Method for inhibiting gene horizontal transfer based on vibrio harveyi tfoX knockout

Abstract

The invention discloses a method for inhibiting gene horizontal transfer based on vibrio harveyi tfoX knockout, and relates to the fields of molecular biology and gene engineering. The method for inhibiting gene horizontal transfer disclosed by the invention comprises the following steps: introducing a target exogenous plasmid into a conjugational transfer donor bacterium and then conjugating with a recipient bacterium. By knocking out the fX gene of the recipient bacterium vibrio harveyi, the efficiency of obtaining exogenous plasmids by the vibrio harveyi through conjugational transfer is reduced, and the method has the characteristic of remarkably reducing the conjugational transfer efficiency. Compared with a wild type host cell, the efficiency of obtaining the plasmid pMMB207 in donor bacteria escherichia coli through conjugational transfer by the tfoX gene knockout host cell is reduced by about 1000 times. According to the method, the obtaining capacity of host cells on exogenous plasmids is greatly reduced, and the method has very important significance on resisting pathogenicity and drug resistance of microorganisms.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for inhibiting gene horizontal transfer based on Vibrio harveyi tfoX knockout. Background Art

[0002] Vibrio harveyi is an important conditional pathogen of marine aquaculture organisms, causing great harm to the marine aquaculture industry. A survey of marine fish diseases along the coast of South China found that about 70% of vibriosis in marine fish was caused by Vibrio harveyi. Due to the limitations of other control methods such as vaccines and immunopotentiators, antibiotics are considered to be the most effective and flexible weapon against bacterial infectious diseases and are widely used to prevent or treat bacterial diseases in aquaculture. At present, the drug resistance situation of Vibrio harveyi is severe, with a resistance index as high as 0.60. The urgency of effective disease prevention and control and the drug resistance caused by antibiotic treatment both indicate that it is urgent to explore new disease prevention and control strategies, and reducing toxicity and resistance is the fundamental requirement for disease prevention and control, and is the key to implementing green and healthy aquaculture.

[0003] The key to reducing toxicity and resistance lies in the control of virulence genes and drug resistance genes. Virulence genes and drug resistance genes of pathogenic microorganisms can be horizontally transmitted between different species through mobile genetic elements such as plasmids through conjugation transfer, thereby enhancing the pathogenicity and drug resistance of pathogens and increasing the complexity and variability of disease prevention and control. Therefore, reducing the efficiency of conjugation transfer of plasmids between bacteria can effectively prevent and control the spread and diffusion of virulence and drug resistance genes, and is considered to be one of the effective strategies for preventing and controlling the spread of virulence and drug resistance of pathogenic microorganisms. Summary of the invention

[0004] In view of the problems existing in the above-mentioned prior art, the purpose of the present invention is to provide a method for inhibiting horizontal gene transfer. The method is used for plasmid conjugation transfer, which can effectively reduce the efficiency of plasmid conjugation transfer and effectively solve the problem of rapid spread of drug-resistant and pathogenic bacteria.

[0005] To solve the above problems, the present invention is achieved as follows:

[0006] The first objective of the present invention is to provide an application of knocking out the bacterial natural competent global regulatory factor encoding gene tfoX in inhibiting gene horizontal transfer.

[0007] Preferably, the bacterium is Vibrio harveyi, and the natural competent global regulatory factor encoding gene tfoX is shown as 818bp-1405bp of SEQ ID NO.1.

[0008] The tfoX gene is located at positions 3334061-3334648 on chromosome 1 of the Vibrio harveyi genome, with an ID of CU052_16110 and consists of 588 bases. The ID of its encoded protein TfoX is NP_797621.1. TfoX is a global regulator of the natural competence of bacterial transformation. Activated tfoX promotes the synthesis of a large number of competent device proteins, which is crucial for the formation of the natural competent device across the cell membrane in the bacterial transformation process.

[0009] The second object of the present invention is to provide a Vibrio harveyi with low conjugation transfer efficiency, wherein the natural competent global regulatory factor encoding gene tfoX of Vibrio harveyi is knocked out, and the natural competent global regulatory factor encoding gene tfoX is shown as 818bp-1405bp of SEQ ID NO.1.

