A CRISPR / Cas12a-based EGFR gene mutation detection system and method

Through the CRISPR/Cas12a gene mutation detection system, combined with the RPA system and CRISPR lateral chromatography detection test strips, the high requirements for paraffin-embedded tissue samples in the existing technology are solved, and the rapid, convenient and high-sensitivity EGFR gene mutation detection is achieved, which is suitable for a variety of sample types.

CN119287021BActive Publication Date: 2025-08-08HANGZHOU REPUGENE TECH CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202411833759.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-13
Publication Date
2025-08-08
Estimated Expiration
2044-12-13

AI Technical Summary

Technical Problem

The existing CRISPR/Cas12a gene mutation detection methods have high requirements for samples, require laboratory testing equipment, and are not suitable for fast and convenient detection. It is especially difficult to achieve low-cost and high-sensitivity EGFR gene mutation detection in paraffin-embedded tissue samples.

Method used

A EGFR gene mutation detection system based on CRISPR/Cas12a was developed. Using the RPA system and reporting system, combined with CRISPR lateral chromatography to detect test strips, the specific identification of restriction endonuclease and crRNA is achieved to achieve rapid and convenient detection of paraffin-embedded tissue samples without the need for fluorescence detection equipment.

Benefits of technology

The EGFR gene mutation detection of paraffin-embedded tissue samples within 2 hours was achieved, with the lower detection limit reaching 0.5%~1%, meeting the needs of fast and convenient detection. It is suitable for a variety of sample types, including fresh tissue and paraffin-embedded tissue.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119287021B_ABST
    Figure CN119287021B_ABST
Patent Text Reader

Abstract

The present invention provides an EGFR gene mutation detection system and method based on CRISPR / Cas12a. The detection system includes an RPA system and a reporter system; the RPA system includes a restriction endonuclease or its encoding gene for the wild-type sequence of the EGFR mutation site, an RPA primer or its encoding gene for the EGFR mutation site, and an RPA reagent; the reporter system includes crRNA, Cas protein or its encoding gene, and single-stranded reporter DNA for the EGFR mutation site; wherein the single-stranded reporter DNA is labeled with a fluorescent reporter molecule or a CRISPR lateral flow test strip reporter molecule. This detection method can be used for the detection of fresh tissue and paraffin-embedded tissue samples, and the entire process is controlled within 2 hours. Only a small incubation instrument is required, which realizes fast and convenient detection of gene mutations with a low detection limit for samples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of genetic testing, and specifically relates to a CRISPR / Cas12a-based EGFR gene mutation detection system and method. Background Art

[0002] Epidermal Growth Factor Receptor (EGFR) is a transmembrane glycoprotein with intracellular tyrosine kinase (TK) activity that controls cell proliferation and angiogenesis. EGFR is an oncogene that has been detected in a variety of human malignancies, including non-small cell lung cancer (NSCLC), head and neck cancer, breast cancer, ovarian cancer, and colon cancer. NSCLC accounts for 85% of the current incidence and mortality of lung cancer. Among all EGFR mutations in NSCLC, deletions in exon 19 and L858R point mutations in exon 21 of the gene account for 47% and 41%, respectively. These mutations make NSCLC sensitive to tyrosine kinase inhibitors (TKIs) and can serve as guidance sites for the use of TKIs.

[0003] Currently, the primary methods for detecting EGFR exon 19 deletions and exon 21 L858R point mutations in DNA samples are quantitative PCR (qPCR) or next-generation sequencing (NGS). However, for detecting a small number of well-defined EGFR mutation sites, NGS suffers from long turnaround times, high costs, and complex equipment. Therefore, for the targeted detection of these two sites, qPCR (qPCR) has become the more commonly used method (CN 118240940 A). However, qPCR systems for EGFR mutation detection still have the following limitations: 1) For point mutation detection, development requires significant costs for primer and probe sequence modification and blocker optimization to improve sensitivity and specificity; 2) DNA purity is critical, requiring the use of an appropriate paraffin-based sample extraction kit, which can be time-consuming; and 3) the use of a PCR instrument, which places high demands on laboratory equipment and is not suitable for rapid and convenient testing.

