has been infected with a suitable helper virus (or is expressing a suitable helper function) and is expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins), such rAAV vectors can be replicated and packaged into infectious viral particles. When the rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or another vector such as a plasmid for cloning or transfection), the rAAV vector can be referred to as a "front vector", which can be "rescued" by replication and encapsidation in the presence of AAV packaging functions and suitable helper functions. The rAAV vector can be any of a variety of forms, including but not limited to plasmids, linear artificial chromosomes, complexed with lipids, encapsulated in liposomes, and encapsidated in viral particles, particularly in AAV particles. rAAV vectors can be packaged into AAV viral capsids to produce "recombinant adeno-associated virus particles (rAAV particles)".

[0069] "Heterologous" means derived from a genotypically different entity from the rest of the entity to which it is being compared or into which it is introduced or incorporated. For example, a polynucleotide introduced into a different cell type by genetic engineering techniques is a heterologous polynucleotide (and when expressed, may encode a heterologous polypeptide). Similarly, a cellular sequence (e.g., a gene or portion thereof) incorporated into a viral vector is a heterologous nucleotide sequence relative to the vector.

[0070] The term "transgenic" refers to a polynucleotide that is introduced into a cell and can be transcribed into RNA and optionally translated and / or expressed under appropriate conditions. In some aspects, it imparts desired properties to the cell into which it is introduced, or otherwise produces a desired therapeutic or diagnostic result.

[0071] "Chicken β-actin (CBA) promoter" refers to a polynucleotide sequence derived from a chicken β-actin gene (e.g., Gallus β-actin, represented by GenBank Entrez Gene ID 396526). As used herein, "chicken β-actin promoter" may refer to a promoter containing a cytomegalovirus (CMV) early enhancer element, a promoter and the first exon and intron of a chicken β-actin gene, and a splice acceptor of a rabbit β-globin gene, such as the sequence described in Miyazaki, J. et al. (1989) Gene 79 (2): 269-77. As used herein, the term "CAG promoter" may be used interchangeably. As used herein, the term "CMV early enhancer / chicken β-actin (CAG) promoter" may be used interchangeably.

[0072] The terms "genomic particles (gp)", "genomic equivalents", or "genomic copies" as used with respect to viral titer refer to the number of virions containing the recombinant AAV DNA genome, without regard to infectivity or functionality. The number of genomic particles in a particular vector preparation can be measured by procedures such as those described in the Examples herein or, for example, in Clark et al. (1999) Hum. Gene Ther. [Human Gene Therapy], 10: 1031-1039; Veldwijk et al. (2002) Mol. Ther. [Molecular Therapy], 6: 272-278.

[0073] The term "vector genome (vg)" as used herein may refer to one or more polynucleotides of a set of polynucleotide sequences comprising a vector (e.g., a viral vector). The vector genome may be encapsidated in a viral particle. Depending on the specific viral vector, the vector genome may comprise single-stranded DNA, double-stranded DNA, or single-stranded RNA or double-stranded RNA. The vector genome may include endogenous sequences associated with a specific viral vector and / or any heterologous sequences inserted into a specific viral vector by recombinant techniques. For example, a recombinant AAV vector genome may include at least one ITR sequence on both sides of a promoter, a stuffing sequence, a target sequence (e.g., RNAi), and a polyadenylation sequence. A complete vector genome may include a complete set of polynucleotide sequences of a vector. In certain embodiments, the nucleic acid titer of a viral vector may be measured according to vg / mL. Methods suitable for measuring this titer are known in the art (e.g., quantitative PCR).

[0074] The terms "infectious unit (iu)", "infectious particles" or "replication units" as used in reference to viral titers refer to the number of infectious and replication-competent recombinant AAV vector particles measured by the infectious center assay (also called the replication center assay), as described, for example, in McLaughlin et al. (1988) J. Virol., 62: 1963-1973.

[0075] The term "transducing unit (tu)" as used in reference to viral titer refers to the number of infectious recombinant AAV vector particles that result in the production of a functional transgene product, as measured in a functional assay such as described in the Examples herein or, for example, in Xiao et al. (1997) Exp. Neurobiol., 144: 113-124; or Fisher et al. (1996) J. Virol., 70: 520-532 (LFU assay).

[0076] "Inverted terminal repeat" or "ITR" sequence is a term well known in the art and refers to relatively short sequences in opposite orientation found at the ends of a viral genome.

[0077] The "AAV inverted terminal repeat (ITR)" sequence is a term well known in the art and is a sequence of approximately 145 nucleotides present at both ends of the native single-stranded AAV genome. The outermost 125 nucleotides of the ITR can exist in either of two alternative orientations, resulting in heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter self-complementary regions (designated as region A, region A', region B, region B', region C, region C', and region D) that allow intrastrand base pairing to occur within this portion of the ITR.

[0078] "Terminal resolution sequence" or "trs" is a sequence in the D region of the AAV ITR that is cleaved by the AAV rep protein during viral DNA replication. Mutant terminal resolution sequences are resistant to cleavage by the AAV rep protein.

[0079] "AAV helper function" refers to a function that allows AAV to be replicated and packaged by a host cell. AAV helper function can be provided in any of a variety of forms, including but not limited to a helper virus or helper virus gene that assists in AAV replication and packaging. Other AAV helper functions are known in the art, such as genotoxic agents.

[0080] The "helper virus" of AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by host cells. The helper virus provides a "helper function" that allows AAV to replicate. Many such helper viruses have been identified, including adenovirus, herpes virus and poxvirus such as vaccinia and baculovirus. Adenovirus covers many different subgroups, but adenovirus type 5 (Ad5) of subgroup C is the most commonly used. Many adenoviruses of human, non-human mammalian and avian origin are known and can be obtained from depository institutions such as ATCC. Viruses of the herpes family that can also be obtained from depository institutions such as ATCC include, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV) and pseudorabies virus (PRV). Examples of adenovirus helper functions for AAV replication include E1A function, E1B function, E2A function, VA function and E4orf6 function. Baculoviruses available from depository institutions include Autographacalifornica nuclear polyhedrosis virus.

[0081] If the ratio of infectious AAV particles to infectious helper virus particles is at least about 10 2 :l; at least about 10 4 :1, at least about 10 6 :1; or at least about 10 8 :1 or greater, then the rAAV preparation is said to be "substantially free" of helper virus. In some embodiments, the preparation also does not contain an equivalent amount of helper virus protein (i.e., if the above-mentioned helper virus particle impurities are present in a disrupted form, the protein present due to such level of helper virus). Viral and / or cellular protein contamination can generally be observed on SDS gels as the presence of Coomassie-stained bands (e.g., the appearance of bands other than those corresponding to AAV capsid proteins VP1, VP2, and VP3).

[0082] An "effective amount" is an amount sufficient to achieve beneficial or desired results, including clinical results (e.g., improvement of symptoms, achievement of clinical endpoints, etc.). An effective amount can be administered in one or more administrations. With respect to a disease state, an effective amount is an amount sufficient to ameliorate, stabilize, or delay the progression of the disease.

[0083] An "individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.

[0084] As used herein, "treatment" is a method for obtaining a beneficial or desired clinical outcome. For the purposes of this disclosure, beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms, reduction of disease extent, stabilization of disease state (e.g., no deterioration), prevention of disease transmission (e.g., metastasis), delay or slowing of disease progression, improvement or alleviation of disease state, and detectable or undetectable relief (partial or complete). "Treatment" can also mean extending survival rate compared to the expected survival rate without treatment.

[0085] As used herein, the term "prophylactic treatment" refers to treatment in which an individual is known or suspected to have a disorder or is at risk for a disorder, but has not yet exhibited symptoms of the disorder or has exhibited minimal symptoms of the disorder. An individual undergoing prophylactic treatment may be treated prior to the onset of symptoms.

[0086] Reference herein to "about" a value or parameter includes (and describes) embodiments involving the value or parameter itself. For example, description referring to "about X" includes description of "X".

[0087] As used herein, the singular forms "a," "an," and "the" include plural referents unless otherwise indicated.

[0088] It should be understood that the aspects and embodiments of the present disclosure described herein include "comprising the aspects and embodiments," "consisting of the aspects and embodiments," and / or "consisting essentially of the aspects and embodiments." Expression Components

[0089] In some embodiments, the transgenic encoding ARSA polypeptide is codon optimized. In some embodiments, the transgenic encoding ARSA polypeptide is codon optimized for expression in specific cells (e.g., eukaryotic cells). Eukaryotic cells can be cells of specific organisms (e.g., mammals, including but not limited to humans, mice, rats, rabbits, dogs, or non-human primates) or cells derived from the specific organisms. In general, codon optimization refers to the use of more frequent or most frequently used codons in the genes of the host cell while maintaining the native amino acid sequence to replace at least one codon of the native sequence, thereby modifying the nucleic acid sequence to enhance the process of expression in the host cell of interest. Various species show specific preferences for certain codons of specific amino acids. For example, codon usage tables can be easily obtained in the "codon usage database", and these tables can be adjusted in a variety of ways (see, for example, Nakamura, Y. et al. (2000) Nucleic Acids Res. [Nucleic Acids Research] 28: 292). Computer algorithms for codon optimization of specific sequences for expression in specific host cells are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), DNA2.0, GeneArt (GA) or Genscript (GS) and GS algorithms combined with reduced CpG content. In some embodiments, the transgenic encoding ARSA polypeptides is codon optimized using the GA algorithm. In some embodiments, the transgenic encoding ARSA polypeptides has the sequence of SEQ ID NO: 1.

[0090] In some embodiments, the expression component further comprises an intron. Various introns used in the present invention are known to those skilled in the art, and these introns include MVM introns, FIX truncated intron 1, β-globin SD / immunoglobin heavy chain SA, adenovirus SD / immunoglobin SA, SV40 late SD / SA (19S / 16S) and hybrid adenovirus SD / IgG SA. (Wu et al., 2008, Kurachi et al., 1995, Choi et al., 2014, Wong et al., 1985, Yew et al., 1997, Huang and Gorman (1990)). In some embodiments, the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid intron. In some embodiments, the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid promoter and intron, wherein all ATG sites are removed to minimize the wrong translation start site. In some embodiments, the intron is an MVM intron, F IX truncated intron 1, β-globin SD / immunoglobin heavy chain SA, adenovirus SD / immunoglobin SA, SV40 late SD / SA (19S / 16S) or hybrid adenovirus SD / IgG SA. In some embodiments, the intron is a chicken β-actin (CBA) / rabbit β-globin hybrid intron.

[0091] In some embodiments, the expression component further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK pA. In some embodiments, the polyadenylation signal is a synthetic polyadenylation signal as described in Levitt, N et al. (1989), Genes Develop. 3: 1019-1025.

[0092] In some embodiments, the expression component includes a stuffing nucleic acid. In some embodiments, the stuffing nucleic acid may include a sequence encoding a reporter polypeptide. As will be understood by those skilled in the art, the stuffing nucleic acid may be located in multiple regions within the nucleic acid, and may be composed of a continuous sequence within the nucleic acid (e.g., a single stuffing nucleic acid in a single position) or multiple sequences (e.g., more than one stuffing nucleic acid in more than one position (e.g., 2 positions, 3 positions, etc.)). In some embodiments, the stuffing nucleic acid may be located downstream of the transgenic encoding the ARSA polypeptide. In an embodiment, the stuffing nucleic acid may be located upstream of the transgenic encoding the ARSA polypeptide (e.g., between the promoter and the transgenic). It will also be understood by those skilled in the art that a variety of nucleic acids can be used as stuffing nucleic acids. In some embodiments, the stuffing nucleic acid includes all or part of a human α1-antitrypsin (AAT) stuffing sequence or a C16 P1 chromosome 16P1 clone (human C16) stuffing sequence. In some embodiments, the stuffing sequence includes all or part of a gene. For example, the stuffing sequence includes a portion of a human AAT sequence. It will be appreciated by those skilled in the art that different parts of a gene (e.g., a human AAT sequence) can be used as stuffing fragments. For example, the filler fragment can be from the 5' end of the gene, the 3' end of the gene, the middle of the gene, the non-coding portion of the gene (e.g., an intron), the coding region of the gene (e.g., an exon), or a mixture of the non-coding portion and the coding portion of the gene. Those skilled in the art will also recognize that all or part of the filler sequence can be used as a filler sequence. In some embodiments, the filler sequence is modified to remove internal ATG codons.

[0093] In some embodiments, the expression component is incorporated into a vector. In some embodiments, the expression component is incorporated into a viral vector. In some embodiments, the viral vector is an rAAV vector as described herein. Vectors and viral particles

[0094] In certain aspects, the expression assembly for expressing ARSA polypeptide (e.g., wild-type human ARSA polypeptide) is included in a vector. In certain embodiments, the present invention contemplates the use of recombinant viral genomes to introduce nucleic acid sequences encoding ARSA polypeptides to be packaged into viral particles, such as viral particles described below. The recombinant viral genome may include any element used to establish the expression of ARSA polypeptides, such as promoters, ITRs, ribosome binding elements, terminators, enhancers, selection markers, introns, polymer A (polyA) signals and / or replication origins. Exemplary viral genome elements and delivery methods of viral particles are described in more detail below. Non-viral delivery systems

[0095] Conventional non-viral gene transfer methods can also be used to introduce nucleic acid into cells or target tissues. Non-viral vector delivery systems include DNA plasmids, naked nucleic acids, and nucleic acids compounded with delivery systems. For example, the carrier can be compounded with lipids (e.g., cations or neutral lipids), liposomes, polycations, nanoparticles, or agents that enhance the cellular uptake of nucleic acids. The carrier can be compounded with agents suitable for any delivery method described herein. In certain embodiments, the nucleic acid comprises one or more viral ITRs (e.g., AAV ITRs). Virus particles

[0096] In some embodiments, the vector comprising an expression assembly for expressing an ARSA polypeptide (e.g., a wild-type human ARSA polypeptide) is a recombinant viral vector. Some examples of recombinant viral vectors include AAV, lentivirus, and adenovirus. In one aspect, the viral vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression assembly for expressing an ARSA polypeptide (e.g., a wild-type human ARSA polypeptide) is flanked by one or more AAV reverse terminal repeat (ITR) sequences. In some embodiments, the viral particle is a recombinant AAV particle comprising an expression assembly for expressing an ARSA polypeptide, and the expression assembly is flanked by one or two ITRs. In some embodiments, the expression assembly for expressing an ARSA polypeptide is flanked by two AAV ITRs.