[0010] The third object of the present invention is to provide a method for constructing Vibrio harveyi with low conjugation transfer efficiency, which is to knock out the natural competent global regulatory factor encoding gene tfoX of Vibrio harveyi to obtain Vibrio harveyi with low conjugation transfer efficiency, and the natural competent global regulatory factor encoding gene tfoX is shown as 818bp-1405bp of SEQ ID NO.1.

[0011] Preferably, the steps include:

[0012] Step 1: Design gene knockout primers for tfoX, a gene encoding a natural competent global regulatory factor on the Vibrio harveyi genome;

[0013] Step 2: Using Vibrio harveyi as the starting strain, knock out the natural competent global regulatory factor encoding gene tfoX, and obtain the gene-deficient strain V.harveyi 345-ΔtfoX, which is a Vibrio harveyi with low conjugation transfer efficiency.

[0014] Preferably, the gene knockout primers in step one are: upstream homology arm amplification primers: aagcttgatatcgaattcTACCA TGGTTGCGCCTAG and caatcatcgtgaaactaaagcgatCTTATATTTTTCACAGTTTAGTTGAGTAAAT TC, downstream homology arm amplification primers gaatttactcaactaaactgtgaaaaatataagATCGCTTTAGTTTCACGATGATT G and ttggtaacgaatcagacGCCATCCTCAACGCGATG.

[0015] Preferably, in step 2, the knocking out of the natural competent global regulatory factor encoding gene tfoX specifically comprises the following steps:

[0016] (1) PCR amplification of the upstream and downstream homology arms of the tfoX gene and the linearized suicide plasmid;

[0017] (2) isothermally assembling upstream and downstream homology arms and linearizing the suicide plasmid to obtain a recombinant plasmid, transforming the recombinant plasmid into the intermediate host E. coli GEB802 and the donor bacterium E. coli GEB883, and obtaining positive clones by PCR identification;

[0018] (3) The donor bacterium E. coli GEB883 was cultured to the early logarithmic stage, and the recipient bacterium V. harveyi 345 was cultured to the early logarithmic stage;

[0019] (4) The early logarithmic-stage recipient bacterium V. harveyi 345 was heat-shocked at 40°C for 30 min and subjected to conjugation transfer experiments with the early logarithmic-stage donor bacterium E. coli GEB883;

[0020] (5) Screening and identifying single-exchange clones and double-exchange clones to obtain strains with tfoX gene deletion, i.e., Vibrio harveyi with low conjugative transfer efficiency;

[0021] In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single exchange clones specifically refers to screening by a plate containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double exchange clones specifically refers to screening by a plate containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing a primer pair: CAATTACAGAGGTCAATGGACATGAC and TCTAAACGCCTACTGAGCGTAC for PCR identification.

[0022] Further, in some embodiments of the present invention, before the conjugation transfer step, the above method includes: a tfoX gene knockout step; the above tfoX gene knockout step includes: constructing a recombinant suicide plasmid containing upstream and downstream homologous arm fragments of the targeting fragment (the tfoX gene fragment to be knocked out); introducing the recombinant suicide plasmid into the conjugation transfer donor bacterial host Escherichia coli GEB883; and conjugating the donor bacteria containing the recombinant suicide plasmid with the recipient bacteria.

[0023] It should be noted that the above-mentioned gene knockout method uses homologous recombination to knock out the tfoX gene, but in some other embodiments, other gene knockout methods can also be used to knock out the tfoX gene. No matter what method is used to knock out the tfoX gene, such as complete knockout, partial knockout, or even using RNAi interference vector to inhibit tfoX gene expression and inactivate it, as long as the tfoX gene of the recipient bacteria does not function during the conjugation transfer of the plasmid, it falls within the protection scope of the present invention.

[0024] The fourth object of the present invention is to provide the use of the above-mentioned Vibrio harveyi with low conjugation transfer efficiency as a genetically engineered bacterium in gene knockout, inhibition of horizontal gene transfer or reduction of drug-resistant bacteria.

