Chemically induced multifunctional gene editing system and application thereof

Abstract

The invention provides a chemically induced multifunctional gene editing system and application thereof, and relates to the technical field of gene editing. The basic group editing system is a multifunctional basic group editing system with controllable chemical drugs, which is obtained by fusing orthogonal chemical drug induced protein dimerization response elements (receptor protein and reader protein expression elements) in the existing PROCISiR system with nuclease or deaminase respectively. The base editing system not only has the characteristic of editing a single base substrate induced by a single chemical drug, but also has the ability of editing two base substrates induced by two chemical drugs, and effectively reduces the existing off-target editing while keeping higher editing activity.

Description

Technical Field

[0001] The present application relates to the field of gene editing technology, and in particular to a chemically induced multifunctional gene editing system and its application. Background Art

[0002] At present, the new generation of gene editing tools based on CRISPR-Cas9 have been deeply applied to various biological fields. The main representatives of base editing technologies derived from this are cytosine base editing technology CBE (C to T conversion), adenine base editing technology ABE (A to G conversion) and dual base editing technology A&C-BE (A to G and C to T conversion), which can efficiently perform different types of base conversions on the genome, bringing hope for the cure of genetic diseases caused by base mutations.

[0003] The current base editing technology has a relatively single function and has certain off-target events, and can only achieve single base editing or uncontrollable double base editing. For example, A&C-BEmax, although it can achieve single base editing and double base editing of A or C within the editing window, only A or C must be within the editing window. In addition, this double base editing technology is uncontrollable and still has certain off-target events.

[0004] Therefore, the development of base editing systems with new multifunctional base editing properties while maintaining low off-target events remains an urgent need in the field. Summary of the invention

[0005] The present invention utilizes the previously reported PROCISiR system (Pleiotropic Response Outputs from a Chemically Inducible Single Receiver), which is a chemical induction system with a multi-effect response output of a single receptor protein receiver, which can be used to program cellular responses caused by different structures of single receptor proteins. The PROCISiR system mainly consists of a central receptor "receiver" protein (receptor protein) and a "reader" protein (reader protein expression element). Among them, the NS3a protease is used as the central receptor "receiver" protein, which can be targeted by a variety of clinically approved drug inputs; the "reader" protein can recognize the specific inhibitor binding state of NS3a, and uses a genetically encoded peptide to selectively recognize the apolipoprotein form of the protease. According to the basic principle of PROCISiR, a controllable orthogonal chemically induced multifunctional base editing system is designed in this application, named cmfBE (Acontrollable multi-function base editor), which has the ability of multifunctional base editing, that is, the characteristics of single-base substrate (A or C) editing induced by a single drug, and also has the ability of two-base substrate editing induced by two drugs, while maintaining high editing activity and effectively reducing off-target editing.

[0006] On the one hand, the present application provides the application of a chemically induced protein dimerization system in gene editing.

[0007] Furthermore, the chemically induced protein dimerization system includes a PROCISiR system and / or an orthogonal chemically induced protein dimerization system based on PRY; preferably, the chemically induced protein dimerization system is a PROCISiR system.

[0008] This application is the first to apply a chemically induced protein dimerization system to a gene editing system to achieve accurate control of the gene editing process.

[0009] On the other hand, the present application also provides a fusion protein, which includes: a chemically induced protein dimerization system, a deaminase, and a nuclease.

[0010] Furthermore, the chemically induced protein dimerization system includes a PROCISiR system and / or an orthogonal chemically induced protein dimerization system based on PRY; preferably, the chemically induced protein dimerization system is a PROCISiR system.

[0011] Furthermore, the fusion protein includes: at least one reader protein expression element, a deaminase, a receptor protein, a nuclease, and a uracil glycosidase inhibitor.

[0012] In a preferred embodiment, the PROCISiR system includes a reader protein expression element and a receptor protein.

[0013] Preferably, the fusion protein comprises more than one reader protein expression element; more preferably, the fusion protein comprises two reader protein expression elements.

[0014] Further, the reader protein expression element is a protein expression element responsive to a chemical small molecule drug; preferably, the reader protein expression element is selected from one or more of GNCR1, DNCR2, and PRSIM; more preferably, the reader protein expression element is GNCR1 and / or DNCR2; more preferably, the amino acid sequence of GNCR1 includes the amino acid sequence shown in SEQ ID No.1 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.1; more preferably, the coding sequence of GNCR1 includes the nucleotide sequence shown in SEQ ID No.2 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.2; more preferably, the amino acid sequence of DNCR2 includes the amino acid sequence shown in SEQ ID No.3 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.3; more preferably, the coding sequence of DNCR2 includes the nucleotide sequence shown in SEQ ID No.4 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.4.

[0015] More preferably, the reader protein expression elements are GNCR1 and DNCR2.

[0016] More preferably, the amino acid sequence of GNCR1 includes the amino acid sequence shown in SEQ ID No.1 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.1.