[0097] In some embodiments, the expression assembly for expressing ARSA polypeptide disclosed herein is operably connected to components, control sequences (including transcription start sequence and termination sequence) in the transcription direction to form an expression assembly. The expression assembly is flanked by at least one functional AAV ITR sequence at the 5' end and the 3' end. "Functional AAV ITR sequence" means that the function of the ITR sequence is as expected for the rescue, replication and packaging of AAV virions. See Davidson et al., PNAS [Proceedings of the National Academy of Sciences of the United States], 2000, 97 (7) 3428-32; Passini et al., J. Virol. [Journal of Virology], 2003, 77 (12): 7034-40; and Pechan et al., Gene Ther. [Gene Therapy], 2009, 16: 10-16, all of which are incorporated herein by reference in their entirety. In order to practice some aspects of the present invention, the recombinant vector contains at least all AAV sequences necessary for encapsidation and a physical structure for rAAV infection. AAV ITRs for use in the vectors of the invention need not have wild-type nucleotide sequences (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801), and may be altered by insertion, deletion, or substitution of nucleotides, or may be derived from any of several AAV serotypes. Currently, more than 40 serotypes of AAV are known, and new serotypes and variants of existing serotypes continue to be identified. See Gao et al., PNAS, 2002, 99(18):11854-6; Gao et al., PNAS, 2003, 100(10):6081-6; and Bossis et al., J. Virol, 2003, 77(12):6799-810.

[0098] The use of any AAV serotype is considered to be within the scope of the present invention. In some embodiments, the rAAV vector is a vector derived from an AAV serotype, including but not limited to AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAV.rh10, AAV11, AAV12, goat AAV, bovine AAV or mouse AAVITR, etc. In some embodiments, the nucleic acid in AAV comprises ITRs, and AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, goat AAV, bovine AAV or mouse AAV, etc. In certain embodiments, the AAV ITR is an AAV2 ITR.

[0099] In some embodiments, the vector may include a filler nucleic acid. In some embodiments, the filler nucleic acid may encode green fluorescent protein (GFP). In some embodiments, the filler nucleic acid may be located at the 3' place of the expression component for expressing the ARSA polypeptide of the present disclosure.

[0100] In some aspects, the present invention provides virus particles comprising a recombinant self-complementary genome. In some embodiments, the vector is a self-complementary vector. AAV virus particles with self-complementary genomes and methods using self-complementary AAV genomes are described in the following documents: U.S. Patent Nos. 6,596,535; 7,125,717; 7,765,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z. et al., (2003) Gene Ther [Gene Therapy] 10: 2105-2111, each of which is incorporated herein by reference in its entirety. rAAV comprising a self-complementary genome will quickly form a double-stranded DNA molecule by relying on its partially complementary sequence (e.g., complementary coding strands and non-coding strands of a transgenic). In some embodiments, the present invention provides AAV viral particles comprising an AAV genome, wherein the rAAV genome comprises a first heterologous polynucleotide sequence (e.g., a coding strand of an ARSA polypeptide of the present invention) and a second heterologous polynucleotide sequence (e.g., a non-coding or antisense strand of an ARSA polypeptide of the present disclosure), wherein the first heterologous polynucleotide sequence can form intrastrand base pairs with the second polynucleotide sequence along most or all of its length.

[0101] In some embodiments, the first heterologous polynucleotide sequence and the second heterologous polynucleotide sequence are connected by a sequence that promotes intrachain base pairing (e.g., a hairpin DNA structure). Hairpin structures are known in the art, for example, in siRNA molecules. In some embodiments, the first heterologous polynucleotide sequence and the second heterologous polynucleotide sequence are connected by a mutated ITR (e.g., right ITR). The mutated ITR comprises a deletion in the D region containing the terminal resolution sequence. Therefore, when the AAV viral genome is replicated, the rep protein will not cut the viral genome at the mutated ITR, and therefore, the recombinant viral genome containing the following items in 5' to 3' order will be packaged in the viral capsid: AAV ITR, a first heterologous polynucleotide sequence comprising a regulatory sequence, a mutated AAV ITR, a second heterologous polynucleotide in the opposite orientation to the first heterologous polynucleotide, and a third AAVITR.

[0102] In some embodiments, the first heterologous nucleic acid sequence and the second heterologous nucleic acid sequence are connected by a mutated ITR (e.g., the right ITR). In some embodiments, the ITR comprises a polynucleotide sequence 5'-CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG-3' (SEQ ID NO: 15). The mutated ITR comprises a deletion of the D region containing the terminal resolution sequence. Therefore, when the AAV viral genome is replicated, the rep protein will not cut the viral genome at the mutated ITR, and therefore, the recombinant viral genome comprising the following items in 5' to 3' order will be packaged in the viral capsid: AAV ITR, a first heterologous polynucleotide sequence comprising a regulatory sequence, a mutated AAV ITR, a second heterologous polynucleotide in the opposite orientation to the first heterologous polynucleotide, and a third AAV ITR.

[0103] In some embodiments, the vector is encapsidated in a viral particle. In some embodiments, the viral particle is a recombinant AAV viral particle comprising a recombinant AAV vector. Different AAV serotypes are used to optimize the transduction of specific target cells or to target specific cell types in specific target tissues (e.g., brain or spinal cord). The rAAV particles may include viral proteins and viral nucleic acids of the same serotype or mixed serotypes. For example, in some embodiments, the rAAV particles may include a modified AAV1999 capsid protein and at least one AAV2 ITR, or it may include a modified AAV1999 capsid protein and at least one AAV1 ITR. Any combination of AAV serotypes for producing rAAV particles is provided herein, as if each combination is explicitly stated herein.

[0104] It is known that the capsid of AAV (e.g., AAV9, AAV1999, etc.) includes three capsid proteins: VP1, VP2 and VP3. These proteins contain a large number of overlapping amino acid sequences and unique N-terminal sequences. The AAV9 capsid includes 60 subunits arranged in icosahedral symmetry. AAV9 includes VP1, VP2 and VP3 capsid proteins at a ratio of about 5:5:50. The VP protein of AAV9 is the product of the open reading frame encoding structural proteins of the genome, called cap, VP1 (about 82kDa) and VP2 (about 73kDa) as minor capsid proteins, and VP3 (about 61kDa) as the major capsid protein. Due to the use of both selective splicing and leaky scanning, when expressed, individual VPs share a C-terminus covering the entire VP3, while VP1 and VP2 are N-terminal VP3 extensions. VP1 and VP2 share a region of about 73 amino acids, which extends an additional about 137 amino acids in VP1, called the VP1 unique region (VP1u). See Penzes et al., (2021), Journal of Virology 95(19)e0084321. In some embodiments of the modified AAV9 capsid proteins disclosed herein, the targeting peptide (e.g., SEQ ID NO: 10) is incorporated into VP1. In some embodiments of the modified AAV9 capsid proteins disclosed herein, the targeting peptide (e.g., SEQ ID NO: 10) is incorporated into VP2. In some embodiments of the modified AAV9 capsid proteins disclosed herein, the targeting peptide (e.g., SEQ ID NO: 10) is incorporated into VP3. In some embodiments of the modified AAV9 capsid proteins disclosed herein, the targeting peptide (e.g., SEQ ID NO: 10) is incorporated into VP1, VP2, and VP3.

[0105] In some embodiments, the present disclosure provides rAAV particles for administering ARSA polypeptides in CSF, which rAAV particles include modified AAV9 capsid proteins, and the modified AAV9 capsid proteins include targeting peptides for targeting rAAV particles to the brain. In a specific embodiment, the targeting peptide of the modified AAV9 capsid is inserted after residue 588 of the AAV9 structural protein. In some embodiments, the targeting peptide has SEQ ID NO: 10. In some embodiments, the targeting peptide is flanked by a joint sequence at the N-terminal and C-terminal sides of the targeting peptide. In some embodiments, the joint sequence on the N-terminal side has the sequence AAA. In some embodiments, the joint sequence on the C-terminal side is AS. In some embodiments, the complete sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO: 11.

[0106] In some embodiments, the complete modified AAV9 capsid structural protein (VP1) has the sequence of SEQ ID NO: 12. In some embodiments, the complete modified AAV9 capsid structural protein (VP1) is at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 12, wherein the modified AAV9 structural capsid comprises a targeting peptide of SEQ ID NO: 10.

[0107] In some embodiments, the modified VP2 capsid of the AAV9 capsid has the sequence of SEQ ID NO: 13. In some embodiments, the modified VP2 capsid of AAV9 has a sequence at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 13, wherein the modified AAV9 structural capsid comprises the targeting peptide of SEQ ID NO: 10.

[0108] In some embodiments, the modified VP3 capsid of the AAV9 capsid has the sequence of SEQ ID NO: 14. In some embodiments, the modified VP3 capsid of AAV9 has a sequence at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 14, wherein the modified AAV9 structural capsid comprises the targeting peptide of SEQ ID NO: 10. Production of AAV particles

[0109] Many methods are known in the art for producing rAAV vectors, including transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpes virus-AAV hybrids (Conway, JE et al., (1997) J. Virology[Journal of Virology] 71 (11): 8780-8789) and baculovirus-AAV hybrids (Urabe, M. et al., (2002) Human Gene Therapy [Human Gene Therapy] 13 (16): 1935-1943; Kotin, R. (2011) Hum Mol Genet. [Human Molecular Genetics] 20 (R1): R2-R6). The rAAV production culture for producing rAAV virus particles all requires: 1) a suitable host cell, 2) a suitable helper virus function, 3) AAV rep and cap genes and gene products; 4) a nucleic acid (e.g., a therapeutic nucleic acid) flanking at least one AAV ITR sequence (e.g., an AAV genome encoding an ARSA polypeptide); and 5) a suitable culture medium and culture medium components that support rAAV production. In some embodiments, the suitable host cell is a primate host cell. In some embodiments, the suitable host cell is a human cell line, such as HeLa, A549, 293 or Perc.6 cells. In some embodiments, suitable helper virus functions are provided by wild-type or mutant adenovirus (e.g., temperature-sensitive adenovirus), herpes virus (HSV), baculovirus, or a plasmid construct providing helper functions. In some embodiments, AAV rep and cap gene products can be from any AAV serotype. Generally speaking, but not necessarily, the AAV rep gene product has the same serotype as the ITR of the rAAV vector genome, as long as the rep gene product can play a role in replicating and packaging the rAAV genome. Suitable culture media known in the art can be used to produce rAAV vectors. These culture media include, but are not limited to, culture media produced by Hyclone Laboratories and JRH, including modified Eagle's medium (MEM), Dulbecco's modified Eagle's medium (DMEM), custom formulations such as those described in U.S. Pat. No. 6,566,118, and Sf-900 II SFM culture media as described in U.S. Pat. No. 6,723,551, each of which is incorporated herein by reference in its entirety, particularly with respect to custom culture media formulations for producing recombinant AAV vectors. In some embodiments, the AAV helper functions are provided by adenovirus or HSV. In some embodiments, the AAV helper functions are provided by baculovirus and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).

[0110] One method for producing rAAV particles is triple transfection. In short, a plasmid containing a rep gene and a capsid gene can be transfected (e.g., using a calcium phosphate method) into a cell line (e.g., HEK-293 cells) together with an auxiliary adenovirus plasmid, and the virus can be collected and optionally purified. Therefore, in some embodiments, rAAV particles are produced by triple transfection of a nucleic acid encoding a rAAV vector, a nucleic acid encoding AAV rep and cap, and a nucleic acid encoding an AAV helper virus function into a host cell, wherein the nucleic acid is transfected into the host cell to produce a host cell capable of producing rAAV particles.

[0111] In some embodiments, rAAV particles can be produced by a production cell line method (see Martin et al., (2013) Human Gene Therapy Methods [human gene therapy method] 24: 253-269; U.S. PG Publication No. US2004 / 0224411; and Liu, XL et al. (1999) Gene Ther. [gene therapy] 6: 293-299). In short, a cell line (e.g., HeLa, 293, A549 or Perc.6 cell line) can be stably transfected with a plasmid containing a rep gene, a capsid gene and a vector genome (e.g., ARSA polypeptide) containing a promoter heterologous nucleic acid sequence. Cell lines can be screened to select leading clones for rAAV production, and then the leading clones can be amplified into a production bioreactor and infected with a helper virus (e.g., adenovirus or HSV) to start rAAV production. The virus can then be harvested, the adenovirus can be inactivated (e.g., by heating) and / or removed, and the rAAV particles can be purified. Thus, in some embodiments, rAAV particles are produced by a production cell line comprising one or more of the following: nucleic acid encoding a rAAV vector, nucleic acid encoding AAV rep and cap, and nucleic acid encoding AAV helper virus functions. As described herein, the production cell line approach may be advantageous for producing rAAV particles with very large genomes compared to the triple transfection approach.