[0025] The fifth object of the present invention is to provide a method for inhibiting horizontal gene transfer based on tfoX knockout of Vibrio harveyi, which comprises the following steps: introducing the target exogenous plasmid into a conjugative transfer donor bacterium, and then conjugating with the above-mentioned Vibrio harveyi with low conjugative transfer efficiency.

[0026] Preferably, the exogenous plasmid is pMMB207, and the donor bacteria is Escherichia coli GEB883.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention's research found for the first time that, compared with wild strains, knocking out the tfoX gene can inhibit its efficiency in acquiring exogenous plasmids through conjugation transfer. Based on this result, in the process of conjugation transfer, the donor bacteria containing the target exogenous plasmid are mixed with the recipient bacteria with the tfoX gene knocked out, and conjugation transfer is performed, which can reduce the conjugation transfer efficiency of the target exogenous plasmid from the donor bacteria to the recipient bacteria, inhibit the horizontal transfer of exogenous genes, and is of great significance for resisting the rapid spread of drug-resistant and pathogenic microorganisms.

[0029] The present invention invents a method for inhibiting horizontal gene transfer based on tfoX knockout, which greatly reduces the ability of host cells to acquire exogenous plasmids through conjugation transfer. Compared with the starting bacteria, the conjugation transfer efficiency of V.harveyi 345-ΔtfoX is significantly reduced. This method greatly reduces the ability of Vibrio harveyi to absorb exogenous plasmids, which is of great significance for resisting the pathogenicity and drug resistance of microorganisms.

[0030] The method for inhibiting horizontal gene transfer provided by the present invention comprises: mixing a donor bacterium containing a target exogenous plasmid with a recipient bacterium with a tfoX gene knocked out, knocking out the tfoX gene of the recipient bacterium, reducing conjugation transfer, and inhibiting horizontal gene transfer. The method has the characteristic of significantly reducing the efficiency of conjugation transfer. For example, compared with the wild-type V.harveyi 345, the efficiency of V.harveyi 345-ΔtfoX with a tfoX gene knocked out in obtaining the plasmid pMMB207 through conjugation transfer is reduced by about 1000 times. The method for inhibiting horizontal gene transfer provided by the present invention is of great significance for resisting the emergence of drug-resistant pathogens.

[0031] The starting strain V. harveyi 345 of the present invention has been published in NCBI (CP025537, CP025538, CP025539, CP025540). The recombinant plasmid intermediate host E. coli GEB802, donor bacteria Ecoli GEB883, and plasmid pSW7848 involved in the present invention have been published in the document: Deng YQ, Su YL, Liu SL, et al. Identification of a novel small RNA srvg23535 in Vibrio alginolyticus ZJ-T and its characterization with phenotype microarray technology [J]. Frontiers in microbiology, 2018: 2394. The inventor also holds the above-mentioned microorganisms and vectors, and guarantees to provide them to the public within 20 years from the date of application. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Construction of a knockout strain of tfoX, a gene encoding a naturally competent global regulatory factor;

[0033] Among them, lane M1: DNA Marker DL5000; lane 1: pSW7848 linearized fragment; lane M2: DNA Marker DL2000; lane 2 / 3: tfoX upstream / downstream fragments; lane M3: DNA Marker DL10000; lane 4: recombinant pSW7848-tfoX detection fragment; lane M4: DNA Marker DL2000; lane 5: tfoX gene knockout identification primer amplification results using wild-type Vibrio harveyi 345 genomic DNA as template; lane 6: tfoX gene knockout identification primer amplification results using tfoX candidate mutant genomic DNA as template.

[0034] Figure 2 The figure is a comparison of the conjugative transfer efficiency of the starting strain V. harveyi 345 and V. harveyi 345-ΔtfoX in chloramphenicol plates.

[0035] Figure 3 A comparison of the relative conjugation efficiencies of the starting strains V. harveyi 345 and V. harveyi 345-ΔtfoX. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is further described below in conjunction with embodiments, but the protection scope of the present invention is not limited thereto.

[0037] For the source of suicide plasmid pSW7848, see the literature: Val, ME., Skovgaard, O., Ducos-Galand, M., Bland, MJ, Mazel, D., 2012. Genome engineering in Vibrio cholerae: a feasible approach to addressing biological issues. PLoS Genet. 8, e1002472.