[0017] More preferably, the coding sequence of GNCR1 includes the nucleotide sequence shown in SEQ ID No.2 or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.2.

[0018] More preferably, the amino acid sequence of GNCR1 is shown as SEQ ID No.1, and the encoding nucleotide sequence of GNCR1 is shown as SEQ ID No.2.

[0019] More preferably, the amino acid sequence of DNCR2 comprises the amino acid sequence shown in SEQ ID No.3 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.3.

[0020] More preferably, the coding sequence of DNCR2 comprises the nucleotide sequence shown in SEQ ID No.4 or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.4.

[0021] More preferably, the amino acid sequence of DNCR2 is shown as SEQ ID No.3, and the encoding nucleotide sequence of DNCR2 is shown as SEQ ID No.4.

[0022] Preferably, the reader protein expression element comprises a first reader protein expression element and a second reader protein expression element; more preferably, the first reader protein expression element is GNCR1, and the second reader protein expression element is DNCR2.

[0023] Further, the deaminase includes cytosine deaminase and / or adenosine deaminase; preferably, the cytosine deaminase is a human-derived cytosine deaminase, a rat-derived cytosine deaminase, a mouse-derived cytosine deaminase and / or a bacterial-derived cytosine deaminase; more preferably, the cytosine deaminase is a human-derived cytosine deaminase; more preferably, the cytosine deaminase is cytosine deaminase AID; more preferably, the amino acid sequence of the cytosine deaminase includes the amino acid sequence shown in SEQ ID No.5 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.5; more preferably, the coding sequence of the cytosine deaminase includes the nucleotide sequence shown in SEQ ID No.6 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO. IDNO.6 has a nucleotide sequence with at least 98% sequence identity; preferably, the adenosine deaminase is a bacterial adenosine deaminase; more preferably, the adenosine deaminase is selected from one or more of adenosine deaminase derived from Escherichia coli, adenosine deaminase derived from Staphylococcus aureus, adenosine deaminase derived from Salmonella choleraesuis, and adenosine deaminase derived from Streptococcus pyogenes; more preferably, the adenosine deaminase is adenosine deaminase TadA-8e derived from Escherichia coli; more preferably, the amino acid sequence of the adenosine deaminase includes the amino acid sequence shown in SEQ ID No.7 or an amino acid sequence with at least 98% sequence identity to SEQ ID NO.7; more preferably, the coding sequence of the adenosine deaminase includes the nucleotide sequence shown in SEQ IDNo.8 or a nucleotide sequence with at least 98% sequence identity to SEQ ID NO.8.

[0024] More preferably, the amino acid sequence of the cytosine deaminase comprises the amino acid sequence shown in SEQ ID No.5 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.5.

[0025] More preferably, the coding sequence of the cytosine deaminase comprises the nucleotide sequence shown in SEQ ID No.6 or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.6.

[0026] More preferably, the amino acid sequence of the cytosine deaminase is shown as SEQ ID No.5, and the encoding nucleotide sequence of the cytosine deaminase is shown as SEQ ID No.6.

[0027] More preferably, the amino acid sequence of the adenosine deaminase comprises the amino acid sequence shown in SEQ ID No.7 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.7.

[0028] More preferably, the coding sequence of the adenosine deaminase comprises the nucleotide sequence shown in SEQ ID No. 8 or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO. 8.

[0029] More preferably, the amino acid sequence of the adenosine deaminase is shown as SEQ ID No.7, and the encoding nucleotide sequence of the adenosine deaminase is shown as SEQ ID No.8.

[0030] Further, the receptor protein includes NS3 / 4A protease and / or NS3 / 4A (S139A) protease of the hepatitis virus HCV; preferably, the receptor protein is NS3a; more preferably, the amino acid sequence of the receptor protein includes the amino acid sequence shown in SEQ ID No.9 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.9; more preferably, the coding sequence of the receptor protein includes the nucleotide sequence shown in SEQ ID No.10 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.10.

[0031] More preferably, the amino acid sequence of the receptor protein comprises the amino acid sequence shown in SEQ ID No.9 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.9.

[0032] More preferably, the coding sequence of the receptor protein comprises the nucleotide sequence shown in SEQ ID No.10 or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.10.

[0033] More preferably, the amino acid sequence of the receptor protein is shown as SEQ ID No.9, and the encoding nucleotide sequence of the receptor protein is shown as SEQ ID No.10.

[0034] Further, the nuclease is selected from one or any several of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1; preferably, the nuclease is Cas9; more preferably, the nuclease is selected from one or any several of Cas9 derived from Streptococcus pneumoniae, Staphylococcus aureus, Streptococcus pyogenes, or Streptococcus thermophilus; more preferably, the nuclease is selected from one or any several of nCas9, dCas9, VQR-spCas9, VRER-spCas9, and spCas9 in Cas9 mutants; more preferably, the nuclease is spCas9; more preferably, the amino acid sequence of the nuclease includes the amino acid sequence shown in SEQ ID No.11 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.11; more preferably, the coding sequence of the nuclease includes the nucleotide sequence shown in SEQ ID No.12 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.12 has a nucleotide sequence with at least 98% sequence identity.