[0112] In some embodiments, nucleic acids encoding AAV rep and cap genes and / or rAAV genomes are stably maintained in production cell lines. In some embodiments, nucleic acids encoding AAV rep and cap genes and / or rAAV genomes are introduced into cell lines on one or more plasmids to produce production cell lines. In some embodiments, AAV rep, AAV cap and rAAV genomes are introduced into cells on the same plasmid. In other embodiments, AAV rep, AAV cap and rAAV genomes are introduced into cells on different plasmids. In some embodiments, cell lines stably transfected with plasmids maintain plasmids in multiple passages (e.g., 5, 10, 20, 30, 40, 50 or more than 50 passages of cells) of cell lines. For example, one or more plasmids can be replicated as cells replicate, or one or more plasmids can be integrated into the cell genome. A variety of sequences that enable plasmids to replicate autonomously in cells (e.g., human cells) have been identified (see, e.g., Krysan, PJ et al. (1989) Mol. Cell Biol. [Molecular and Cell Biology] 9: 1026-1033). In certain embodiments, one or more plasmids may include a selective marker (e.g., an antibiotic resistance marker) that allows selection of cells that retain the plasmid. Selective markers commonly used in mammalian cells include, but are not limited to, blasticidin, G418, hygromycin B, zeocin, puromycin and derivatives thereof. Methods for introducing nucleic acids into cells are known in the art, and include, but are not limited to, viral transduction, cationic transfection (e.g., using cationic polymers such as DEAE-dextran or cationic lipids such as liposomes), calcium phosphate transfection, microinjection, particle bombardment, electroporation and nanoparticle transfection (see, for example, Kim, TK and Eberwine, JH (2010) Anal. Bioanal. Chem. [Analysis and Bioanalytical Chemistry] 397: 3173-3178 for more details).

[0113] In some embodiments, nucleic acids encoding AAV rep and cap genes and / or rAAV genomes are stably integrated into the genome of the production cell line. In some embodiments, nucleic acids encoding AAV rep and cap genes and / or rAAV genomes are introduced into the cell line on one or more plasmids to produce the production cell line. In some embodiments, AAV rep, AAVcap and rAAV genomes are introduced into cells on the same plasmid. In other embodiments, AAV rep, AAV cap and rAAV genomes are introduced into cells on different plasmids. In some embodiments, one or more plasmids may include a selective marker (e.g., an antibiotic resistance marker) that allows selection of cells that retain plasmids. Methods known in the art for stably integrating nucleic acids into various host cell lines. For example, cells containing nucleic acids of selective markers (and AAV cap and rep genes and / or rAAV genomes) can be selected using repeated selection (e.g., by using a selective marker). In other embodiments, nucleic acids can be integrated into the cell line in a site-specific manner to produce a production cell line. Several site-specific recombination systems are known in the art, such as FLP / FRT (see, e.g., O'Gorman, S. et al. (1991) Science 251:1351-1355), Cre / loxP (see, e.g., Sauer, B. and Henderson, N. (1988) Proc. Natl. Acad. Sci. 85:5166-5170), and phi C31-att (see, e.g., Groth, AC et al. (2000) Proc. Natl. Acad. Sci. 97:5995-6000).

[0114] In some embodiments, the production cell line is derived from a primate cell line (e.g., a non-human primate cell line, such as a Vero or FRhL-2 cell line). In some embodiments, the cell line is derived from a human cell line. In some embodiments, the production cell line is derived from HeLa, 293, A549, or (Crucell) cells. For example, before nucleic acids encoding AAV rep and cap genes and / or super-large rAAV genomes are introduced and / or stably maintained / integrated into a cell line to generate a production cell line, the cell line is HeLa, 293, A549 or (Crusell) cell line or its derivatives.

[0115] In some embodiments, the production cell line is adapted to grow in suspension. As is known in the art, anchorage-dependent cells are generally unable to grow in suspension without a substrate (e.g., microcarrier beads). Adapting the cell line to grow in suspension may include, for example, growing the cell line in a rotating culture medium with a stirring paddle, using a culture medium lacking calcium and magnesium ions (and an optional defoamer) to prevent aggregation, using a culture container coated with a siliconized compound, and selecting cells in the culture (rather than cells that are large aggregates or located on the side of the container) at each passage. For further explanation, see, for example, the ATCC FAQ document (available at www.atcc.org / Global / FAQs / 9 / 1 / Adapting%20a%20monolayer%20cell%20line%20to%20suspension-40.aspx) and the references cited therein.

[0116] In some aspects, a method for producing any rAAV particle as disclosed herein is provided, the method comprising (a) culturing a host cell under conditions for producing rAAV particles, wherein the host cell comprises (i) one or more AAV packaging genes, wherein each of the AAV packaging genes encodes an AAV replication and / or encapsidation protein; (ii) a rAAV provector comprising a nucleic acid encoding a heterologous nucleic acid as described herein, the nucleic acid flanked by at least one AAV ITR, and (iii) AAV helper functions; and (b) recovering the rAAV particles produced by the host cell. In some embodiments, the at least one AAV ITR is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, goat AAV, bovine AAV or mouse AAV serotype ITRs, etc. For example, in some embodiments, the AAV serotype is AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, or AAVrh 10. In certain embodiments, the nucleic acid in the AAV comprises AAV2 ITRs. In some embodiments, the encapsidation protein is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV1999, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2N587A, AAV2 E548A, AAV2 N708A, AAV V708K, goat AAV, AAV1 / AAV2 chimera, bovine AAV, mouse AAV capsid, rAAV2 / HBoV1 serotype, AAV-XL32 or AAV-XL32.1 capsid protein or a mutant thereof. In some embodiments, the encapsidation protein is an AAV8 capsid protein. In some embodiments, the rAAV particles comprise an AAV9 capsid and a recombinant genome comprising AAV2 ITRs, and a nucleic acid encoding a therapeutic transgene / nucleic acid (e.g., an expression component for expressing an ARSA polypeptide). In some embodiments, the rAAV particles comprise an AAV1999 capsid and a recombinant genome comprising AAV2 ITRs, and a nucleic acid encoding a therapeutic transgene / nucleic acid (e.g., an expression component for expressing an ARSA polypeptide).

[0117] Suitable rAAV production medium of the present invention can be supplemented with serum or serum-derived recombinant proteins at a level of 0.5%-20% (v / v or w / v). Alternatively, as known in the art, rAAV vectors can be produced under serum-free conditions, which can also be referred to as a medium without animal-derived products. It will be appreciated by those of ordinary skill in the art that commercial or custom culture media designed to support the production of rAAV vectors can also be supplemented with one or more cell culture components known in the art, including but not limited to glucose, vitamins, amino acids and / or growth factors, to increase the titer of rAAV in the production culture.

[0118] rAAV production cultures can be grown under a variety of conditions (over a wide temperature range, for different lengths of time, etc.) suitable for the specific host cells used. As is known in the art, rAAV production cultures include attachment-dependent cultures that can be cultured in suitable attachment-dependent containers, such as roller bottles, hollow fiber filters, microcarriers, and packed beds or fluidized bed bioreactors. rAAV vector production cultures can also include suspension-adapted host cells, such as HeLa, 293, and SF-9 cells, which can be cultured in a variety of ways, including, for example, spinner flasks, stirred tank bioreactors, and disposable systems such as wave bag systems.

[0119] The rAAV vector particles of the invention can be harvested from rAAV production cultures by lysing the host cells of the production culture or by harvesting spent culture medium from the production culture, provided that the cells are cultured under conditions known in the art to allow release of rAAV particles from intact cells into the culture medium, as more fully described in U.S. Pat. No. 6,566,118). Suitable methods for lysing cells are also known in the art and include, for example, multiple freeze / thaw cycles, sonication, microfluidization, and treatment with chemicals such as detergents and / or proteases.

[0120] In another embodiment, rAAV particles are purified. As used herein, the term "purification" includes preparations of rAAV particles that do not contain at least some other components, which may also be present in places where rAAV particles naturally exist or are initially prepared. Therefore, for example, separated rAAV particles can be prepared by enriching them from source mixtures such as culture lysates or production culture supernatants using purification techniques. Enrichment can be measured in a variety of ways, such as by the ratio of DNA enzyme-resistant particles (DRP) or genome copies (gc) present in the solution, or by infectivity, or enrichment can be measured relative to a second potential interfering substance present in the source mixture, the second potential interfering substance such as a contaminant, including production culture contaminants or process contaminants, including helper viruses, culture medium components, etc.

[0121] In some embodiments, the rAAV production culture harvest is clarified to remove host cell debris. In some embodiments, the production culture harvest is clarified by filtering through a series of depth filters, including, for example, DOHC-grade Millipore Millistak+HC Pod filter, A1HC-grade Millipore Millistak+HC Pod filter, and 0.2 μm filter Opticap XL10 Millipore Express SHC Hydrophilic Membrane filter. Clarification can also be achieved by various other standard techniques known in the art, such as centrifugation or filtering through any cellulose acetate filter of 0.2 μm or larger pore size known in the art.

[0122] In some embodiments, further The rAAV production culture harvest is treated to digest any high molecular weight DNA present in the production culture. In some embodiments, the production culture is carried out under standard conditions known in the art. Digestion, such standard conditions include, for example, at temperatures between ambient temperature and 37°C The final concentration is 1-2.5 units / ml for a period of 30 minutes to several hours.

[0123] rAAV particles may be isolated or purified using one or more of the following purification steps: equilibrium centrifugation; flow-through anion exchange filtration; tangential flow filtration (TFF) for concentrating rAAV particles; capture of rAAV by apatite chromatography; heat inactivation of helper virus; capture of rAAV by hydrophobic interaction chromatography; buffer exchange by size exclusion chromatography (SEC); nanofiltration; and capture of rAAV by anion exchange chromatography, cation exchange chromatography, or affinity chromatography. These steps may be used alone, in various combinations, or in different orders. In some embodiments, the method includes all steps in the order described below. Methods for purifying rAAV particles are found, for example, in Xiao et al., (1998) Journal of Virology 72: 2224-2232; U.S. Pat. Nos. 6,989,264 and 8,137,948; and WO 2010 / 148143. Treatment

[0124] Certain aspects of the present disclosure relate to methods for treating MLD and / or improving the level of ARSA polypeptides in individuals in need. In some embodiments, the present invention provides methods for treating MLD by administering an effective amount of an expression assembly (e.g., an expression assembly delivered in rAAV particles), which is used to express the ARSA polypeptides disclosed herein. In some embodiments, the ARSA polypeptide is a wild-type ARSA polypeptide. The expression assembly (e.g., an expression assembly delivered in rAAV particles) for expressing the ARSA polypeptide can be administered by various routes. In some embodiments, the administration includes direct spinal injection and / or intracerebral administration. In some embodiments, the administration is performed at a site selected from the following: cerebrum, medulla, pons, cerebellum, intracranial cavity, meninges around the brain, dura mater, arachnoid, pia mater, cerebrospinal fluid (CSF) in the subarachnoid space around the brain, deep cerebellar nuclei, cerebral ventricular system, subarachnoid space, striatum, cortex, septum, thalamus, hypothalamus and brain parenchyma. In some embodiments, the administration includes intraventricular injection into at least one lateral ventricle of the brain. In some embodiments, the administration comprises intrathecal injection in the cervical, thoracic and / or lumbar regions. In some embodiments, the administration comprises intrastriatal injection. In some embodiments, the administration comprises intrathalamic injection.

[0125] An effective amount of rAAV (in the form of particles in some embodiments) is administered according to the therapeutic goal. For example, when a low percentage of transduction can achieve the desired therapeutic effect, the goal of treatment is usually to meet or exceed this transduction level. In some cases, this transduction level can be achieved by transducing only about 1% to 5% of the target cells of the desired tissue type, transducing at least about 20% of the cells of the desired tissue type in some embodiments, transducing at least about 50% of the cells of the desired tissue type in some embodiments, transducing at least about 80% of the cells of the desired tissue type in some embodiments, transducing at least about 95% of the cells of the desired tissue type in some embodiments, and transducing at least about 99% of the cells of the desired tissue type in some embodiments. The rAAV composition can be administered by one or more administrations, can be administered during the same procedure, or can be administered at intervals of several days, weeks, months or years. One or more of any administration routes described herein can be used. In some embodiments, multiple vectors can be used to treat humans.

[0126] In some embodiments of the above aspects, the rAAV is administered via direct injection into the spinal cord, by intrathecal injection, or by intracisternal injection. In some embodiments, the rAAV is administered to more than one location in the spinal cord or cisterns. In some embodiments, the rAAV is administered to more than one location in the spinal cord. In some embodiments, the rAAV is administered to one or more of the lumbar subarachnoid space, thoracic subarachnoid space, and cervical subarachnoid space of the spinal cord. In some embodiments, the rAAV is administered to the cisterns.

[0127] Methods for identifying cells transduced by AAV viral particles are known in the art; for example, immunohistochemistry or the use of a marker (e.g., enhanced green fluorescent protein) can be used to detect transduction of viral particles; for example, transduction of viral particles comprising an rAAV capsid having one or more amino acid substitutions.