[0038] For the source of E.coli GEB883, please refer to the literature: Nguyen, AN, Disconzi, E., Charrière, GM, Destoumi eux-Garzón, D., Bouloc, P., Le Roux, F., Jacq, A., 2018. csrB geneduplication drives the evolution of redundant regulatory pathways controlling expression of the major toxic secreted metalloproteases in Vibriotasmaniensis LGP32.mSphere.3,e00582-00518.

[0039] E. coli GEB802 is disclosed in the literature Deng YQ, Su YL, Liu SL, et al. Identification of a novel small RNA srvg23535 in Vibrio alginolyticus ZJ-T and its characterization with phenotype microarray technology [J]. Frontiers in microbiology, 2018: 2394. E. coli GEB802 is π3813 in the article.

[0040] Embodiment 1:

[0041] 1. Knockout of tfoX (CU052_16110), the gene encoding the natural competent global regulatory factor, in the genome of V. harveyi 345

[0042] In the experiment, we designed corresponding gene knockout primers for the tfoX gene (Table 1).

[0043] Table 1 Primers related to gene knockout and identification

[0044]

[0045] The tfoX gene ORF and its upstream and downstream sequences (specifically shown in SEQ ID NO. 1), the italic ATG and TAA are the tfoX start codon and stop codon, respectively, from 818 bp to 1405 bp.

[0046] The genome of V. harveyi 345 was extracted as a template, and the upstream homology arm amplification primers: tfoX-U_fwd: aagcttgatatcgaattcTACCATGGTTGCGCCTAG and tfoX-U_rev: caatcatcgtgaaactaaagcgatCTTATATT TTTCACAGTTTAGTTGAGTAAATTC, and the downstream homology arm amplification primers tfoX-D_fwd: gaatttactcaactaaact gtgaaaaatataagATCGCTTTAGTTTCACGATGATTG and tfoX-D_rev: ttggtaacgaatcagacGCCATCC TCAACGCGATG were used to obtain the upstream and downstream flanking sequences of the tfoX gene. The suicide plasmid pSW7848 was used as a template, and the linearized plasmid pSW7848 was obtained by PCR amplification using primers pSW7848-F and pSW7848-R. The upstream and downstream flanking sequences were isothermally assembled with the linearized plasmid using the seamless cloning kit ClonExpress MultiS One Step Cloning Kit (Nanjing Novogene Biotechnology Co., Ltd.), and the obtained recombinant plasmid pSW7848-tfoX (whose sequence is shown in SEQ ID NO.2) was successively transformed into the intermediate host E. coli GEB802 and the donor bacteria E. coli GEB883 (the preparation and transformation methods of E. coli GEB802 and E. coli GEB883 competent cells refer to the invention patent CN 107904228A), and the positive clones were screened by PCR based on the primers pSW7848-check-F and pSW7848-check-R. The above PCR amplification system and procedure refer to the invention patent CN 107904228 A.

[0047] The mutant strain V.harveyi 345-ΔtfoX was constructed with reference to the invention patent CN 107904228 A. The recipient bacterium V.harveyi 345 was cultured to the early logarithmic stage (OD 600nm =0.3-0.7), and then heat-shocked at 40°C for 30 min and cultured to the early logarithmic phase (OD 600nm=0.3~0.7) donor bacteria containing recombinant plasmid pSW7848-tfoX E. coli GEB883 was transferred by conjugation. The recombinant plasmid pSW7848-tfoX in E. coli GEB883 strain was transferred into V. harveyi 345 by conjugation transfer of bacterial genes. Since the pSW7848 plasmid cannot replicate itself in V. harveyi 345, it can only replicate with the genome after the plasmid is integrated into the genome of V. harveyi 345 by homologous recombination. The integration of the plasmid will give V.harveyi 345 resistance to chloramphenicol, and D-glucose will inhibit the expression of the toxic gene ccdB of the suicide plasmid pSW7848. These single-exchange clones can be obtained by screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose; then, plates containing 0.2% L-arabinose (inducing the expression of the toxic gene ccdB) are coated to screen double-exchange clones, and the clones are further coated with 0.2% L-arabinose and plates containing 34 μg / mL chloramphenicol and 0.2% L-arabinose to screen candidate mutants. PCR identification is performed on clones that do not have chloramphenicol resistance (del tfoX-check-F and del tfoX-check-R), and clones with successful gene knockout are obtained, namely the mutant strain V.harveyi 345-ΔtfoX. According to this process, tfoX is knocked out, and the identification results of its gene knockout are in line with expectations ( Figure 1 ).