[0035] More preferably, the amino acid sequence of the nuclease comprises the amino acid sequence shown in SEQ ID No.11 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.11.

[0036] More preferably, the coding sequence of the nuclease comprises the nucleotide sequence shown in SEQ ID No.12 or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.12.

[0037] More preferably, the amino acid sequence of the nuclease is shown as SEQ ID No.11, and the encoding nucleotide sequence of the nuclease is shown as SEQ ID No.12.

[0038] Furthermore, the uracil glycosidase inhibitor is selected from one or more of a human-derived uracil glycosidase inhibitor, a rat-derived uracil glycosidase inhibitor, a mouse-derived uracil glycosidase inhibitor, or a bacterial-derived uracil glycosidase inhibitor; preferably, the uracil glycosidase inhibitor is derived from Bacillus subtilis phage PBS1; more preferably, the uracil glycosidase inhibitor is UGI X2 ; More preferably, the amino acid sequence of the uracil glycosidase inhibitor includes the amino acid sequence shown in SEQ ID No.13 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.13; More preferably, the coding sequence of the uracil glycosidase inhibitor includes the nucleotide sequence shown in SEQ ID No.14 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.14.

[0039] UGI X2 The function is to inhibit the C-to-U editing produced by AID deaminase, which is cleaved by glycosidases in the cell to produce AP sites.

[0040] More preferably, the amino acid sequence of the uracil glycosidase inhibitor comprises the amino acid sequence shown in SEQ ID No. 13 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO. 13.

[0041] More preferably, the coding sequence of the uracil glycosidase inhibitor comprises the nucleotide sequence shown in SEQ ID No.14 or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.14.

[0042] More preferably, the amino acid sequence of the uracil glycosidase inhibitor is shown as SEQ ID No.13, and the nucleotide sequence encoding the uracil glycosidase is shown as SEQ ID No.14.

[0043] Further, the fusion protein further comprises an NLS; preferably, the NLS is located at at least one end of the fusion protein; more preferably, the amino acid sequence of the NLS comprises the amino acid sequence shown in SEQ ID No.15 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.15; more preferably, the coding sequence of the NLS comprises the nucleotide sequence shown in SEQ ID No.16 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.16;

[0044] And / or, the fusion protein further comprises auxiliary elements, the auxiliary elements comprising T2A and / or IRES; preferably, the amino acid sequence of T2A comprises the amino acid sequence shown in SEQ ID No.17 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.17; more preferably, the coding sequence of T2A comprises the nucleotide sequence shown in SEQ ID No.18 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.18; preferably, the coding sequence of IRES comprises the nucleotide sequence shown in SEQ ID No.19 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.19.

[0045] More preferably, the NLS is located at both ends of the fusion protein.

[0046] The function of T2A is to allow two simultaneously transcribed genes to be expressed separately without affecting each other's functions.

[0047] IRES has the function of recruiting ribosomes independently without relying on the cap structure, thereby initiating the translation of downstream genes.

[0048] More preferably, the amino acid sequence of the NLS comprises the amino acid sequence shown in SEQ ID No.15 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.15.

[0049] More preferably, the coding sequence of the NLS comprises the nucleotide sequence shown in SEQ ID No.16 or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.16.

[0050] More preferably, the amino acid sequence of the NLS is shown as SEQ ID No.15, and the encoding nucleotide sequence of the NLS is shown as SEQ ID No.16.

[0051] More preferably, the amino acid sequence of T2A comprises the amino acid sequence shown in SEQ ID No.17 or an amino acid sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.17.

[0052] More preferably, the coding sequence of T2A comprises the nucleotide sequence shown in SEQ ID No.18 or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity with SEQ ID NO.18.

[0053] More preferably, the amino acid sequence of T2A is shown as SEQ ID No.17, and the encoding nucleotide sequence of T2A is shown as SEQ ID No.18.

[0054] More preferably, the coding sequence of the IRES comprises the nucleotide sequence shown in SEQ ID No. 19, or a nucleotide sequence having 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity to SEQ ID NO. 19.

[0055] More preferably, the encoding nucleotide sequence of the IRES is shown as SEQ ID No.19.

[0056] Furthermore, starting from the N-terminus of the sequence toward the C-terminus, the connection order of the fusion protein is: the reader protein expression element is located at the N-terminus and / or C-terminus of the deaminase, and the receptor protein is located at the N-terminus or C-terminus of the nuclease; preferably, in the fusion protein, the deaminase, the reader protein expression element, the receptor protein, the nuclease, and the uracil glycosidase inhibitor are connected in sequence;

[0057] More preferably, the deaminase comprises cytosine deaminase and adenosine deaminase;

[0058] More preferably, the reader protein expression element comprises a first reader protein expression element and a second reader protein expression element; more preferably, the first reader protein expression element is GNCR1, and the second reader protein expression element is DNCR2;

[0059] More preferably, adenosine deaminase, a first reader protein expression element, cytosine deaminase, a second reader protein expression element, a receptor protein, a nuclease, and a uracil glycosidase inhibitor are linked in sequence.