[0128] In some embodiments, an effective amount of rAAV particles is administered to more than one location simultaneously or sequentially. In other embodiments, an effective amount of rAAV particles is administered to a single location more than once (e.g., repeated administration). In some embodiments, multiple injections of rAAV viral particles are spaced no more than one hour, two hours, three hours, four hours, five hours, six hours, nine hours, twelve hours, or 24 hours apart.

[0129] In some embodiments, the present invention provides a method for treating a person suffering from MLD by administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an ARSA polypeptide disclosed herein. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

[0130] In some embodiments, the methods include administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an ARSA polypeptide of the disclosure to treat MLD in an individual in need thereof. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5×10 12 , 6×10 12 ,7×10 12 , 8×10 12 ,9×10 12 , 10×10 12 , 11×10 12 , 15×10 12 , 20×10 12 , 25×10 12 ,30×10 12 or 50×10 12 In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about 5×10 12 Up to 6×10 12 , 6×10 12 Up to 7×10 12 ,7×10 12 Up to 8×10 12 , 8×10 12 Up to 9×10 12 ,9×10 12 Up to 10×10 12 , 10×10 12Up to 11×10 12 , 11×10 12 Up to 15×10 12 , 15×10 12 Up to 20×10 12 , 20×10 12 Up to 25×10 12 , 25×10 12 Up to 30×10 12 ,30×10 12 Up to 50×10 12 or 50×10 12 Up to 100×10 12 In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about 5×10 12 Up to 10×10 12 , 10×10 12 Up to 25×10 12 or 25×10 12 Up to 50×10 12 In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5×10 9 , 6×10 9 ,7×10 9 , 8×10 9 ,9×10 9 , 10×10 9 , 11×10 9 , 15×10 9 , 20×10 9 , 25×10 9 ,30×10 9 or 50×10 9 In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about 5×10 9 Up to 6×10 9 , 6×10 9 Up to 7×10 9 ,7×10 9 Up to 8×10 9 , 8×10 9 Up to 9×10 9 ,9×10 9 Up to 10×10 9 , 10×10 9 Up to 11×10 9 , 11×10 9 Up to 15×10 9 , 15×10 9Up to 20×10 9 , 20×10 9 Up to 25×10 9 , 25×10 9 Up to 30×10 9 ,30×10 9 Up to 50×10 9 or 50×10 9 Up to 100×10 9 In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is about 5×10 9 Up to 10×10 9 , 10×10 9 Up to 15×10 9 , 15×10 9 Up to 25×10 9 or 25×10 9 Up to 50×10 9 In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5×10 10 , 6×10 10 ,7×10 10 , 8×10 10 ,9×10 10 , 10×10 10 , 11×10 10 , 15×10 10 , 20×10 10 , 25×10 10 ,30×10 10 , 40×10 10 or 50×10 10 In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5×10 10 Up to 6×10 10 , 6×10 10 Up to 7×10 10 ,7×10 10 Up to 8×10 10 , 8×10 10 Up to 9×10 10 ,9×10 10 Up to 10×10 10 , 10×10 10 Up to 11×10 10 , 11×10 10 Up to 15×10 10 , 15×10 10 Up to 20×10 10, 20×10 10 Up to 25×10 10 , 25×10 10 Up to 30×10 10 ,30×10 10 Up to 40×10 10 , 40×10 10 Up to 50×10 10 or 50×10 10 Up to 100×10 10 In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5×10 10 Up to 10×10 10 , 10×10 10 Up to 15×10 10 , 15×10 10 Up to 25×10 10 or 25×10 10 Up to 50×10 10 In some embodiments, the virus particles are rAAV particles. In some embodiments, the rAAV particles comprise AAV1999 capsid protein.

[0131] In some embodiments, the dose of viral particles administered to a subject is at least about 1×10 8 About 6×10 13 In some embodiments, the dose of viral particles administered to an individual is about 1×10 8 About 6×10 13 In some embodiments, the dose of viral particles administered to an individual is about 1×10 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 6×10 10 ,7×10 10 , 8×10 10 ,9×10 10 , 1×10 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 ,7×10 11 , 8×10 11 ,9×10 11 , 1×10 12, 2×10 12 , 13×10 12 , 4×10 12 , 5×10 12 , 6×10 12 ,7×10 12 , 8×10 12 ,9×10 12 or 1×10 13 Any of genomic copies / kg body weight.

[0132] In some embodiments, the total amount of viral particles administered to a subject is at least about 1×10 9 About 1×10 14 In some embodiments, the total amount of viral particles administered to an individual is about 1×10 9 About 1×10 14 In some embodiments, the total amount of viral particles administered to an individual is about 1×10 11 , 2×10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 ,7×10 11 , 8×10 11 ,9×10 11 , 1×10 12 , 2×10 12 , 3×10 12 , 4×10 12 , 5×10 12 , 6×10 12 ,7×10 12 , 8×10 12 ,9×10 12 , 1×10 13 , 2×10 13 , 13×10 13 , 4×10 13 , 5×10 13 , 6×10 13 ,7×10 13 , 8×10 13 ,9×10 13 or 1×10 14 Any of the genome copies.

[0133] The compositions of the invention (e.g., recombinant viral particles of vectors comprising an ARSA polypeptide of the present disclosure) can be used alone or in combination with one or more additional therapeutic agents for the treatment of MLD. The interval between sequential administrations can be at least (or alternatively, less than) a few minutes, hours, or days.

[0134] An effective amount of rAAV (in the form of particles in some embodiments) is administered according to the therapeutic goal. For example, when a low percentage of transduction can achieve the desired therapeutic effect, the goal of treatment is usually to meet or exceed this transduction level. In some cases, this transduction level can be achieved by transducing only about 1% to 5% of the target cells, in some embodiments, at least about 20% of the cells of the desired tissue type are transduced, in some embodiments, at least about 50% of the cells of the desired tissue type are transduced, in some embodiments, at least about 80% of the cells of the desired tissue type are transduced, in some embodiments, at least about 95% of the cells of the desired tissue type are transduced, and in some embodiments, at least about 99% of the cells of the desired tissue type are transduced. The rAAV composition can be administered by one or more administrations, can be administered during the same procedure, or can be administered at intervals of several days, weeks, months, or years. In some embodiments, multiple vectors can be used to treat mammals (e.g., humans).

[0135] In some embodiments, the rAAV compositions of the present disclosure can be used for administration to people. In some embodiments, the rAAV compositions of the present disclosure can be used for pediatric administration. In some embodiments, an effective amount of rAAV (in the form of particles in some embodiments) is administered to patients who are less than one month, less than two months, less than three months, less than four months, less than five months, less than six months, less than seven months, less than eight months, less than nine months, less than ten months, less than eleven months, less than one year old, less than 13 months, less than 14 months, less than 15 months, less than 16 months, less than 17 months, less than 18 months, less than 19 months, less than 20 months, less than 21 months, less than 22 months, less than two years old, less than three years old, less than five years old or less than seven years old.

[0136] In some embodiments, the rAAV compositions of the present disclosure can be used for administration to young adults. In some embodiments, an effective amount of rAAV (in some embodiments in the form of particles) is administered to a patient less than 12 years of age, less than 13 years of age, less than 14 years of age, less than 15 years of age, less than 16 years of age, less than 17 years of age, less than 18 years of age, less than 19 years of age, less than 20 years of age, less than 21 years of age, less than 22 years of age, less than 23 years of age, less than 24 years of age, or less than 25 years of age. Kit or product

[0137] The expression components described herein (e.g., expression components for expressing an ARSA polypeptide, such as a wild-type human ARSA polypeptide), rAAV vectors, particles and / or pharmaceutical compositions can be included, for example, in a kit or article of manufacture designed for use in one of the methods of the invention described herein.

[0138] Typically, the system includes a cannula suitable for use in the methods of the invention, one or more syringes (e.g., 1, 2, 3, 4, or more), and one or more fluids (e.g., 1, 2, 3, 4, or more).

[0139] Syringe can be any suitable syringe, as long as it can be connected to cannula to deliver fluid.In certain embodiments, the system has one syringe.In certain embodiments, the system has two syringes.In certain embodiments, the system has three syringes.In certain embodiments, the system has four or more syringes.The fluid suitable for use in the inventive method comprises the fluid as described herein, for example, one or more fluids each comprising an effective amount of one or more carriers as described herein and one or more fluids comprising one or more therapeutic agents.

[0140] In some embodiments, the kit comprises a single fluid (e.g., a pharmaceutically acceptable fluid comprising an effective amount of a carrier). In some embodiments, the kit comprises 2 fluids. In some embodiments, the kit comprises 3 fluids. In some embodiments, the kit comprises 4 or more fluids. The fluid may include a diluent, a buffer, an excipient, or any other liquid suitable for delivering, diluting, stabilizing, buffering, or otherwise transporting an expression assembly to express the ARSA polypeptide or rAAV vector composition of this disclosure as described herein or known in the art. In some embodiments, the kit comprises one or more buffers, such as a pH buffered aqueous solution. Examples of buffers may include, but are not limited to, phosphate, citrate, Tris, HEPES, and other organic acid buffers.

[0141] In some embodiments, the kit includes a container. Suitable containers may include, for example, vials, bags, syringes, and bottles. The container may be made of one or more materials such as glass, metal, or plastic. In some embodiments, the container is used to hold the rAAV composition of the present disclosure. In some embodiments, the container may also hold fluids and / or other therapeutic agents.

[0142] In some embodiments, the kit comprises an additional therapeutic agent and the rAAV composition of the present disclosure. In some embodiments, the rAAV composition and the additional therapeutic agent can be mixed. In some embodiments, the rAAV composition and the additional therapeutic agent can be kept separate. In some embodiments, the rAAV composition and the additional therapeutic agent can be in the same container. In some embodiments, the rAAV composition and the additional therapeutic agent can be in different containers. In some embodiments, the rAAV composition and the additional therapeutic agent can be administered simultaneously. In some embodiments, the rAAV composition and the additional therapeutic agent can be administered on the same day. In some embodiments, the rAAV composition can be administered within one day, two days, three days, four days, five days, six days, seven days, two weeks, three weeks, four weeks, two months, three months, four months, five months or six months of administering the additional therapeutic agent.

[0143] In some embodiments, the kit includes a therapeutic agent for temporarily suppressing the immune system before AAV administration. In some embodiments, the patient is subjected to transient immunosuppression shortly before and after the injection of the virus to suppress the response of T cells to AAV particles (e.g., see Ferreira et al., Hum. Gene Ther. [Human Gene Therapy] 25: 180-188, 2014). In some embodiments, the kit further provides cyclosporine, mycophenolate mofetil and / or methylprednisolone.

[0144] The rAAV particles and / or compositions of the present invention may also be packaged into a kit including instructions for use. In some embodiments, the kit further comprises a device for delivering (e.g., any type of parenteral administration described herein) a composition of rAAV particles. In some embodiments, the instructions for use include instructions according to one of the methods described herein. In some embodiments, these instructions are printed on a label provided for the container (e.g., affixed to the container). In some embodiments, the instructions for use include instructions for administering an effective amount of rAAV particles to an individual (e.g., a human), for example, for treating MLD in an individual. Examples

[0145] The present invention will be more fully understood by reference to the following examples. However, these examples should not be construed as limiting the scope of the present invention. It should be understood that the examples and embodiments described herein are for illustrative purposes only, and the various modifications or changes made according to the examples and embodiments will be conceived by those skilled in the art and should be included in the spirit and scope of the present application and in the scope of the attached embodiments. General Methods Tissue homogenization

[0146] Tissues were homogenized in a refrigerated Omni bead disruptor using cold 10 mM Tris-1 mM EDTA buffer added to a 1.4 mm ceramic bead homogenizer tube—20 sec cycles of 4.7 oscillations / sec. After homogenization, aliquots were taken for subsequent assays. Tissue solubilization of sulfatase activity

[0147] Nonidet P-40 was added to the homogenized tissue to a final concentration of 0.1%, allowed to lyse on an orbital shaker at 4°C for 1.5 hours, then centrifuged at 18,000 xg for 20 minutes. The supernatant was removed and transferred to an Eppendorf tube on ice. BCA assay

[0148] Total protein concentration was determined by BCA (bicinchoninic acid) assay (Thermo Scientific 23227) using 10 ul of supernatant diluted in water. The cuprous cation (Cu) was detected by colorimetric bicinchoninic acid (BCA) by absorbance at 562 nm. 1+ ). A Molecular Devices SpectraMax 340PC-384 equipped with SoftMax Pro version 5.4.4 software was used to read the 96-well microtiter plates. Sulfatase activity

[0149] The total sulfatase activity of ten microliters of clear supernatant was determined using the sulfatase activity assay for 4-nitrocatechol (PNC) hydrolyzed in 4-nitrocatechol sulfate (PNCS) substrate. (Abcam Ab204731). Activity was determined by the 4-nitrocatechol (PNC) hydrolyzed by the sample relative to the PNC standard curve, and absorbance was read at 515nm. Sulfatase activity was reported as mU / mg (nmol / min / mg). 96-well microtiter plates were read using the Molecular Devices SpectraMax 340PC-384 equipped with SoftMax Pro 5.4.4 version software. Lipid extraction

[0150] Aliquots of tissue homogenate (or liquid) were extracted with 20-100X extraction solution (5 mM ammonium formate, 0.2% formic acid in acetonitrile: methanol (70:30), supplemented with 10 ng / ml C17-sulfatide). After vigorous mixing for 10 minutes, the samples were allowed to stand for 5 minutes and vortexed quickly again (30 s). All samples were centrifuged at 8,400 rpm for 10 minutes at 4°C. Aliquots (200 uL) of the supernatant were transferred to inactivated Q-sert vials for LC-MS analysis.