[0048] 2. Implementation Effect

[0049] The starting strain V. harveyi 345 and the obtained mutant strain V. harveyi 345-ΔtfoX were heat-shocked at 40℃ for 5 minutes in the early logarithmic period and then respectively hybridized with the RP4 shuttle plasmid pMMB207 (which has chloramphenicol resistance and can self-replicate in V. harveyi 345, and the construction method is shown in Liu, JX, Zhao, Z., Deng, YQ, Shi, Y., Liu, YP, Wu, C., Luo, P., Hu, CQ, 2017. Complete genome sequence of Vibrio campbellii LMB29 isolated from red drum with four native coliGEB883) was conjugated. After overnight conjugation, the plaques were collected with 1 mL of fresh culture medium (LBS culture medium, containing 1% peptone, 0.5% yeast powder, and 3% sodium chloride by mass fraction) and diluted in multiples. 100 μL of bacterial solution with different dilutions was applied to LBS plates containing 34 μg / mL chloramphenicol (containing 1% peptone, 0.5% yeast powder, 3% sodium chloride, and 1.5% technical agar powder by mass fraction) to screen the conjugants. The conjugation transfer efficiency was statistically analyzed. The results showed that ( Figure 2-3 , Table 2), compared with the starting strain Vibrio harveyi 345, the conjugative transfer efficiency of V. harveyi 345-ΔtfoX was significantly reduced by about 1000 times.

[0050] Table 2 Conjugation transfer efficiency of V. harveyi 345 and V. harveyi 345-ΔtfoX

[0051]

[0052] Compared with wild-type host cells, the efficiency of tfoX gene knockout host cells in acquiring the plasmid pMMB207 in the donor bacterium Escherichia coli through conjugation transfer is reduced by about 1000 times. This method greatly reduces the host cell's ability to acquire exogenous plasmids, which is of great significance in resisting microbial pathogenicity and drug resistance.

[0053] Based on the above results, it is shown that the deletion of the gene tfoX can significantly reduce the efficiency of Vibrio harveyi in acquiring exogenous plasmids through conjugation transfer, inhibit horizontal gene transfer, and thereby prevent or reduce the ability of microorganisms to absorb drug-resistant DNA fragments or pathogenic DNA fragments from the external environment. The method provided by the present invention provides a new approach and idea for reducing or avoiding the emergence of drug-resistant bacteria.