[0060] Preferably, in the fusion protein, adenosine deaminase, a first reader protein expression element, cytosine deaminase, a second reader protein expression element, a receptor protein, a nuclease, and a uracil glycosidase inhibitor are connected in sequence starting from the N (nitrogen) end of the sequence toward the C (carbon) end.

[0061] More preferably, starting from the N-terminus of the sequence toward the C-terminus, the NLS, adenosine deaminase, the first reader protein expression element, cytosine deaminase, the second reader protein expression element, the receptor protein, the nuclease, and the NLS in the fusion protein are connected in sequence.

[0062] Furthermore, the fusion protein further comprises auxiliary elements, and the auxiliary elements comprise one or more of XTEN.

[0063] XTEN acts to connect two different proteins.

[0064] In a preferred embodiment, starting from the N-terminus of the sequence to the C-terminus, the fusion protein comprises NLS, adenosine deaminase, a first reader protein expression element, T2A, NLS, cytosine deaminase, a second reader protein expression element, IRES, a receptor protein, XTEN, a nuclease, NLS, T2A, UGI X2 , NLS are connected in sequence.

[0065] In a preferred embodiment, starting from the N-terminus of the sequence to the C-terminus, the fusion protein comprises NLS, adenosine deaminase, a first reader protein expression element, T2A, NLS, cytosine deaminase, a second reader protein expression element, IRES, a receptor protein, XTEN, a nuclease, NLS, T2A, UGI X2 , NLS are connected in sequence.

[0066] Those skilled in the art will appreciate that a known linker can be added between the various elements in the fusion protein for connection, and the fusion protein can also be subjected to known modifications, including phosphorylation, acetylation, ubiquitination, glycosylation, etc. The linker sequence can be GSG.

[0067] It is understandable that those skilled in the art can select a suitable gene editing system and gene editing method according to actual conditions to complete the construction of the above-mentioned fusion protein.

[0068] In a preferred embodiment, the encoding nucleotide sequence of the fusion protein is shown as SEQ ID No.22.

[0069] On the other hand, the present application also provides a biomaterial, which comprises any one of the following A)-F):

[0070] A) a gene encoding the fusion protein;

[0071] B) an expression cassette, the expression cassette comprising the gene described in A);

[0072] The expression cassette described herein may also include functional elements such as a promoter, a terminator, and a marker gene, and those skilled in the art may make conventional selections according to actual conditions, as long as the expression of the gene described in A) can be achieved. The structure and composition of the expression cassette are not restricted too much here;

[0073] C) a recombinant vector, the recombinant vector containing A) the gene and / or B) the expression cassette;

[0074] The vector described herein refers to a vector that can carry exogenous DNA or target gene into host cells for amplification and expression. The vector can be a cloning vector or an expression vector. Those skilled in the art can choose according to actual conditions, and no excessive restrictions are imposed here.

[0075] D) a recombinant cell or recombinant bacterium, containing the fusion protein, A) the gene, B) the expression cassette or C) the recombinant vector;

[0076] E) A chemically induced gene editing system, comprising the fusion protein; preferably, the gene editing system further comprises sgRNA, wherein the sgRNA guides the fusion protein to perform gene editing on a target gene in a target cell; more preferably, the target sequence of the sgRNA comprises at least one of SEQ ID No.23-SEQ ID No.26;

[0077] In a specific implementation, the target sequence of the sgRNA may include any one, any two, any three or all four of SEQ ID No.23, SEQ ID No.24, SEQ ID No.25, and SEQ ID No.26;

[0078] In a preferred embodiment, the editing target is one or more of ABE site 25, ABE site 27, ABE site 23, and HEK site 3;

[0079] Preferably, the chemically induced gene editing system edits base conversions from A (adenine) to G (guanine) and C (cytosine) to T (thymine) in the target site;

[0080] It has been demonstrated in this application that in the case of multiple targets, the fusion protein exhibits editing capabilities from A to G and C to T, and maintains considerable activity. Therefore, those skilled in the art can choose to design other editing targets for gene editing operations based on this, and no excessive restrictions are imposed here;

[0081] F) A multi-base gene editing kit with low off-target rate, the kit comprising E) the system and a chemical small molecule drug; preferably, the chemical small molecule drug responds to the reader protein expression element.

[0082] Preferably, the first reader protein expression element is GNCR1, and the corresponding chemical small molecule drug is Grazoprevir; the second reader protein expression element is DNCR2, and the corresponding chemical small molecule drug is Danoprevir.

[0083] Preferably, the concentration of the chemical small molecule drug Grazoprevir is 1-5 μM, and the concentration of Danoprevir is 1-10 μM.