[0151] Standard curves were prepared using sulfatides with C16, C18, C24 and C24:1 chain lengths (Matreya) and C18 2R-OH sulfatides and lyso-sulfatides (Avanti) in the same extraction solution (linear range 0.03-1000 ng / mL, 2x serial dilution). LC-MS analysis of sulfatides

[0152] A Waters Acquity UPLC system (Milford, MA) was connected to a Qtrap 6500 mass spectrometer system (Framingham, MA) equipped with an ESI source and operated in negative ion mode with the following parameters: curtain gas 25.0; ion spray voltage -4.5 kV; temperature 500°C; ion source gas: 50 and 70; declustering potential -80 V; entrance potential -10 V; collision energy -155 V; and collision cell exit potential -15 V.

[0153] Sulfatide species were separated on a Waters Acquity UPLC BEH Amide (1.7μ, 2.1 x 100 mm, P / N: 186004801). The autosampler and column oven were maintained at 10°C and 20°C, respectively. The mobile phase consisted of: solvent A: 5 mM ammonium formate solution in 95:5 acetonitrile:water; and solvent B: 5 mM ammonium formate solution in 90:10 methanol:water.

[0154] The gradient program started from 0% B and held for 2 min, following a linear curve from 0% B to 100% B. After holding at 100% B for another 1 min, it was re-equilibrated at 0% B. All sulfatide species were normalized to the internal standard of C17-sulfatide and calculated by the standard curve of the corresponding standard sulfatide. Nitro blue myelin staining

[0155] The sections were transferred to 12-well plates and all steps were performed in free-floating sections. The sections were washed 2x 1 minute in TBA on a shaker. Incubated for 1 hour in nitro blue solution (Sigma catalog number N5374), and rinsed 2x 5 minutes in TBA on a shaker. The sections were incubated for 1 hour in DAB stain (Sigma kit catalog number D4293), and rinsed 2x 1 in reverse osmosis (RO) water. The sections were rinsed in PBS for 1 minute, loaded into PBS and air-dried slides. Counterstained with neutral red solution for 2 minutes, washed 2x 2 in RO water. The slides were rinsed in 95% reagent alcohol for 1 minute, rinsed 2x 2 minutes in 100% reagent alcohol, rinsed 2x 2 minutes in xylene, and coverslips were used Acrytol mounting agent. GFP ELISA

[0156] Using GFP SimpleStep from Abcam The kit (ab171581) measures GFP protein. It is important to read the protocol insert provided with each kit batch, as some reagent concentrations can vary between batches, especially the standards.

[0157] Before starting, equilibrate all kit components to room temperature (18°C-25°C) for at least 30 minutes. Thaw an aliquot of protein-treated tissue homogenate on ice. Reagents and working standards are freshly prepared according to the kit instructions. Dilute the samples in whole cell extraction buffer as follows: gray matter 1:5, spinal cord 1:5, heart: 1:5, liver 1:20. Add the diluted samples and standards to the appropriate wells, and then add the antibody mixture to each well. Seal the plate and incubate at room temperature for 1 hour, shaking at 400RPM. Wash the wells 3 times with wash buffer and ensure complete removal of the liquid. Add TMB solution to each well and incubate in the dark at room temperature for 10 minutes, shaking at 400RPM. Add stop solution to each well quickly after TMB incubation and mix on a plate shaker for 1 minute. Read the plate at 450nm on a SpectraMax plate reader (Molecular Devices) using Softmax software. FLAG IHC

[0158] NHP brain FFPE slides were treated in EDTA solution (pH.9.0) at 90°C for 20 minutes for antigen retrieval, followed by blocking with 3% hydrogen peroxide for 5 minutes. The slides were then incubated with Flag DDK antibody (Abcam ab205606) in antibody diluent (Cell Signaling #8112) at a dilution of 1:200 for one hour at room temperature, followed by incubation with anti-rabbit HRP (Abcam ab6721) secondary antibody. The Flag DDK signal was visualized by incubating the slides in DAB solution for 3 minutes at room temperature, and then counterstained with hematoxylin for nuclear staining. GFP IHC

[0159] NHP brain FFPE slides were treated in EDTA solution (pH.9.0) at 90°C for 20 minutes for antigen retrieval, and then blocked with 3% hydrogen peroxide for 10 minutes, and then blocked with 5% horse serum for 45 minutes at room temperature. The slides were then incubated with GFP antibody (Thermo Fisher A-11122) in antibody diluent (Cell Signaling #8112) at a dilution of 1:500 for one hour at room temperature, followed by anti-rabbit HRP (Abcam ab6721) secondary antibody incubation. The color development of the GFP signal was achieved by incubating the slides in DAB solution for 3 minutes at room temperature, and the slides were counterstained with hematoxylin for nuclear staining. Cross-calibration analysis

[0160] Adjacent 5 μm FFPE sections were processed with ARSA IHC and DAPI or WPRE ISH and DAPI. Individual tiles were then stitched to obtain sagittal slices of both IHC and ISH images. These images were then globally registered with a transformation matrix (rotation and translation parameters) to align the IHC and ISH images. Individual tiles within the sagittal slices were then locally registered using DAPI to ensure good alignment between individual IHC and ISH tiles. In each tile, IHC-positive cells and ISH-positive cells were estimated by threshold parameters determined empirically across the sagittal slice. In the case of ISH, IHC-positive cells had to overlap the nucleus by at least 20% to be considered a true ISH signal. For IHC images, negative controls without ARSA staining were used to determine the threshold parameters. The cross-correction factor, i.e., the ratio of IHC-positive cells to ISH-positive cells, was estimated for each tile and represented as a heat map. Single-cell nuclear sequencing

[0161] Nuclear Isolation: To isolate the nuclei, the dissected brains were transferred to microcentrifuge tubes, snap frozen in a slurry of dry ice and ethanol, and stored at -800°C until the time of use. To isolate the nuclei, the frozen mouse brains were placed in a 1 ml Dounce Homogenizer (Wheaton) in a nuclear lysis buffer containing 0.1% Triton-100 (Sigma-Aldrich), 1 mM DTT (Sigma-Aldrich), and 0.2 U / ul ribonuclease inhibitor (Sigma-Aldrich). The tissue was homogenized by 10 grindings with a loose Dounce rod and then 10 grindings with a tight rod and incubated on ice for 15 minutes. The resulting homogenate was passed through a 30 μm cell strainer (Miltenyi Biotech) and centrifuged at 500×g for 5 minutes to pellet the nuclei. The nuclei were resuspended in a buffer containing 1×PBS (Thermo Fisher), 1% nuclease-free BSA (Sigma-Aldrich), 1 mM DTT (Sigma-Aldrich), and 0.2 U / ul ribonuclease inhibitor (Sigma-Aldrich). Mouse anti-NeuN conjugated to PE (EMD Millipore) was added to the preparation at a dilution of 1:500, and the samples were incubated at 40°C for 30 minutes. The samples were then centrifuged at 500×g for 5 minutes to pellet the nuclei, and the pellet was resuspended in 1×PBS, 1% BSA, 1 mM DTT, and 0.2 U / ul ribonuclease inhibitor. DAPI was added at a concentration of 0.1 ug / ml. Single cell nuclei sorting was performed on an Influx-83 (BD ​​Biosciences) using a 100 μm nozzle. Nuclei were gated by DAPI and NeuN signal (PE). Library preparation and NovaSeq sequencing

[0162] Libraries were prepared according to the 10x Genomics protocol for the Chromium Single Cell 3' Gene Expression V3.1 kit. Briefly, nuclei were immediately mixed with 90% NeuN- and 10% NeuN+ nuclei after sorting. The GEM generation step was performed in the 10X Genomics Gene Expression kit (10x Genomics). After GEM generation, the samples were kept at -20 °C for further steps. All samples were processed together from cDNA amplification, library construction to library sequencing. Quantification of cDNA and libraries for all samples was reliable. These libraries were sequenced on the illumine Novaseq 6000. The libraries were sequenced at a median depth of approximately 50K reads / nucleus. The UMI count matrix was generated by CellRanger V5.

[0163] Data preprocessing: The generated count matrix was loaded onto Partek Flow together with the nuclear barcodes and gene tags. For quality control (QC), nuclei were filtered according to the inspection of the violin plot following the standard protocol. The detailed cut-off values were 250 < nFeature_RNA < 6000 and nCount_RNA < 30000. Mitochondrial protein-coding genes < 2%. After quality filtering, 147313 total nuclei were retained for further analysis. Vector genome assessment

[0164] HT gDNA isolation: According to the manufacturer's protocol " 96DNA HT Manual", gDNA was isolated from 50 ul of NHP tissue homogenate using the QIAmp 96 DNA QIAcube HT kit (Catalog No. 51331). The tissue homogenate was first treated with proteinase K overnight at 56 °C, then transferred to the S block, and the samples were placed in the QIAcube HT instrument for gDNA isolation using the QIAcube HT-Prep Mange software. Then the gDNA concentration was measured using a NANODROP 8000 (Thermo Fisher Scientific).

[0165] dPCR via QIAcuty: dPCR was used to determine the vector genome via QIAcuty manufactured by QIAGEN. 7 μg of gDNA isolated from NHP tissue and 5 μl of a master reaction mixture containing 1x probe PCR master mix (Catalog No. 250103); 1x primer-probe mixture 1 (BGH) and mixture 2 (housekeeping gene); 0.25U HindIII restriction endonuclease were mixed in a standard PCR plate and then transferred to the nanoplate. The total reaction volume per well was 12ul. The nanoplate was then placed in the QIAcuity instrument and dPCR was performed using the manufacturing suggested cycles. The DNA copies of each sample and each gene were automatically analyzed by the software. The vector genome of each cell was then calculated as follows: 2XBGH copies divided by housekeeping gene copies. Example 1. In vivo ARSA expression using two different expression modules

[0166] The vector payload was designed to express a human codon-optimized arylsulfatase A (ARSA) gene (SEQ ID NO: 2) driven by a constitutive chimeric CMV-chicken β-actin (CBA) promoter. Transgenic expression was further enhanced by the addition of a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). SEQ ID NO: 3 shows a representative complete DNA sequence of a plasmid for rAAV packaging, including 5'AAV2 ITR (SEQ ID NO: 4) and 3'AAV2 ITR (SEQ ID NO: 5), a CMV enhancer element (SEQ ID NO: 6), a chicken β-actin promoter (SEQ ID NO: 7), and a WPRE element (SEQ ID NO: 8). Fig.17 Schematic representation of specific plasmids used for rAAV particle production is shown. Specific elements of the plasmids are listed in Table 1. Table 1. Sequence annotation from 5' ITR to 3' ITR

[0167] ARSA was administered intravenously (IV) (bilateral retro-orbital injection) on the second day after birth. - / - Mice were administered PBS or AAV9 (2e11 VG; 2e14 VG / kg) rAAV viral particles expressing human ARSA with or without the WPRE element. Figure 1A It is schematically shown in FIG. Figure 1B Western blot analysis of hARSA expression in the forebrain, midbrain, and hindbrain following administration of viral particles is shown. Expression levels were compared with ARSA - / - The expression levels of ARSA in WT mice were compared with those in mice expressing normal levels of ARSA (ie, WT mice).

[0168] like Figure 1B As shown, expression levels increased after administration of viral particles containing two expression modules. Inclusion of the WPRE element in the expression module increased the expression level of ARSA compared to the expression module without the WPRE element.

[0169] Next, C24-ST levels were measured using LC-MS. ST levels were normalized to tissue weight. Figure 1C CST levels in the forebrain, midbrain, and hindbrain after administration of viral particles containing two expression modules are shown. Error bars represent mean and standard deviation. One-way ANOVA and Tukey's multiple comparison test. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. ELN: 20200205-188, 20200305-152, 20200205-006. With ARSA - / - C24-ST levels in mice were higher than those in ARSA - / - Mice administered AAV9 particles containing expression modules without the WPRE element showed significantly reduced levels of C24-ST. - / - A further reduction in C24-ST levels was observed after mice were administered AAV9 particles containing an expression module with a WPRE element. Example 2. ARSA administered with AAV.rh10-CBA-ARSA-WPRE - / - Assessment of sulfatase activity in mice

[0170] For late (13 months) ARSA - / - Mice were administered AAV.rh10-CBA-ARSA-WPRE (1.97e11 VG per animal). As a control, age-matched WT and ARSA - / - Mice were injected with formulation buffer. Three months after dosing, mice were euthanized and their brains, spinal cords, and livers were collected. ARSA-mediated sulfatase activity was measured using a sulfatase activity assay kit (ab204731); data were normalized to total protein measured by BCA assay. Error bars represent mean and standard deviation. Two-way ANOVA and Tukey's multiple comparison test. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. ELN: 20201205-001, 20210225-107, 20210211-117. As Figure 2 As shown, advanced MLD (ARSA - / -) mice showed increased ARSA-mediated sulfatase activity in the brain, spinal cord, and liver. Example 3. ARSA administered with AAV.rh10-CBA-ARSA-WPRE - / - Evaluation of sulfatides in mice

[0171] Sulfatide deposition is the main driver of toxicity and neuronal death in MLD patients. Short-chain fatty acids (C16, C18) accumulate primarily in neurons and astrocytes, while long-chain fatty acid sulfatides (C24:1, C24) accumulate in myelinating cells. Lyso-sulfatides are the deacylated form of sulfatides that accumulate in all tissues of MLD patients.