[0054] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

[0055] SEQ ID NO.1

[0056] TACCATGGTTGCGCCTAGCTCACGAGAAACCGCGGCACTTTTCACCAATATACTATTGCAGTCTTTAGAAAGGTTGACCGAATGCTTTAACTGTTCAATTGCTTGAGCTGTGACGATATCCCTCACTCGTAAAATGCCTAAGCGAGATACCGCTGTTGTTAGGTCATTACAGGTAATATTACGGCGATTAAAAATCACGGAATTCGCGACGCGAACCACAACCGCAGCAAGACTAGGATCTTCTAGTAACGCATTTGC GACGTCGGAAATCGTGGTGTTTTCTTCTGTGCAGAGTTGCTGGATTTTAAGTACGACATCAGGGATAGGAGGAAGGGAGATTTTCCCGGTAGAAATTGATTGTTCTACTAGGTGAGCGAACTCAGATTCGAGTGCTTTTATAAGCTTATCTTTATTATTTGGTAGGCCAAAAAAATGATAGATGTTCCATTATGACGTTGTGCTAGAGAGCTTTCGTACAGTGTACCTCCACACTATGTTG CTTATCAATTAAATACCTATTTCACGTTCGCAATTGCCGCATTTATCACCATGATGGTTTGATTTTTGGCAGTTGCTGTGTCAAAAAAACATCGCTTAAGGATGAGTAAATGTGAAACTAATCACGTATGTGGAATTTGTAGTTCGGCAACTGTGACATAGATCCTAACTTATTTTTCAACGTTAAGTATGATTAAGACAGTTGGTGAGCGCAATTCACAAAAATATCGCCAACATATCGACAATTTATAATTCGCTATAAGCTGCTGTTCATCTGGTGACATCGCTAATCGGGGTAATTTATTCCAATTACAGAGGTCAATGGACATGACAGACCAAGCTTTTTTTAACTATGTAAGCAATTTTAGTGAGTACCAAAAACGTTCAATGTTTGGCGGGATTGGTTTATTCAGCAACGACGCAATGTTCGCACTAGTAAGTAACGACTGTTGTTATTTACGTGGTGGTAACGGGTTAGATGAA G AATTTACTCAACTAAACTGTGAAAAATATAAGCACGTCAAAAAACAAACGACGGCAACCGTTAACTACTATGATGTAACCGATCTATTTGACTCAGGTTTTGCGGGTCTAGACGCGTTGTTACAAAAATCGATTGAATGTTCTATTAAGGAACGTAAATACCAAAAGTCTTCAGCCAGTAGACGTTTGCGTGACCTACCAAATATGCAGTTGACGCTAGAGCGTATGGTCAAAAAAGCAGGTATTGATGACGTAGAAACGTTTTTGGAACTAGGACCAGTAGAAGTATTTAATAAAGTAAGAGTGACATACGGTAGTGATGTTGATGTGAAGCTTCTATGGAAGTTTGCTGGCGCCACTGATGGTATTCACTGGAAGCTGCTCCAAGAACCAC GCAAGAAACAACTGCTGGCAATGTGTGAATAA ATCGCTTTAGTTTCACGATGATTGACTCGTTTAGGATGAAGTTAGCGAGTCATAAAAGGTGAGTGTTGAAAGCGACAAAAGGAAGTTGATGCTTTTGGCCACTTCATTTGAGTTAGTCATTGCAACAAGACAGTTTGTAGATACAAAAAAACCGAGGTAAATGCCTCGGTTTTTTAGTTCATACTTTAAGAAAGTACGCTCAGTAGGCGTTTAGAACTTAAAGCGAGTAGTGAACATTACTTGATCACCGTAGAAGTCGTTGATACGCGCTTCAGCACCCAGAGAGAATAGCTCTGTAGAGTGGAAACGAGCGTAAACAGAACCGATCCAATCGTCATCGTTGTCGATAGAAACGTAACCCGCTTTACCACCAACTTCTAGTTGAGGACCAAGCCATTGGCGCACGCCTAAGTTAAGTTCCATACCAACGTCAGTGCTGCTTGAGTTTGACGGTTGTACAACGCGCATTAGCATTGCACCCGTTAGGTCAGCCCAGTTGTTTAGTGGTGAGTGGAAACCAAAACCCGCTGCTGAATCGAAATCACCATCAAACTCAGAGTCGATGCGCGCGATTACGTGTGCATTTGGGTGGATTGATTTGCTGAAACCAGCACCGAACGTTACTGGGCTAGCACCAATGCGAGCTTCCATGTAGTCGTAGCTAAAGTTGCTCATTGTTGCTGGAGCGTTGTAGTCGTTCGCAGCTAGAGCTTGGCTTGATGCCAACAAAAGGGCAGCGGCTAATAGTGTTTTACGCATAACTAACGATAAACCTTGTCTTATAGTTCCATGGATCCAAGTAACCACTTGAACCGTAATCTGATTTGTTCGACATCATAATAAAAACGAAGGTCTACGACCAACAAAAATGTGTCGATGTTTTGTCAAATGACTCATTGTGCCGTTTTATCAGCAAAAAACGCGCCATGTTGATGACGAATATGACTTGTTTTTCTATCCCAGTACTCATTCACCAAAGCTTGCACGTCGTTGTGC CATCGCGTTGAGGATGGC SEQID NO.2

[0057]

Claims

1. The application of knocking out the gene tfoX encoding the bacterial natural competence global regulatory factor in inhibiting horizontal gene transfer.

