SNP (Single Nucleotide Polymorphism) marker primer pair related to porcine tolerance mycoplasmal pneumonia character on porcine chromosome 15 and application of SNP marker primer pair

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) marker primer pair related to a porcine mycoplasma pneumonia tolerance character on a porcine chromosome 15 and application of the SNP marker primer pair. The locus of the SNP marker is a molecular marker of the nucleotide locus rs1110963643 of a porcine chromosome 15 in a reference sequence of an international porcine genome version 11.1, and the SNP marker has T / C polymorphism. According to a primer pair for detecting the SNP marker, an upstream primer is SEQ ID NO: 2, and a downstream primer is SEQ ID NO: 3. The SNP marker provided by the invention can be applied to marker-assisted selection of swine mycoplasmal pneumonia resistant traits, and swine populations or strains resistant to swine mycoplasmal pneumonia traits are screened by identifying the genotype of the SNP marker. Establishment of the group or strain can improve the capability of tolerating swine mycoplasmal pneumonia and produce more social and economic benefits.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to a SNP marker primer pair related to the trait of pig tolerance to mycoplasma pneumonia and an application thereof. Background Art

[0002] Globally, mycoplasma pneumonia in pigs has caused huge economic losses to the pig industry. Mycoplasma pneumonia seriously affects pig production indicators such as feed intake and daily weight gain. The lungs are susceptible to invasion by environmental pathogens, leading to lung diseases, which are usually accompanied by lung lesions and can even cause death in severe cases. As a complex trait, tolerance to mycoplasma pneumonia has low heritability and many influencing factors. Therefore, it is difficult to directly select pigs for tolerance to mycoplasma pneumonia through traditional methods. Traditional methods are inefficient and genetic improvement is slow. In recent years, with the development of molecular genetics and genomics, researchers have begun to use the association between single nucleotide polymorphism (SNP) markers and pig traits to solve this problem. SNP markers are a common genomic genetic marker with the advantages of being highly polymorphic and widely distributed in the genome, so they have become an important tool for studying pig genetic traits.

[0003] Based on this background, this patent proposes a SNP marker primer pair related to the trait of tolerance to mycoplasma pneumonia as a complex trait with low heritability and many influencing factors. The trait can be quickly and accurately evaluated for the trait of mycoplasma pneumonia tolerance in pigs through genotyping technology. This technology can not only reduce the cost of production and improve the tolerance of mycoplasma pneumonia in pig herds, but also provide important molecular genetic basis for pig breeding and improvement. Summary of the invention

[0004] The purpose of the present invention is to provide a breeding molecular marker developed from SNP markers related to pig tolerance to mycoplasma pneumonia, in view of the slow effect and small progress of traditional pig tolerance to mycoplasma pneumonia breeding.

[0005] Another object of the present invention is to provide a primer pair and a detection method for detecting the above-mentioned SNP marker. Another object of the present invention is to provide uses of the above-mentioned SNP marker, molecular marker, and primer.

[0006] The purpose of the present invention can be achieved through the following technical solutions:

[0007] A molecular marker on pig chromosome 15 that is associated with the trait of pig tolerance to mycoplasma pneumonia, the molecular marker sequence is shown in SEQ ID NO: 1, which contains a SNP marker site associated with the trait of pig tolerance to mycoplasma pneumonia, which is the nucleotide site rs1110963643 on chromosome 15 of the international pig genome version 11.1 reference sequence (the site was identified by the team through whole genome association analysis), and the SNP marker site described in SEQ ID NO: 1 is located at position 234, and there is a T / C polymorphism.

[0008] A primer pair for detecting a SNP marker on chromosome 15 of pigs related to the trait of pig tolerance to mycoplasma pneumonia, wherein the upstream primer is tatgtgcggtaactcagcca (SEQ ID NO: 2) and the downstream primer is tctttgcactgggggtaatgg (SEQ ID NO: 3).

[0009] The molecular markers and primer pairs of the present invention are used in detecting the mycoplasma pneumonia tolerance trait of pigs and pig breeding.

[0010] A method for detecting the SNP marker on pig chromosome 15 related to the trait of pig tolerance to mycoplasma pneumonia, comprising PCR amplifying a sequence of the rs1110963643 nucleotide site of pig chromosome 15 of the pig international pig genome version 11.1 reference sequence, sequencing the amplified product, and interpreting the T / C polymorphism of the site.

[0011] As a preferred embodiment of the present invention, the pig is a Pimei pig.

[0012] As a preferred embodiment of the present invention, the primer pairs of the present invention are used to perform PCR amplification on the genomic DNA of Pimei pig.