[0172] For late (13 months) ARSA - / - (ARSA KO) mice were administered AAV.rh10-CBA-ARSA-WPRE. As a control, age-matched WT and ARSA - / - Mice were injected with formulation buffer. Three months after dosing, mice were euthanized and their brains and spinal cords were collected. Sulfatide levels were measured using LC-MS. Data were normalized to tissue weight: from ng / mL (50 μL) to μg / g. Error bars represent mean and standard deviation. Two-way ANOVA and Tukey's multiple comparison test.

[0173] ARSA using LC-MS and administration of AAV.rh10-CBA-ARSA-WPRE - / - Measurement of sulfatide levels in both brain and spinal cord samples from mice showed a significant decrease in levels of all sulfatide isoforms ( Figure 3 ). Example 4. ARSA administered with AAV.rh10-CBA-ARSA-WPRE - / - Assessment of myelination in mice

[0174] MLD patients show a significant loss of myelin in white matter fiber tracts. - / - To investigate the effects of AAV.rh10-CBA-ARSA-WPRE on mice, age-matched WT and ARSA - / - Mice were injected with formulation buffer. Three months after administration, matched sagittal brain hemisections were stained with nitro blue and signal intensity was quantified specifically in the corpus callosum. Error bars represent mean and standard deviation. One-way ANOVA and Tukey's multiple comparison test were performed. Compared with controls, AAV.rh10-CBA-ARSA-WPRE treated mice with advanced MLD (ARSA - / - ) mice showed improved corpus callosum myelination ( Figure 4). Example 5. ARSA administered with AAV.rh10-CBA-ARSA-WPRE - / - Assessment of myelination and mature oligodendrocyte numbers in mice

[0175] ARSA for advanced (13 months) MLD - / - Mice were administered AAV.rh10-CBA-ARSA-WPRE. As a control, age-matched WT and ARSA - / - Mice were injected with formulation buffer. Brain hemispheres were collected and snap frozen; cerebellum, brainstem, and olfactory bulb were removed. Single-cell nuclear transcriptome sequencing (RNAseq) was performed on the rest of the brain to measure the relative abundance of different cell types. Error bars represent mean and standard deviation. Two-way ANOVA and Tukey multiple comparisons. Figure 5 Compared with untreated ARSA - / - Compared with mice treated with AAV.rh10-CBA-ARSA-WPRE, ARSA - / - The mice showed normalization of oligodendrocyte counts. Example 6. ARSA protein cross-correction study

[0176] For late (13 months) ARSA - / - Mice were administered AAV.rh10-CBA-ARSA-WPRE. Three months after administration, ARSA-mRNA in situ hybridization (ISH) and ARSA-protein immunohistochemistry (IHC) were performed on matched sagittal brain hemisections. The sections were imaged and analyzed by signal overlay. Fig. 6A ) Adjacent sagittal sections from mouse brain were processed for WPRE ISH or ARSA IHC using DAPI staining for nuclei. The sagittal sections were then analyzed as individual 1024 x 1024 pixel tiles. In each tile, ISH-positive cells and IHC-positive cells were determined by threshold parameters empirically determined across the sagittal image. The cross-correction factor (i.e., the ratio of IHC+ cells to ISH+ cells) is represented as a heat map, where highly cross-corrected tiles are shaded red ( Figure 6B ). ISH+ cell counts from each tile are plotted against IHC+ cell counts as a scatter plot, with the y=x line shown in red. Tiles above the y=x line represent cross-corrected cells. In late neuropathic mice, 10-fold more cells were cross-corrected compared to infected cells, highlighting the extensive cross-correction achieved with this strategy. Example 7. MLD mice (Arsa - / -Evaluation of AAV.rh10-hARSA-WPRE-mediated gene replacement in reversing MLD-related pathology

[0177] For early (6 months) ARSA - / - Mice were administered AAV.rh10-CBA-ARSA-WPRE. As a control, age-matched WT and ARSA - / - Mice were injected with formulation buffer. Four months after administration, extensive ARSA expression was observed in sagittal brain sections by IHC relative to human ARSA ( Fig. 7A In the same animals, the brain, spinal cord, DRG, and liver showed a significant increase in ARSA activity ( Figure 7B ). Therefore, early MLD (ARSA) treated with AAV.rh10-CBA-ARSA-WPRE - / - ) mice exhibited widespread CNS expression of human ARSA and displayed increased ARSA-mediated sulfatase activity in the brain, spinal cord, DRG, and liver. Example 8. MLD mice (Arsa - / - Evaluation of sulfatide levels in AAV.rh10-hARSA-WPRE-mediated gene replacement in )

[0178] For early (6 months) ARSA - / - Mice were administered AAV.rh10-CBA-ARSA-WPRE. As a control, age-matched WT and ARSA - / - Mice were injected with formulation buffer. Four months after dosing, animals were euthanized and (A) brain and spinal cord, (B) liver, (C) plasma, and (D) CSF were collected. Sulfatide levels were measured using LC-MS. Data were normalized to tissue weight: converted from ng / mL (50 μL) to μg / g. Fluids: Data were converted to (30 μL) ng / mL to ng / mL, and to ng / mL (5 μL) to ng / uL. Figures 8A-8D Shown brain ( Fig. 8A ),liver( Figure 8B ),plasma( Figure 8C ) and CSF( Fig.8D ) sulfatide levels in the brain, spinal cord, liver, plasma, and CSF were significantly increased after administration of AAV.rh10-CBA-ARSA-WPRE. Example 9: Study on Sulfatase Activity in Non-Human Primates (NHP)

[0179] Cynomolgus monkeys (male, Mauritius 2 years old, 2-3Kg) with negative AAVrh.10 seronegative reactions were administered intrathecally at the 1-2 level of the neck using a ported intrathecal catheter inserted into the lumbar region. Animals were administered two 2.5mL infusions at a rate of 0.125mL / min in the Trendelenburg position, with two administrations approximately six hours apart. Two doses were administered: 7.5e12 VG / NHP (at 1e11 VG / brain gram) and 2.75e13VG / NHP (at 3.3e11 VG / brain gram). 29 days after administration, animals were euthanized and samples were evaluated for ARSA activity: 59 tissue ring samples were from the brain and 7 tissue ring samples were from the spinal cord. Significant increases in sulfatase activity were observed in the brain and spinal cord, with 59% and 86% of brain encircled samples showing at least 10% increase in activity over background at low and high doses, respectively ( Fig. 9A ). This exceeded our target criterion of 50% of circumcised samples having an increase in activity >10%. Similarly, increases of 25% and 32% in sulfatase activity were observed in the spinal cords of NHPs treated with low and high doses, respectively ( Fig. 9B Extensive ARSA biodistribution was observed in the brain of treated NHPs by IHC against FLAG antibody ( Fig. 9C Our results suggest that AAV.rh10-CBA-ARSA-WPRE-mediated gene replacement is a feasible approach to achieve widespread and therapeutic levels of ARSA in both the central nervous system (CNS) and peripheral nervous system (PNS). Example 10: Non-human primate (NHP) studies - Comparison of transgene expression levels following administration of particles containing AAV1999 or AAV.rh10

[0180] Cynomolgus monkeys (male, Mauritius, 2 years old, 2-3 kg) seronegative for AAVrh10 and AAV1999 (VP1 has SEQ ID NO.12; VP2 has SEQ ID NO.13; and VP3 has SEQ ID NO:14) were dosed intrathecally at the cervical 1-2 junction using a ported intrathecal catheter inserted in the lumbar region. Animals were given two 2.5 mL infusions at a rate of 0.125 mL / min in the Trendelenburg position, approximately 6 hours apart. One dose of AAV1999 / rh10 / Myo-CBA-eGFP was administered at 2.75e13 VG / NHP (at 3.3e11 VG / brain gram). Two weeks after dosing, animals were euthanized and samples were evaluated for expression of green fluorescent protein (GFP) by ELISA.

[0181] A total of 41 brain circumcision samples (gray matter) representing 16 different brain regions showed significantly higher GFP expression with AAV1999 compared to AAVrh.10 ( Fig. 10A Across all samples, GFP expression in the brains of NHPs treated with AAV1999 was 93%-123% higher compared to NHPs treated with AAVrh.10 ( Fig. 10B This is demonstrated by the heat map, where 38 of 41 circumcised samples (averaged across three NHPs) in AAV1999-treated NHPs showed a minimum 10% increase in GFP expression compared to AAVrh10-treated NHPs ( Fig.11 ). Representative matched brain sections stained with antibodies against eGFP showed robust expression in AAV1999-treated NHPs compared with AAVrh10, demonstrating superior biodistribution ( Fig.12 ). In addition, in the spinal cord and DRG, GFP expression was 79% and 22% higher in NHPs treated with AAV1999 compared with NHPs treated with AAVrh.10, respectively. Fig.13 GFP expression in the spinal cord and DRG of NHPs is shown. AAV1999-GFP expression in the heart and liver was lower compared to NHPs treated with AAVrh10-GFP ( Fig.14 ).

[0182] AAV1999 vector genome load was ten-fold lower in the brain and three-fold lower in the spinal cord compared with AAVrh.10 ( Fig.15A This is evident in the “leftward shift” in the correlation between GFP expression (y-axis) and tissue vector genome (x-axis), where the correlation for AAV1999 (red) is leftward, indicating higher protein expression and a lower tissue dose (approximately 10-fold) from the vector ( Fig.16 In addition, DRG, liver, heart, lung, and kidney also showed lower AAV1999 vector genomes compared to AAVrh.10 ( Fig. 15B The spleen was the only tissue tested that showed higher AAV1999 vector genomes compared to AAVrh.10 ( Fig. 15B ). These results suggest that AAV1999 is superior to AAVrh.10 and has a broader biodistribution and higher transgene expression at lower doses. Example 11: Long-term pharmacology, efficacy and durability study using AAV1999-ARSA in the pre-neuropathy Arsa KO mouse model

[0183] This study was designed to evaluate the long-term pharmacology and efficacy of AAV1999-ARSA in the Arsa KO mouse model. The study design is summarized in Table 2. Two-month-old Arsa KO mice were administered (bilateral ICV injection; 4uL in each hemisphere) AAV1999-ARSA (lot number VP091321), 1.6e11 VG per mouse (3.3e11 VG / g brain weight). As a control, age-matched WT and Arsa KO mice were administered formulation buffer. Mice were euthanized 13 months after administration and samples were collected. Table 2 - Long-term pharmacology, efficacy and durability studies in Arsa KO mice (2 months-15 months)

[0184] Robust hARSA mRNA expression was observed in the brain and spinal cord of Arsa KO mice treated with AAV1999-ARSA ( Fig.18 ). Sulfatase activity was measured using a sulfatase activity assay kit (Abcam, ab204731). Arsa KO mice administered AAV1999-ARSA showed normal (equivalent to WT) levels of sulfatase activity in the brain, spinal cord, DRG, and sciatic nerve ( Fig.19 A measurable increase in WT sulfatase activity levels was observed in the livers of treated mice ( Fig.19 ). Sulfatide deposition is a major driver of toxicity and neuronal death in MLD patients. Lyso-ST is the deacylated form of sulfatide that accumulates in all tissues and is a characteristic hallmark of MLD-associated pathology in patients. In Arsa KO mice treated with AAV1999-ARSA, lyso-ST levels in the brain and spinal cord returned to normal (similar to WT) ( Fig. 20 Significant reductions in lyso-ST levels were also observed in DRG, sciatic nerve, and liver, while total sulfatide levels were significantly reduced in plasma and CSF of treated animals ( Fig. 20 Arsa KO mice treated with AAV1999-ARSA showed significant improvements in neuroinflammatory markers (Gfap and Aif1) and Lamp1 expression (a marker of lysosomal health) in the brain and spinal cord due to sulfatide clearance in the brain and spinal cord ( Fig.21 In addition, a significant decrease in plasma Nf-L levels was observed in Arsa KO mice treated with AAV1999-ARSA compared with Arsa KO mice treated with buffer ( Fig. 22 ).

[0185] Hearing impairment is common in patients with MLD. Auditory brainstem response (ABR) testing provides functional information about the inner ear (cochlea) and central auditory pathways. ABR reflects the electrical responses of both cochlear ganglion neurons and central auditory pathway nuclei to sound stimuli (Zhou et al., 2006; Burkard et al., 2007). ABR is recorded via electrodes placed on the scalp of anesthetized animals. The ABR threshold refers to the lowest sound pressure level (SPL) that can produce a recognizable electrical response wave. Arsa KO mice showed a gradual decline in hearing over time, which was reversed after AAV1999-ARSA treatment ( Fig.23 Partial reversal of the phenotype was observed as early as 4 months after dosing (the earliest time tested after dosing) ( Fig.23 ).