[0084] More preferably, the concentration of the chemical small molecule drug Grazoprevir is 2 μM, and the concentration of Danoprevir is 5 μM.

[0085] In a specific implementation, when the reader protein expression element in the gene editing system includes GNCR1, the addition of Grazoprevir can induce the base conversion from A to G in the editing target of the gene editing system;

[0086] When the reader protein expression element in the gene editing system includes DNCR2, the addition of Danoprevir can induce the C to T base conversion in the editing target site of the gene editing system;

[0087] When the reader protein expression elements in the gene editing system include GNCR1 and DNCR2, the simultaneous addition of Grazoprevir and Danoprevir can induce the gene editing system to simultaneously edit the A to G and C to T base conversions in the target site.

[0088] On the other hand, the present application also provides the use of the fusion protein or the biomaterial in gene editing for non-disease diagnosis and treatment purposes, improving gene editing efficiency, reducing gene editing off-target rate and / or preparing gene editing products.

[0089] The present invention has the following beneficial effects:

[0090] The present invention provides a controllable orthogonal chemically induced multifunctional base editing system, named cmfBE, which has multifunctional base editing capabilities, has the characteristics of single-drug induced editing of a single base substrate (A or C), and has the ability to edit two base substrates induced by two drugs, and effectively reduces the existence of off-target editing while maintaining high editing activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] The drawings described herein are used to provide a further understanding of the present application and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation on the present application. In the drawings:

[0092] Figure 1is a design and construction diagram of chemically induced cmfBE, wherein the amino acid sequence of GNCR1 is shown in SEQ ID No.1, the coding sequence is shown in SEQ ID No.2, the amino acid sequence of DNCR2 is shown in SEQ ID No.3, the coding sequence is shown in SEQ ID No.4, the amino acid sequence of AID is shown in SEQ ID No.5, the coding sequence is shown in SEQ ID No.6, the amino acid sequence of TadA-8e is shown in SEQ ID No.7, the coding sequence is shown in SEQ ID No.8, the amino acid sequence of NS3a is shown in SEQ ID No.9, the coding sequence is shown in SEQ ID No.10, the amino acid sequence of SpCas9(D10A) is shown in SEQ ID No.11, the coding sequence is shown in SEQ ID No.12, and the amino acid sequence of UGI is shown in SEQ ID No.13. X2 The amino acid sequence of is shown in SEQ ID No.13, and the coding sequence is shown in SEQ ID No.14, the amino acid sequence of NLS is shown in SEQ ID No.15, and the coding sequence is shown in SEQ ID No.16, the amino acid sequence of T2A is shown in SEQ ID No.17, and the coding sequence is shown in SEQ ID No.18, the coding sequence of IRES is shown in SEQ ID No.19, the amino acid sequence of XTEN is shown in SEQ ID No.20, and the coding sequence is shown in SEQ ID No.21;

[0093] Figure 2 This is a graph of the editing efficiency of cmfBE at different endogenous target sites in humans;

[0094] Figure 3 This is the efficiency diagram of cmfBE editing two bases A / C simultaneously at different endogenous target sites in humans;

[0095] Figure 4 This is the off-target assessment diagram of cmfBE at the endogenous target sites ABE site23 and HEK site3;

[0096] Figure 5 This is the off-target assessment diagram of cmfBE at the RNA level. DETAILED DESCRIPTION

[0097] Technical terms:

[0098] Protein dimerization: Protein dimerization refers to the process in which two protein molecules combine into a complex through non-covalent interaction.

[0099] Identity: refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules in molecular evolution research.

[0100] Recombination: Broadly speaking, any gene exchange process that causes genotype changes is called recombination.

[0101] Expression cassette: An expression cassette is a group of DNA sequences consisting of a promoter, a target gene, and a reporter gene, which can be expressed in specific tissues and easily detected.

[0102] Recombinant vector: A recombinant vector is a vector that transfers the target gene into the basic skeleton of a cloning vector, thereby enabling the target gene to be expressed.

[0103] Recombinant bacteria: A fungal cell strain that uses genetic engineering methods to efficiently express exogenous genes.

[0104] Recombinant cell: The term "recombinant cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "recombinant cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

[0105] In order to more clearly explain the overall concept of the present application, the following is described in detail in conjunction with the accompanying drawings of the specification by way of embodiment. In the following description, a large number of specific details are provided to provide a more thorough understanding of the present invention. However, it is obvious to those skilled in the art that the present invention can be implemented without one or more of these details. In other examples, in order to avoid confusion with the present invention, some technical features well known in the art are not described.

[0106] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0107] Unless otherwise specified, in the following embodiments, the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0108] The processes, conditions, reagents, experimental methods, etc. for implementing the present invention, except for the contents specifically mentioned below, are all common knowledge and common common sense in the art, and the present invention has no particular limitations, such as those described in Sambrook et al., Molecular Cloning, A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the recommended conditions of the manufacturer.

[0109] Among them, the PROCISiR system is described in the literature (Foight, et al. Nat Biotechnol, 2019).