[0013] As a further preference of the present invention, the method comprises the following steps:

[0014] (1) Extract DNA from pig ear tissue samples;

[0015] (2) using the extracted porcine genomic DNA as a template and performing PCR amplification using the primer pair of the present invention;

[0016] (3) The amplified product was sequenced, the sequencing results were analyzed, and the T / C polymorphism at position 234 of SEQ ID NO: 1 was determined.

[0017] The molecular markers of the present invention are used in screening pig groups or new strains with stronger tolerance to mycoplasma pneumonia.

[0018] The primer pair of the present invention is used in screening a pig population or a new strain with a stronger ability to tolerate mycoplasma pneumonia.

[0019] A method for screening a pig population with a stronger ability to tolerate mycoplasma pneumonia, comprising detecting the genotype of the rs1110963643 nucleotide site on chromosome 15 of the pig international porcine genome version 11.1 reference sequence, and selecting TT-type individuals at the rs1110963643 nucleotide site as reserve breeding pigs.

[0020] As a preferred embodiment of the present invention, the pig breed used is Pimei pig.

[0021] As a preferred embodiment of the present invention, the method for detecting the genotype of the nucleotide site rs1110963643 of pig chromosome 15 in the international pig genome version 11.1 reference sequence is selected from PCR or gene sequencing.

[0022] Beneficial Effects

[0023] The present invention develops a SNP marker on chromosome 15 of pigs related to pig tolerance to mycoplasma pneumonia, and provides a primer pair and method for detecting the marker. The SNP marker provided by the present invention can be applied to marker-assisted selection of pig tolerance to mycoplasma pneumonia, and the genotype of the SNP marker can be identified to screen a pig population or strain with tolerance to mycoplasma pneumonia. The establishment of the population or strain can improve the ability to tolerate mycoplasma pneumonia in pigs and generate more social and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the gel image of PCR amplification of the rs1110963643 site on chromosome 15 of Pimei pig.

[0025] Figure 2 This is an example of the genotyping map of the rs1110963643 locus on chromosome 15 of Pimei pig.

[0026] Note: The genotype of A is TT, the genotype of B is TC, and the genotype of C is CC. Specific implementation plan

[0027] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention all fall within the scope of the present invention.

[0028] Example 1

[0029] 1 Data Source

[0030] The data used are from the slaughter data records of Kunshan Meishan Pig Breeding Co., Ltd. After slaughter, the proportion of lung lesion area and the seven lobes of the pig are scored as the phenotype: the proportion of lesion area of ​​each lobe is 0%, 1-25%, 26-50%, 51-75%, and 76-100%, and is scored 0, 1, 2, 3, and 4 points respectively. The total score of the seven lobes is 28 points.

[0031] 2 Extraction of pig genomic DNA

[0032] One ear tissue sample of these 56 pigs was collected for individual DNA extraction;

[0033] Refer to the instructions of the tissue DNA extraction kit of Tiangen Biotechnology Company. The extraction steps are as follows:

[0034] ① First, add 68 mL and 200 mL of anhydrous ethanol to buffer GD and rinse solution PW respectively, and mix thoroughly.

[0035] ② Collect about 100 mg of ear tissue sample and place it in a 2 mL EP tube. After completely mincing, add 200 μL of buffer GA and shake until completely suspended.

[0036] ③ Add 20 μL of proteinase K solution, mix well and digest overnight in a 56°C water bath until the tissue sample is dissolved. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0037] ④ Add 200 μL of buffer GB, mix thoroughly by inversion, and place in a 70°C metal bath for 10 min. The solution should become clear and centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0038] ⑤ Add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0039] ⑥ Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, place the adsorption column in a collection tube, then centrifuge at 12,000 rpm for 30 seconds, pour out the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0040] ⑦ Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in the collection tube

[0041] ⑧ Add 600 μL of rinse solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0042] ⑨Repeat step ⑧.

[0043] ⑩ Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0044] Transfer the adsorption column CB3 into a clean centrifuge tube, add 100 μL of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 2-5 minutes, centrifuge it at 12,000 rpm for 2 minutes, collect the solution in a centrifuge tube, add the solution obtained by centrifugation to the adsorption column CB3, let it stand at room temperature for 2 minutes, centrifuge it at 12,000 rpm for 2 minutes, and collect the solution in a centrifuge tube.

[0045] The quality and concentration of DNA were detected using Nanodrop-2000 spectrophotometer. The DNA concentration was diluted to 50 ng / μL and stored at -20°C for future use.

[0046] 3. PCR amplification and sequencing of target fragments

[0047] PCR amplification was performed using Pimei pig genomic DNA as a template. The reaction system included 1 μL of DNA template, 1 μL of primers shown in SEQ ID NO: 2 and SEQ ID NO: 3, and 22 μL of PCR mix. The amplification procedure was as follows:

[0048]

[0049] The amplified product was subjected to agarose gel electrophoresis, and the product fragment size was about 495 bp. The electrophoresis results were as follows Figure 1 The remaining amplified products were sequenced, and the sequencing results were compared with DNAman software to verify the accuracy of the sequence, and Chromas software was used to type the rs1110963643 site.