[0186] Vacuolization and neurodegeneration were observed in the brains of all Arsa KO mice, usually in the brainstem and / or cerebellum. In treated mice, histological changes were detected in only 4 of 10 mice and were less severe than in Arsa KO mice ( Fig.24A All Arsa KO mice showed minimal severity of vacuolation in the spinal cord, whereas no changes were detected in WT mice or in Arsa KO mice treated with AAV1999-ARSA ( Fig. 24B Finally, no pathological changes were detected in the DRGs in any group (except for 1 out of 10 animals in the KO+AAV group) ( Fig.24C ). Thus, treatment of Arsa KO mice with AAV1999-ARSA significantly reduced and / or prevented MLD-associated pathology in the brain and prevented MLD-associated pathology in the spinal cord. Example 12: Longitudinal Pharmacology, Efficacy and Durability Study in an Early Neuropathic ARSA KO Mouse Model Using AAV1999

[0187] This study was designed to evaluate target engagement and reversal of MLD-related pathological and biochemical phenotypes in the Arsa KO model over a 6-month period. The early neuropathic stage (6 months after dosing) was selected as the stage most relevant to the target patient population. The study design is summarized in Table 3. Six-month-old Arsa KO mice were administered (bilateral ICV injection; 4uL in each hemisphere) AAV1999-ARSA (lot number VP091321) at a dose of 5e10 VG per mouse (1e11 VG / gram brain weight). Age-matched WT and Arsa KO mice as controls were administered formulation buffer. Mice were euthanized at 1, 2, 3, and 6 months after dosing, and samples were collected. Table 3 - Longitudinal pharmacology, efficacy and durability studies in Arsa KO mice

[0188] The exposure of AAV1999-ARSA vector genomes in the brain remained consistent over a 6-month period after dosing ( Fig.25A This translates into continued ARSA-mediated sulfatase activity over time ( Fig.25B ), peak sulfatase activity was reached 1 month after administration ( Fig.25C At each time point, treated mice showed significant reductions in lyso-sulfatides, C16-sulfatides, and C18-sulfatides ( Figures 26A-26C Importantly, clearance was gradual, with sulfatide levels (especially lyso-ST) returning to normal by 6 months after dosing ( Figures 26D-26F In addition, the levels of total sulfatide in CSF and plasma of Arsa KO mice treated with AAV1999-ARSA were significantly reduced ( Fig. 27 Finally, the initial increase in plasma Nf-L levels was reduced 6 months after AAV1999-ARSA administration compared with the KO+FB group ( Fig.28 ).

[0189] Neuronal and neutrophil changes in the brains of Arsa KO mice were observed in the brainstem and / or cerebellar nuclei. Notably, in Arsa KO mice treated with AAV1999-ARSA, a reduction in the incidence and severity of these changes was observed as early as 2 months after dosing ( Figures 29A-29B Some AAV1999-ARSA-treated mice had minimal focal or multifocal perivascular mononuclear infiltration in the brain (usually near the hippocampus) ( Fig.29C ). Neurons primarily from the CA3 region of the hippocampus also had minimal degeneration / necrosis in 1-2 animals per group ( Fig.29D ).

[0190] Some AAV1999-ARSA-treated mice had focal or multifocal increases in glial and / or monocyte cellularity in the dorsal root ganglia, which were generally of low severity ( Fig. 30A ), some treated Arsa KO mice showed minimal axonal degeneration ( Figures 30B-30C Microscopic observations were observed in the spinal cords of animals in all groups and are considered to be random or accidental ( Fig.30D Most Arsa KO mice showed histological changes in the sciatic nerve (very low or minimal axonal degeneration), while the incidence and severity occasionally increased to minimal / mild or mild ( Fig.30E WT mice also had a rare, very low background of occasional axonal degeneration in the sciatic nerve ( Fig.30E ). No test article-specific observations were found in the liver.

[0191] Taken together, these data indicate that AAV1999-ARSA-mediated gene replacement in Arsa KO mice is well tolerated and reverses MLD-associated phenotypes to the same extent in both male and female mice. Example 13: NHP Pharmacology and Dose-Range Observational Study Evaluating AAV1999-ARSA

[0192] In brief, the drug was administered to naive male / female cynomolgus monkeys (2-3 years old, 2.6-3.1 kg in Cambodia) NHPs bred specifically for AAV1999 neutralizing antibody seronegative by a single direct cerebral pool (ICM) infusion. During administration, the animals were placed in the Trendelenburg position. The administration mode included a single infusion of 2.5 mL AAV1999-ARSA (lot number VP050322) at a speed of 0.125 ml / min, followed by rinsing with 250 ul formulation buffer. Five weeks after administration, the animals were euthanized, and the samples were evaluated for vector biodistribution (dPCR) and hARSA mRNA (RTdPCR), while safety assessments were performed. The samples represented 64 circumcision samples from the brain, representing 19 different gray matter areas and 7 different white matter areas, 8 segments of the spinal cord, and adjacent DRGs, peripheral nerves, and visceral organs. The study design is described in Table 4. Table 4 - Study CRL.2021-5613: NHP Dose-Range Observational Outcome Study

[0193] Following ICM administration, a dose-dependent increase in AAV1999-ARSA vector biodistribution was observed in NHP brains, including both gray matter (19 unique brain regions) and white matter (7 unique brain regions). Fig.31 AAV1999-ARSA treatment also resulted in hARSA mRNA ( Fig.32 ) and protein (Figure 33) levels: 7.5e12 VG (1e11 VG / g brain weight) and 2.5e13 VG (3.3e11 VG / g brain weight). Uniform dose-dependent vector biodistribution and hARSA expression were observed along the cranial-caudal axis of the spine in DRG and spinal cord (Figure 34). Among the visceral organs, the liver, spleen, and cervical lymph nodes showed a dose-dependent increase in vector biodistribution ( Fig.35 ).

[0194] To explore whether administration of AAV1999-ARSA would result in meaningful expression of human ARSA in the NHP brain, we assessed levels of AAV-derived human ARSA protein and compared them to 1) endogenous cynomolgus macaque cyARSA protein (hARSA / cyARSA in 19 brain regions measured in the same sample) and 2) human ARSA protein measured in the brains of seven healthy human organ donors between the ages of 3 and 8 years (in 12 brain regions). Whole brain mean human ARSA protein levels were approximately 63% and 546% of native cyARSA at doses of 1e11 VG / g and 3.3e11 VG / g brain weight, respectively. Fig.36 ). In addition, at doses of 1e11 VG / gram and 3.3e11 VG / gram brain weight, the average human ARSA protein level in the whole brain was about 51% and about 416% of the human ARSA protein level in healthy control organ donors (Figure 37). Therefore, AAV1999-ARSA treatment in NHPs produces therapeutically meaningful ARSA protein expression in the CNS at 1e11 and 3.3e11 VG / gram brain weight.

[0195] No clinical signs (functional or behavioral deficits) were observed in NHPs in either dosing group at week 1 or week 5 (necropsy) compared with pre-dose testing ( Fig.38 Intra-CM infusions were well tolerated; as expected, the ICM procedure resulted in a significant increase in CSF Nf-L levels, with further increases observed in NHPs treated with AAV1999-ARSA compared with those treated with formulation buffer ( Fig.39A However, no dose-dependent increase was observed ( Fig.39A No significant changes in plasma cytokine concentrations were observed in NHPs treated with AAV1999-ARSA at any dose ( Fig.39B ), and no cell-mediated immune response to AAV1999 capsid or hARSA protein was found by IFN-γ ELISpot in NHPs treated with AAV1999-ARSA at two high doses ( Fig.39C ). In addition, no significant observations related to the test items were found in any of the animals at necropsy.

[0196] In most animals, starting from 1e10 VG / g brain weight, cerebrospinal fluid changes consisted of a minor, non-dose-related increase in nucleated cell counts (primarily monocytes). In addition, at ≥3.3e10 VG / g brain weight, albumin and / or total protein increased in most animals 5 weeks after vehicle administration. A few individual animals had variable amounts of basophilic to eosinophilic granular material at 3.3e10 or 3.3e11 VG / g brain weight that was morphologically compatible with neural material. These changes were associated with neuronal degeneration and mononuclear cell infiltration in various sections from the central nervous system.

[0197] Hematological changes consisted of a transient mild increase in reticulocyte counts in most males ≥1e10 VG / g brain weight and a few sporadic females at 1e11 VG / g brain weight on Day 7, with minimal decreases in red cell mass parameters in a few individuals. At 3.3e10 VG / g brain weight, some males and females had increased white blood cell counts, secondary to increases in neutrophil, lymphocyte, and / or monocyte counts, which were still observed in some animals, primarily in males dosed at 3.3e11 VG / g brain weight. No test article-related effects on coagulation or clinical chemistry were found.

[0198] The main test article effects consisted of: neuronal degeneration (affecting the brain, lumbar spinal cord, and DRGs), increased glial cell response (cerebellum and spinal cord), neurofibrillary degeneration (affecting nerve fibers in the white matter of the spinal cord and peripheral nerves), and mononuclear cell infiltration (including perivascular distribution) affecting the brain (cerebellum), DRGs, and spinal cord ( Figure 40-4 2). No test article-related observations were observed in the internal organs (heart, liver, gallbladder, spleen, pancreas, adrenal glands, lungs, bones, sternum / bone marrow, ovaries, duodenum, testes, epididymis, thymus, eyes, cervix, kidneys) at any dose. Some changes were observed in some sites with dose responses between the lowest dose (1e10 VG / g brain weight) and the highest dose (3.3e11 VG / g brain weight), such as neuronal degeneration (cerebellum, lumbar DRGs at the highest dose), gliosis (cerebral cortex, cerebellum, but not in spinal cord), and mononuclear cell infiltration (in the cerebral cortex and in the lumbar DRGs at the highest dose) ( Figure 40-4 2).