[0110] 1.1 Plasmid design and construction

[0111] 1.1.1. Based on the PROCISiR system, the NS3a protease was fused to SpCas9 (D10A) as the central receptor "receiver" protein using the Gibson assembly method. The protein expression elements GNCR1 and DNCR2 that respond to small molecule drugs of Grazoprevir (Grazo) and Danoprevir (Dano) were inserted into the C-terminus of Tad-8e and AID, respectively, using the Gibson assembly method. T2A was used as the connecting protein in the middle (the specific sequence is shown in Table 1, and the construction structure is shown in Table 1). Figure 1 shown).

[0112] Table 1 Recombinant plasmid sequences

[0113]

[0114]

[0115]

[0116]

[0117]

[0118] At the same time, four endogenous targets from humans, ABE site 25, ABE site 27, ABE site 23, and HEK site 3, were designed for multi-target verification (targets and sequences, the sequences are shown in Table 2).

[0119] Table 2 Targets and sequences used

[0120] Target name Sequence (5'-3') SEQ ID No. ABE site 25 AGTAAACAAAGCATAGACTGAGG 23 ABE site 27 CGGGCATCAGAATTCCCTGGAGG 24 ABE site 23 TAAGCATAGACTCCAGGATAAGG 25 HEK site 3 GGCCCAGACTGAGCACGTGATGG 26

[0121] The forward and reverse single-stranded DNAs of the targets ABE site 25, ABE site 27, ABE site 23, and HEK site 3 shown in Table 2 were artificially synthesized, and short double-stranded nucleotides were formed after annealing. They were connected to the BbsI site of the sgRNA expression plasmid U6-sgRNA-EF1α-GFP (used to express the sgRNA of the corresponding target) through Golden gate cloning to obtain the recombinant target plasmid.

[0122] 1.1.3. The plasmids constructed in 1.1.1 and 1.1.2 were sequenced by Sanger sequencing to ensure that the plasmids were correct.

[0123] 1.2 Cell transfection

[0124] HEK293T 2×105 The cells were plated in 24-well plates. When the cell density reached 70%-80%, the plasmid combination was transfected according to cmfBE / ABE8e / AID-BE4max / eA&C-BEmax:sgRNA=750ng:250ng. Each plasmid combination was transfected in 3 replicates, with 2×10 cells per well. 5 cells. A blank control without any treatment was also set up. 24 hours after transfection, Grazoprevir (concentration: 2 μM) or Danoprevir (concentration: 5 μM) was added, or both drugs were added at the same time. After 3 days, the cell genome was extracted, as shown in Table 3.

[0125] Plasmids ABE8e, AID-BE4max and eA&C-BEmax were used as controls. The specific structures are as follows Figure 1 shown.

[0126] Table 3

[0127] Group Plasmid name Chemical drugs Untreated - - ABE8 ABE8 - AID-BE4max AID-BE4max - eA&C-BEmax eA&C-BEmax - cmfBE-Grazo / Dano cmf - cmfBE+Grazo cmf Grazoprevir cmfBE+Dano cmf Danoprevir cmfBE+Grazo / Dano cmf Grazoprevir+Danoprevir

[0128] 1.3. Genome extraction and preparation of amplicon libraries

[0129] 72h after transfection, BIOSEARCH QuickExtract TM The DNA extraction kit (QE09050) was used to extract the genomic DNA of the cells. Then, the corresponding identification primers (Table 4) were designed, that is, the bridging sequence 5'-ggagtgagtacggtgtgc-3' was added to the 5' end of the forward identification primer, and the bridging sequence 5'-gagttggatgctggatgg-3' was added to the 5' end of the reverse identification primer, and a first-round PCR product was obtained. Then, the first-round PCR product was used as a template, and the second-round PCR was performed, mixed together, cut and recovered, purified, and sent to the sequencing company for second-generation sequencing.

[0130] Table 4 Target identification primers used

[0131]

[0132] 1.4 Off-target detection

[0133] 1.4.1. Off-target primers were designed for off-target sites predicted by the Cas-OFFinder website (sequences are shown in Table 5). Subsequent cell transfection, gene extraction and preparation of amplicon libraries were the same as in 1.2 and 1.3.

[0134] Table 5 Off-target primers

[0135]

[0136]

[0137] 1.5. NGS sequencing results analysis and statistics

[0138] The NGS sequencing results of step 1.3 were analyzed using the BE-analyzer website (http: / / www.rgenome.net / be-analyzer / #!) to calculate the ratio of A to G or C to T. The results are as follows Figure 2-5 shown.