[0050] 4 Statistical analysis

[0051] Use the editor of SAS 9.4 software to run the code for genotype and phenotype association analysis. The code is as follows:

[0052]

[0053] 5 Results

[0054] Table 1 shows the effects of different genotypes of rs1110963643 on the tolerance of Pimei pigs to mycoplasma pneumonia. The results showed that the genotype of rs1110963643 was significantly associated with the total score of the proportion of lung lesions (P<0.001). Among them, the total score of the proportion of lung lesions in TT type individuals was significantly lower than that in CC type individuals (P<0.001), indicating that the tolerance of TT type individuals to mycoplasma pneumonia was significantly greater than that of CC type individuals (P<0.001); the total score of the proportion of lung lesions was significantly different between TT type and TC type, CC type individuals (P<0.05), indicating that the tolerance of TT type and TC type, CC type individuals to mycoplasma pneumonia was significantly different (P<0.05). Therefore, breeding the TT type at the rs1110963643 locus in Pimei pigs is beneficial to increasing the mycoplasma tolerance of the Pimei pig population, thereby improving the economic benefits and disease resistance of Pimei pigs.

[0055] Table 1 Association analysis between rs1110963643 locus on chromosome 15 and lung lesion area after slaughter

[0056]

[0057] Note: Numbers with different letters in the same column indicate significant differences (P<0.001).

Claims

1. A method for developing molecular markers associated with swine tolerance to mycoplasma pneumonia, characterized in that: Based on the nucleotide sequence of the rs1110963643 nucleotide site on chromosome 15 of the international swine genome version 11.1 reference sequence, a primer pair was designed, and PCR amplification was performed using swine genomic DNA as a template to convert the rs1110963643 nucleotide site on chromosome 15 of the international swine genome version 11.1 reference sequence into a molecular marker. The genotype of the rs1110963643 nucleotide site was significantly associated with the mycoplasma tolerance phenotype, among which TT type individuals had significantly greater tolerance to mycoplasma pneumonia than CC type individuals.

2. The method according to claim 1, characterized in that The primer pair sequence is upstream primer: SEQ ID NO: 2, downstream primer: SEQ ID NO:

3.

3. Molecular markers obtained according to the method of claim 1 or 2.

4. The molecular marker according to claim 3, characterized in that The molecular marker sequence is shown in SEQ ID NO:

1. The nucleotide site of rs1110963643 on chromosome 15 of the international porcine genome version 11.1 reference sequence is located at position 234 in SEQ ID NO:

1. There is a T / C polymorphism. The tolerance of TT-type individuals to mycoplasma pneumonia is significantly greater than that of CC-type individuals.

5. A primer pair for detecting SNP markers associated with swine tolerance to mycoplasma pneumonia, characterized in that: The upstream primer is: SEQ ID NO: 2, and the downstream primer is: SEQ ID NO: 3; the SNP marker associated with the pig's tolerance to mycoplasma pneumonia is a molecular marker at the rs1110963643 nucleotide site of the international pig genome version 11.1 reference sequence pig chromosome 15, and has a T / C polymorphism, and the SNP marker genotype is significantly correlated with the pig's tolerance to mycoplasma pneumonia.

6. A method for detecting the SNP marker associated with the trait of pig tolerance to mycoplasma pneumonia as claimed in claim 5, characterized in that: It comprises a PCR amplification of a section of the nucleotide site rs1110963643 of the pig chromosome 15 of the reference sequence of the international pig genome version 11.1, sequencing the amplified product, and interpreting the T / C polymorphism of the site.

7. The method according to claim 6, characterized in that The following steps are involved: (1) Extract total DNA from pig tissue samples; (2) using the extracted porcine genomic DNA as a template and performing PCR amplification using the primer pair described in claim 5; (3) The amplified product was sequenced, the sequencing results were analyzed, and the T / C polymorphism at position 234 of SEQ ID NO: 1 was determined.

8. Use of the molecular marker according to claim 3 or 4 and the primer pair according to claim 5 in screening a population of pigs resistant to mycoplasma pneumonia.

9. A method for tolerating a population of pigs with mycoplasma pneumonia, characterized in that: This includes detecting the genotype of the rs1110963643 nucleotide site on chromosome 15 of the pig international pig genome version 11.1 reference sequence, and selecting TT type individuals with the rs1110963643 nucleotide site as breeding pigs.

10. The method according to claim 9, characterized in that The pig is a Pimei pig.

Images