[0199] In conclusion, a single administration of AAV1999-ARSA by direct intracisternal (ICM) was well tolerated in cynomolgus monkeys (both male and female) at dose levels of 1e10, 3.3e10, 1e11, and 3.3e11 VG / g brain weight, and 1e11 and 3.3e11 VG / g brain weight were considered to be effective doses. sequence ARSA polypeptide sequence Codon-optimized ARSA DNA sequence (human) ATGAGCATGGGAGCCCCTAGATCTCTGCTGCTGGCTCTTGCTGCTGGACTGGCTGT GGCCAGACCTCCTAACATCGTGCTGATCTTCGCCGACGATCTCGGCTATGGCGATC TGGGCTGTTACGGACACCCTAGCAGCACCACACCTAACCTGGATCAACTGGCTGCC GGCGGACTGAGATTCACCGATTTCTACGTGCCCGTGTCTCTGTGCACACCTAGTAG AGCTGCTCTGCTGACAGGCAGACTGCCAGTGCGGATGGGAATGTATCCTGGCGTG CTGGTTCCTAGCAGTAGAGGCGGACTGCCTCTGGAAGAAGTGACAGTTGCTGAAG TGCTGGCCGCCAGAGGCTATCTGACTGGAATGGCCGGAAAATGGCACCTCGGAGT TGGACCTGAAGGCGCTTTTCTGCCTCCTCACCAGGGCTTCCACAGATTTCTGGGCA Complete DNA sequence of the plasmid used for rAAV packaging; the coding sequence of ARSA is underlined ATGAGCATGGGAGCCCCTAGATCTCTGCTGCTGGCTCTTGCTGCTGGACTGGCTGTGGCCAGACCTCCTAACATC GTGCTGATCTTCGCCGACGATCTCGGCTATGGCGATCTGGGCTGTTACGGACACCCTAGCAGCACCACACCTAACC TGGATCAACTGGCTGCCGGCGGACTGAGATTCACCGATTTCTACGTGCCCGTGTCTCTGTGCACACCTAGTAGAGC TGCTCTGCTGACAGGCAGACTGCCAGTGCGGATGGGAATGTATCCTGGCGTGCTGGTTCCTAGCAGTAGAGGCGGA CTGCCTCTGGAAGAAGTGACAGTTGCTGAAGTGCTGGCCGCCAGAGGCTATCTGACTGGAATGGCCGGAAAATGGC ACCTCGGAGTTGGACCTGAAGGCGCTTTTCTGCCTCCTCACCAGGGCTTCCACAGATTTCTGGGCATCCCTTACAG CCACGATCAGGGCCCTTGCCAGAACCTGACCTGCTTTCCTCCTGCCACACCTTGTGATGGCGGCTGTGATCAGGGA CTCGTGCCTATTCCTCTGCTGGCCAATCTGAGCGTGGAAGCTCAACCTCCTTGGCTGCCTGGCCTGGAAGCCAGAT ATATGGCCTTCGCTCACGACCTGATGGCCGACGCTCAGAGACAGGACAGACCATTCTTCCTGTACTACGCCAGCCA CCACACACACTACCCTCAGTTCTCTGGCCAGTCCTTCGCCGAGAGATCTGGCAGAGGCCCTTTTGGCGATAGCCTG ATGGAACTGGATGCCGCCGTGGGAACACTGATGACAGCCATTGGAGATCTGGGCCTGCTGGAAGAGACACTGGTCA TCTTCACCGCCGACAACGGCCCCGAGACAATGAGAATGAGCAGAGGCGGCTGTAGCGGCCTGCTGAGATGTGGCAA GGGAACAACATACGAAGGCGGCGTCAGAGAGCCTGCTCTGGCTTTTTGGCCTGGACATATTGCCCCTGGCGTGACA CACGAACTGGCCTCTTCTCTGGATCTGCTGCCTACACTGGCTGCTTTGGCTGGCGCTCCTCTGCCTAATGTGACCC TGGATGGCTTCGATCTGTCTCCACTGCTGCTCGGAACAGGCAAGAGCCCTAGACAGAGCCTGTTCTTCTACCCTAG CTACCCCGATGAAGTGCGGGGAGTGTTTGCCGTGCGGACAGGCAAGTACAAGGCCCACTTTTTTACCCAAGGCAGC GCCCACAGCGATACCACAGCTGATCCTGCTTGTCACGCCTCTAGCAGCCTGACAGCTCATGAACCACCTCTGCTGT ACGACCTGTCTAAGGACCCCGGCGAGAACTATAATCTGCTTGGCGGAGTTGCCGGCGCTACACCTGAAGTTCTGCA GGCTCTGAAACAGCTCCAGCTGCTGAAAGCCCAGCTGGACGCTGCTGTGACATTTGGACCTTCTCAAGGTGGCAAGA GGCGAGGACCCTGCTCTGCAGATTTGTTGTCACCCTGGCTGTACCCCTAGACCTGCCTGCTGTCACTGTCCTGATC CTCACGCTTGA Underline , codon-optimized ARSA DNA sequence (human) 5' AAV2 ITR DNA sequence TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT(SEQ ID NO:4) 3' AAV2 ITR DNA sequence in Flip orientation AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA(SEQ ID NO:5) CMV enhancer element DNA sequence (GenBank: K03104.1) GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCAT AGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTG ACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAA CGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCC CACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAA TGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGG(SEQ ID NO:6) Chicken-actin promoter DNA sequence TCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCC CAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGG GGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCG AGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTT TTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGG CGGGAGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCC(SEQ ID NO:7) WPRE element DNA sequence TTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTAT GTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATT GCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTT ATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCT GACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGAC TTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCG CTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGA AATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG(SEQ ID NO: 8) AAV9 capsid amino acid sequence (VP1) Targeting peptide amino acid sequence KGGGFHG(SEQ ID NO:10) Targeting peptide-amino acid sequence flanked by linkers AAAKGGGFHGAS(SEQ ID NO:11) AAV1999 capsid amino acid sequence (VP1) AAV1999 capsid amino acid sequence (VP2) AAV1999 capsid amino acid sequence (VP3) The complete DNA sequence of the vector; the coding sequence of ARSA is underlined TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCC CGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGA GAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTACGTACAATTGGGATCCCGG ACCGTCGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTA GTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCC TGGCTGACCGCCCCAACGACCCCGCCCATTGACGTCAATAATGACGTATGTTCCCA TAGTAACGCCAATAGGGACTTTCCATTGACGTCCAATGGGTGGAGTATTTACGGTAA ACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTTATTGA CGTCAATGACGGTAATGGCCCGCCTGGGCATTATGCCCAGTACATGACCTTATGGG ACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAG GTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATT TTGTATTATTATTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGG GGGGCGCGGCCCAGGCGGGCGGGGCGGGGCGAGGGCGGGGCGGGGCGAGGC GGAGAGGTGCGGCGGCAGCCAATCAGAGGCGGCGCGCTCCGAAAGTTTCCTTTTAT GGCGAGGCGGCGGCGGCGGCGCCTATAAAAAGCGAAGCGCGCGGCGGGGCGGG AGTCGCTGCGCGCTGCCTTCGCCCCGTGCCCCGCTCCCGCCGCCGCTCCGGCCGCC CGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCC TTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTG GCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGAGCGGC TCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGC TGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAG TGTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTG CGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGG TGTGGGCGCGTCGGTCGGGCTGCAACCCCCCCTGCACCCCCCTCCCCGAGTTGCTG AGCACGGCCCGGCTTCGGGTGCGGGGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTCTACGTACCACC ATGAGCATGGGAGCCCC TAGATCTCTGCTGCTGGCTCTTGCTGCTGGACTGGCTGTGGCCAGACCTCCTAACATCGTGCTGATCTTCGCCGAC GATCTCGGCTATGGCGATCTGGGCTGTTACGGACACCCTAGCAGCACCACACCTAACCTGGATCAACTGGCTGCCG GCGGACTGAGATTCACCGATTTCTACGTGCCCGTGTCTCTGTGCACACCTAGTAGAGCTGCTCTGCTGACAGGCAG ACTGCCAGTGCGGATGGGAATGTATCCTGGCGTGCTGGTTCCTAGCAGTAGAGGCGGACTGCCTCTGGAAGAAGTG ACAGTTGCTGAAGTGCTGGCCGCCAGAGGCTATCTGACTGGAATGGCCGGAAAATGGCACCTCGGAGTTGGACCTG AAGGCGCTTTTCTGCCTCCTCACCAGGGCTTCCACAGATTTCTGGGCATCCCTTACAGCCACGATCAGGGCCCTTG CCAGAACCTGACCTGCTTTCCTCCTGCCACACCTTGTGATGGCGGCTGTGATCAGGGACTCGTGCCTATTCCTCTG CTGGCCAATCTGAGCGTGGAAGCTCAACCTCCTTGGCTGCCTGGCCTGGAAGCCAGATATATGGCCTTCGCTCACG ACCTGATGGCCGACGCTCAGAGACAGGACAGACCATTCTTCCTGTACTACGCCAGCCACCACACACACTACCCTCA GTTCTCTGGCCAGTCCTTCGCCGAGAGATCTGGCAGAGGCCCTTTTGGCGATAGCCTGATGGAACTGGATGCCGCC GTGGGAACACTGATGACAGCCATTGGAGATCTGGGCCTGCTGGAAGAGACACTGGTCATCTTCACCGCCGACAACG GCCCCGAGACAATGAGAATGAGCAGAGGCGGCTGTAGCGGCCTGCTGAGATGTGGCAAGGGAACAACATACGAAGG CGGCGTCAGAGAGCCTGCTCTGGCTTTTTGGCCTGGACATATTGCCCCTGGCGTGACACACGAACTGGCCTCTTCT CTGGATCTGCTGCCTACACTGGCTGCTTTGGCTGGCGCTCCTCTGCCTAATGTGACCCTGGATGGCTTCGATCTGT CTCCACTGCTGCTCGGAACAGGCAAGAGCCCTAGACAGAGCCTGTTCTTCTACCCTAGCTACCCCGATGAAGTGCG GGGAGTGTTTGCCGTGCGGACAGGCAAGTACAAGGCCCACTTTTTTACCCAAGGCAGCGCCCACAGCGATACCACA GCTGATCCTGCTTGTCACGCCTCTAGCAGCCTGACAGCTCATGAACCACCTCTGCTGTACGACCTGTCTAAGGACC CCGGCGAGAACTATAATCTGCTTGGCGGAGTTGCCGGCGCTACACCTGAAGTTCTGCAGGCTCTGAAACAGCTCCA GCTGCTGAAAGCCCAGCTGGACGCTGCTGTGACATTTGGACCTTCTCAGGTGGCAAGAGGCGAGGACCCTGCTCTG CAGATTTGTTGTCACCCTGGCTGTACCCCTAGACCTGCCTGCTGTCACTGTCCTGATCCTCACGCTTGAGATTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGATCCTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTCGAAATTAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA(SEQ ID NO:16) Underline, codon-optimized ARSA DNA sequence (human).

Claims

1. A recombinant adeno-associated virus (rAAV) particle, comprising (1) an rAAV vector comprising an expression component for expressing an arylsulfatase A (ARSA) polypeptide, wherein the expression component comprises a gene encoding the ARSA polypeptide, the ARSA polypeptide being operably linked to a promoter and an optional enhancer, and (2) a modified AAV9 capsid protein comprising a targeting peptide having SEQ ID NO:

10.

2. The rAAV particle of claim 1, wherein the ARSA polypeptide comprises SEQ ID NO:

1.

3. The rAAV particle of claim 1 or claim 2, wherein the targeting peptide is flanked by linker sequences at its N-terminus and C-terminus.

4. The rAAV particle of claim 3, wherein the combined targeting peptide and linker sequence comprises SEQ ID NO:

11.

5. The rAAV particle of any one of claims 1-4, wherein the modified capsid protein has a sequence at least 98.5% identical to SEQ ID NO:

12.

6. The rAAV particle of claim 5, wherein the modified capsid protein comprises a sequence comprising SEQ ID NO:

12.

7. The rAAV particle of any one of claims 1-6, wherein the expression component comprises a codon-optimized ARSA gene of SEQ ID NO:

2.

8. The rAAV particle of any one of claims 1-7, wherein the rAAV vector comprises a 5' AAV2 ITR of SEQ ID NO:4 and a 3' AAV2 ITR of SEQ ID NO:

5.

9. The rAAV particle of any one of claims 1-8, wherein the expression component comprises a CMV enhancer element comprising SEQ ID NO:

6.

10. The rAAV particle of any one of claims 1-9, wherein the expression component comprises a chicken b-actin promoter comprising SEQ ID NO:

7.

11. The rAAV particle of any one of claims 1-10, wherein the rAAV vector further comprises a WPRE element.

12. The rAAV particle of claim 11, wherein the WPRE element comprises the sequence of SEQ ID NO:

8.

13. The rAAV particle of any one of claims 1-12, wherein the rAAV vector comprises the sequence of SEQ ID NO:

16.

14. A method of treating metachromatic leukodystrophy (MLD) in a human patient in need thereof, the method comprising administering to the patient's cerebrospinal fluid (CSF) a composition comprising an effective amount of a recombinant adeno-associated virus (rAAV) viral particle as described in any one of claims 1-13.

15. The method of claim 14, wherein the composition is administered directly to the patient's CSF via intracerebroventricular (ICV) administration.

16. The method of claim 14, wherein the composition is administered directly to the patient's CSF via direct cisternal (dCM) administration.

17. The method of claim 14, wherein the composition is administered directly to the patient's CSF using an intrathecal microcatheter (IT-CM).

18. The method of any one of claims 14-17, wherein the composition is administered only once in the patient's lifetime.

19. The method of any one of claims 14-17, wherein the composition is administered to the patient only once per year.

20. The method of any one of claims 14-19, wherein said administration increases ARSA activity in the patient by at least 5%.

21. The method of any one of claims 14-19, wherein the administration increases ARSA activity in the patient by at least 10%.

22. The method of any one of claims 14-19, wherein said administration increases ARSA activity in the patient by at least 20%.

23. The method of any one of claims 14-19, wherein said administration increases ARSA activity in the patient by at least 30%.

24. The method of any one of claims 14-19, wherein said administration increases ARSA activity in the patient by at least 50%.

25. A method for increasing the expression and / or activity of ARSA in an individual in need thereof, the method comprising administering to the patient's cerebrospinal fluid (CSF) a composition comprising an effective amount of a recombinant adeno-associated virus (rAAV) viral particle as described in any one of claims 1-13.

26. A plasmid comprising SEQ ID NO:

3.

27. A codon-optimized human ARSA sequence, comprising SEQ ID NO:

2.

28. An expression module comprising a codon-optimized human ARSA sequence comprising SEQ ID NO:

2.

29. The expression component of claim 28, further comprising a chicken b-actin promoter comprising SEQ ID NO:

7.

30. The expression module of claim 28 or claim 29, further comprising a CMV enhancer element comprising SEQ ID NO:

6.

31. A vector comprising the expression component of any one of claims 27-30.

32. The vector of claim 31, further comprising a WPRE element comprising SEQ ID NO:

8.

33. A pharmaceutical composition comprising the rAAV particles of any one of claims 1-13.

34. A kit comprising the pharmaceutical composition of claim 33.

35. A recombinant adeno-associated virus (rAAV) particle, comprising (1) an rAAV vector comprising an expression component for expressing an arylsulfatase A (ARSA) polypeptide, wherein the expression component comprises a gene encoding the ARSA polypeptide, and the ARSA polypeptide is operably linked to a promoter and an optional enhancer, and (2) a modified AAV9 capsid protein, wherein the modified AAV9 capsid protein comprises a targeting peptide having SEQ ID NO: 10, and the recombinant adeno-associated virus (rAAV) particle is used to treat MLD.

36. The rAAV particle of claim 35, wherein the ARSA polypeptide comprises SEQ ID NO:

1.

37. The rAAV particle of claim 35 or claim 36, wherein the targeting peptide is flanked by linker sequences at its N-terminus and C-terminus.

38. The rAAV particle of claim 37, wherein the combined targeting peptide and linker sequence comprises SEQ ID NO:

11.

39. The rAAV particle of any one of claims 35-38, wherein the modified AAV9 capsid protein is a modified VP3 capsid protein.

40. The rAAV particle of any one of claims 35-38, wherein the modified VP3 capsid protein has a sequence at least 98.5% identical to SEQ ID NO:

12.

41. The rAAV particle of claim 40, wherein the modified VP3 capsid protein comprises a sequence comprising SEQ ID NO:

12.

42. The rAAV particle of any one of claims 35-38, wherein VP1, VP2 and VP3 capsid proteins are unmodified AAV9 capsid proteins.

43. The rAAV particle of any one of claims 35-42, wherein the expression component comprises a codon-optimized ARSA gene of SEQ ID NO:

2.

44. The rAAV particle of any one of claims 35-43, wherein the rAAV vector comprises a 5' AAV2 ITR of SEQ ID NO:4 and a 3' AAV2 ITR of SEQ ID NO:

5.

45. The rAAV particle of any one of claims 35-44, wherein the expression component comprises a CMV enhancer element comprising SEQ ID NO:

6.

46. ​​The rAAV particle of any one of claims 35-45, wherein the expression component comprises a chicken b-actin promoter comprising SEQ ID NO:

7.

47. The rAAV particle of any one of claims 35-46, wherein the rAAV vector further comprises a WPRE element.

48. The rAAV particle of claim 47, wherein the WPRE element has a sequence comprising SEQ ID NO:

8.

49. The rAAV particle of any one of claims 35-48, wherein the rAAV vector has a sequence comprising SEQ ID NO: 16.

Images