[0139] The results show that:

[0140] like Figure 2 and Figure 3 As shown, the highest efficiency at four endogenous targets was compared: compared with the ABE8e editing efficiency of 70.2%-87.4%, the targeted editing efficiency of cmfBE with the addition of the chemical drug Grazo was 61.5%-67.5%, a slight decrease of about 10%; compared with the control AID-BE4max editing efficiency

[0141] Compared with 71.2%-77.6%, the targeted editing efficiency of cmfBE with the addition of the chemical drug Dano was

[0142] 72.3%-77.9%, similar editing efficiency; compared with the editing efficiency of eA&C-BEmax A to G

[0143] The editing efficiency of A to G in cmfBE was 44.0%-68.7%, the editing efficiency of C to T was 54.7%-74.9%, and the efficiency of A / C simultaneous editing was 49.17%-60.81%, and their A to G or C to T editing efficiency decreased slightly.

[0144] By further analyzing off-target editing, in terms of DNA off-target (such as Figure 4 ), a total of 17 potential off-target sites at 2 sites were detected. The results showed that ABE8e had 4 off-target sites, and the cmfBE with ABE function had only 1 off-target site, namely ABE site23 OT1, and the off-target efficiency was significantly reduced; AID-BE4max produced 1 off-target site, and the cmfBE with CBE function produced 3 off-target sites, with a slight increase in off-target; eA&C-BEmax produced 1 off-target site, and the cmfBE with two base editing functions produced 2 off-target sites; Overall, the number of cmf DNA off-target sites was the same as that of the corresponding functional base editors, and there was no significant increase. In terms of RNA off-target (such as Figure 5), compared with ABE8e in A-to-I off-target events, cmfBE off-target events were similar; compared with AID-BE4max in C-to-U off-target events, cmfBE off-target events were similar; compared with eA&C-BEmax in A-to-I and C-to-U off-target events, cmfBE off-target events were significantly reduced.

[0145] In summary, this application has developed a multifunctional base editing tool that is efficient and has low off-target effects and can be controlled by chemical induction.

[0146] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. Application of chemically induced protein dimerization system in gene editing.

2. The use according to claim 1, characterized in that: The chemically induced protein dimerization system includes a PROCISiR system and / or a PRY-based orthogonal chemically induced protein dimerization system; preferably, the chemically induced protein dimerization system is a PROCISiR system.

3. A fusion protein, characterized in that The fusion protein includes: a chemically induced protein dimerization system, a deaminase, and a nuclease.

4. The fusion protein according to claim 3, characterized in that The chemically induced protein dimerization system includes a PROCISiR system and / or a PRY-based orthogonal chemically induced protein dimerization system; preferably, the chemically induced protein dimerization system is a PROCISiR system.

5. The fusion protein according to claim 4, characterized in that The fusion protein includes: at least one reader protein expression element, a deaminase, a receptor protein, a nuclease, and a uracil glycosidase inhibitor; Preferably, the reader protein expression element is a protein expression element responsive to a chemical small molecule drug; more preferably, the reader protein expression element is selected from one or more of GNCR1, DNCR2, and PRSIM; more preferably, the reader protein expression element is GNCR1 and / or DNCR2; more preferably, the amino acid sequence of GNCR1 includes the amino acid sequence shown in SEQ ID No.1 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.1; more preferably, the coding sequence of GNCR1 includes the nucleotide sequence shown in SEQ ID No.2 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.2; more preferably, the amino acid sequence of DNCR2 includes the amino acid sequence shown in SEQ ID No.3 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.3; more preferably, the coding sequence of DNCR2 includes the nucleotide sequence shown in SEQ ID No.4 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.4; Preferably, the deaminase comprises cytosine deaminase and / or adenosine deaminase; more preferably, the cytosine deaminase is a human-derived cytosine deaminase, a rat-derived cytosine deaminase, a mouse-derived cytosine deaminase and / or a bacterial-derived cytosine deaminase; more preferably, the cytosine deaminase is a human-derived cytosine deaminase; more preferably, the cytosine deaminase is cytosine deaminase AID; more preferably, the amino acid sequence of the cytosine deaminase comprises the amino acid sequence shown in SEQ ID No.5 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.5; more preferably, the coding sequence of the cytosine deaminase comprises the nucleotide sequence shown in SEQ ID No.6 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO. IDNO.6 has a nucleotide sequence with at least 98% sequence identity; preferably, the adenosine deaminase is a bacterial adenosine deaminase; more preferably, the adenosine deaminase is selected from one or more of adenosine deaminase derived from Escherichia coli, adenosine deaminase derived from Staphylococcus aureus, adenosine deaminase derived from Salmonella choleraesuis, and adenosine deaminase derived from Streptococcus pyogenes; more preferably, the adenosine deaminase is adenosine deaminase TadA-8e derived from Escherichia coli; more preferably, the amino acid sequence of the adenosine deaminase includes the amino acid sequence shown in SEQ ID No.7 or an amino acid sequence with at least 98% sequence identity to SEQ ID NO.7; more preferably, the coding sequence of the adenosine deaminase includes the nucleotide sequence shown in SEQ ID No.8 or a nucleotide sequence with at least 98% sequence identity to SEQ ID NO.8; Preferably, the receptor protein comprises NS3 / 4A protease and / or NS3 / 4A (S139A) protease of HCV of hepatitis virus; more preferably, the receptor protein is NS3a; more preferably, the amino acid sequence of the receptor protein comprises the amino acid sequence shown in SEQ ID No.9 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.9; more preferably, the coding sequence of the receptor protein comprises the nucleotide sequence shown in SEQ ID No.10 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.10; Preferably, the nuclease is selected from one or any several of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1; more preferably, the nuclease is Cas9; more preferably, the nuclease is selected from one or any several of Cas9 derived from Streptococcus pneumoniae, Staphylococcus aureus, Streptococcus pyogenes, or Streptococcus thermophilus; more preferably, the nuclease is selected from one or any several of nCas9, dCas9, VQR-spCas9, VRER-spCas9, and spCas9 in Cas9 mutants; more preferably, the nuclease is spCas9; more preferably, the amino acid sequence of the nuclease includes the amino acid sequence shown in SEQ ID No.11 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.11; more preferably, the coding sequence of the nuclease includes the nucleotide sequence shown in SEQ ID No.12 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.12 has a nucleotide sequence with at least 98% sequence identity; Preferably, the uracil glycosidase inhibitor is selected from one or more of a human-derived uracil glycosidase inhibitor, a rat-derived uracil glycosidase inhibitor, a mouse-derived uracil glycosidase inhibitor, or a bacterial-derived uracil glycosidase inhibitor; preferably, the uracil glycosidase inhibitor is derived from Bacillus subtilis phage PBS1; more preferably, the uracil glycosidase inhibitor is UGI X2 ; More preferably, the amino acid sequence of the uracil glycosidase inhibitor includes the amino acid sequence shown in SEQ ID No.13 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.13; More preferably, the coding sequence of the uracil glycosidase inhibitor includes the nucleotide sequence shown in SEQ ID No.14 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