2. The use according to claim 1, characterized in that: The bacterium is Vibrio harveyi, and the natural competent global regulatory factor encoding gene tfoX is shown in 818bp-1405bp of SEQ ID NO.

1.

3. A Vibrio harveyi with low conjugation transfer efficiency, characterized in that: The natural competent global regulatory factor encoding gene tfoX of Vibrio harveyi is knocked out, and the natural competent global regulatory factor encoding gene tfoX is shown by 818bp-1405bp of SEQ ID NO.

1.

4. A method for constructing Vibrio harveyi with low conjugative transfer efficiency, characterized in that: The natural competent global regulatory factor encoding gene tfoX of Vibrio harveyi is knocked out to obtain Vibrio harveyi with low conjugation transfer efficiency. The natural competent global regulatory factor encoding gene tfoX is shown by 818bp-1405bp of SEQ ID NO.

1.

5. The construction method according to claim 4, characterized in that: The following steps are involved: Step 1: Design gene knockout primers for tfoX, a gene encoding a natural competent global regulatory factor on the Vibrio harveyi genome; Step 2: Using Vibrio harveyi as the starting strain, knock out the natural competent global regulatory factor encoding gene tfoX, and obtain the gene-deficient strain V.harveyi 345-ΔtfoX, which is a Vibrio harveyi with low conjugation transfer efficiency.

6. The construction method according to claim 5, characterized in that: The gene knockout primers described in step one are: upstream homology arm amplification primers: aagcttgatatcgaattcTACCATGGTTGCGCCTAG and caatcatcgtgaaactaaagcgatCTTATATTTTTCACAGTTTAGTTGAGTAAATTC, downstream homology arm amplification primers gaatttactcaactaaactgtgaaaaatataagATCGCTTTAGTTTCACGATGATTG and ttggtaacgaatcagacGCCATCCTCAACGCGATG.

7. The construction method according to claim 5, characterized in that: In step 2, the knocking out of the natural competent global regulatory factor encoding gene tfoX specifically comprises the following steps: (1) PCR amplification of the upstream and downstream homology arms of the tfoX gene and the linearized suicide plasmid; (2) isothermally assembling upstream and downstream homology arms and linearizing the suicide plasmid to obtain a recombinant plasmid, transforming the recombinant plasmid into the intermediate host E. coli GEB802 and the donor bacterium E. coli GEB883, and obtaining positive clones by PCR identification; (3) The donor bacterium E. coli GEB883 was cultured to the early logarithmic stage, and the recipient bacterium V. harveyi 345 was cultured to the early logarithmic stage; (4) The early logarithmic-stage recipient bacterium V. harveyi 345 was heat-shocked at 40°C for 30 min and subjected to conjugation transfer experiments with the early logarithmic-stage donor bacterium E. coli GEB883; (5) Screening and identifying single-exchange clones and double-exchange clones to obtain strains with tfoX gene deletion, i.e., Vibrio harveyi with low conjugative transfer efficiency; In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single exchange clones specifically refers to screening by a plate containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double exchange clones specifically refers to screening by a plate containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing a primer pair: CAATTACAGAGGTCAATGGACATGAC and TCTAAACGCCTACTGAGCGTAC for PCR identification.

8. Use of the Vibrio harveyi with low conjugation transfer efficiency as claimed in claim 3 as a genetically engineered bacterium in inhibiting horizontal gene transfer or reducing drug-resistant bacteria.

9. A method for inhibiting horizontal gene transfer based on knockout of Vibrio harveyi tfoX, characterized in that: The steps include: The target exogenous plasmid is introduced into the conjugative transfer donor bacteria, and then conjugated with the low conjugative transfer efficiency Vibrio harveyi described in claim 3.

10. The method according to claim 9, characterized in that The exogenous plasmid is pMMB207, and the donor bacteria is Escherichia coli GEB883.

Images