14.

6. The fusion protein according to claim 5, characterized in that The fusion protein also includes an NLS; preferably, the NLS is located at at least one end of the fusion protein; more preferably, the amino acid sequence of the NLS includes the amino acid sequence shown in SEQ ID No.15 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.15; more preferably, the coding sequence of the NLS includes the nucleotide sequence shown in SEQ ID No.16 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

16.

7. The fusion protein according to claim 5, characterized in that The fusion protein also includes auxiliary elements, which include T2A and / or IRES; preferably, the amino acid sequence of T2A includes the amino acid sequence shown in SEQ ID No.17 or an amino acid sequence having at least 98% sequence identity with SEQ ID NO.17; more preferably, the coding sequence of T2A includes the nucleotide sequence shown in SEQ ID No.18 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.18; preferably, the coding sequence of IRES includes the nucleotide sequence shown in SEQ ID No.19 or a nucleotide sequence having at least 98% sequence identity with SEQ ID NO.

19.

8. The fusion protein according to claim 5, characterized in that Starting from the N-terminus of the sequence toward the C-terminus, the connection order of the fusion protein is: the reader protein expression element is located at the N-terminus and / or C-terminus of the deaminase, and the receptor protein is located at the N-terminus or C-terminus of the nuclease; preferably, in the fusion protein, the deaminase, the reader protein expression element, the receptor protein, the nuclease, and the uracil glycosidase inhibitor are connected in sequence; More preferably, the deaminase comprises cytosine deaminase and adenosine deaminase; More preferably, the reader protein expression element comprises a first reader protein expression element and a second reader protein expression element; more preferably, the first reader protein expression element is GNCR1, and the second reader protein expression element is DNCR2; More preferably, adenosine deaminase, a first reader protein expression element, cytosine deaminase, a second reader protein expression element, a receptor protein, a nuclease, and a uracil glycosidase inhibitor are linked in sequence.

9. Biomaterial, characterized in that The biological material includes any one of the following A)-F): A) a gene encoding the fusion protein according to any one of claims 3 to 8; B) an expression cassette, the expression cassette comprising the gene described in A); C) a recombinant vector, the recombinant vector containing A) the gene and / or B) the expression cassette; D) a recombinant cell or recombinant bacterium, comprising the fusion protein according to any one of claims 3 to 8, the gene according to A), the expression cassette according to B or the recombinant vector according to C; E) A chemically induced gene editing system, comprising the fusion protein according to any one of claims 1 to 8; preferably, the gene editing system further comprises sgRNA, wherein the sgRNA guides the fusion protein to perform gene editing on a target gene in a target cell; more preferably, the target sequence of the sgRNA comprises at least one of SEQ ID No. 23 to SEQ ID No. 26; F) A multi-base gene editing kit with low off-target rate, the kit comprising E) the system and a chemical small molecule drug; preferably, the chemical small molecule drug responds to the reader protein expression element.

10. Use of the fusion protein as described in any one of claims 3 to 8 or the biomaterial as described in claim 9 in gene editing for non-disease diagnosis and treatment purposes, improving gene editing efficiency, reducing gene editing off-target rate and / or preparing gene editing products.

Images