[0004] CRISPR / Cas technology, considered the "next generation of molecular diagnostics," boasts advantages such as speed, portability, low cost, high sensitivity, and strong specificity. It has been proven to be useful for a variety of applications, including SNP typing and tumor gene mutation detection. For example, the type II Cas12a discovered by Zhang Feng's team, guided by crRNA, can specifically recognize and cleave the target gene, subsequently activating Cas12a's trans-cleavage activity. Based on this principle, CN116377036A provides a CRISPR / Cas12a-based system and method for detecting EGFR gene mutations in the peripheral blood of lung cancer patients. This system uses ssDNA fragments bearing fluorescent reporter groups as trans-cleavage targets for the Cas12a protein, and the release of a fluorescent signal indicates the presence of the target gene, thereby identifying whether the sample contains the target gene. However, after RPA amplification of the sample, this method requires a fluorescence detection device for fluorescence excitation and detection of the amplified product, which places high demands on the detection equipment and is not suitable for rapid and convenient detection. Alternatively, naked-eye visualization using blue light irradiation is less objective and difficult to discern at low fluorescence intensities. In addition, the samples processed by this method are artificially synthesized plasmid DNA containing EGFR mutant genes, which has less background interference. However, at the practical application sample level, because ctDNA in plasma samples is highly fragmented and usually exists at low abundance levels, current technology makes it difficult to reliably detect EGFR mutations using DNA samples extracted from blood. Therefore, DNA extraction is currently mainly performed using preserved paraffin-embedded patient tumor tissue samples for EGFR mutation detection. Therefore, it is necessary to develop a rapid and convenient EGFR mutation detection system and method that can be applied to paraffin-embedded tissues. Summary of the Invention

[0005] In order to solve the problems of high sample requirements and the need for laboratory testing equipment in the existing CRISPR / Cas12a-based EGFR gene mutation detection methods, the present invention provides a CRISPR / Cas12a-based EGFR gene mutation detection system and method that can be applied to paraffin-embedded tissue samples. This method does not require fluorescence detection equipment and only requires CRISPR lateral flow test strips to quickly and conveniently report the test results in a similar time. The lower limit of mutation frequency detection for paraffin-embedded tissue samples can reach 0.5%~1%.

[0006] The technical solution adopted by the present invention is: an EGFR gene mutation detection system based on CRISPR / Cas12a, including an RPA system and a reporter system; the RPA system includes a restriction endonuclease or its encoding gene for the wild-type sequence of the EGFR mutation site, an RPA primer or its encoding gene for the EGFR mutation site, and an RPA reagent; the reporter system includes crRNA, Cas protein or its encoding gene, and single-stranded reporter DNA for the EGFR mutation site; wherein the single-stranded reporter DNA is labeled with a fluorescent reporter molecule or a CRISPR lateral flow test strip reporter molecule.

[0007] In order to provide a convenient and fast EGFR gene mutation detection system and method based on CRISPR / Cas12a that can be applied to paraffin-embedded tissue samples, the present invention has developed a detection system and method that can use CRISPR lateral flow detection test strips to report the results of EGFR gene mutation detection. Unlike fluorescence signal detection, CRISPR lateral flow detection test strips do not require fluorescence detection equipment, and the interpretation of the detection line / quality control line is more objective than naked eye observation. Furthermore, in order to meet the concentration requirements of the CRISPR lateral flow detection test strips for reporter molecules and overcome the problem that DNA is degraded and contains more inhibitory substances after nucleic acid is extracted from paraffin-embedded tissue samples, the present invention has made creative improvements in both the detection system and the detection method to improve detection specificity.

[0008] In the detection system, in order to exclude the background interference of a large number of wild-type sequences in tissue samples on the test results, the present invention adds an appropriate amount of restriction endonuclease for the wild-type sequence of the EGFR mutation site in the RPA system, which is used to specifically identify and cut the wild-type amplified sequence obtained by RPA amplification, and combines the crRNA sequence with specific recognition ability in CRISPR / Cas12a detection. The remaining wild-type fragments that are not cleaved by the enzyme will not cause non-specific positive detection signals, thereby ensuring the specificity of the test results under appropriate DNA input. It should be noted that there is no need to add restriction endonuclease buffer in the RPA system. The experimental results show that the addition of restriction endonuclease buffer may inhibit amplification to a certain extent, resulting in abnormal experimental results.

[0009] In detection method, in order to improve detection specificity under shorter detection time, the present invention is by arranging the complex incubation step of Cas12a / crRNA to improve the trans-cleavage activity of Cas12a / crRNA complex, rather than carrying out CRISPR / Cas12a trans-cleavage reaction after purifying RPA reaction product. Generally, it takes 60~90 min to purify RPA reaction product, and this step cannot meet the requirements of rapid detection. And the complex incubation step of Cas12a / crRNA only takes 20~40 min, can be carried out simultaneously with the RPA reaction (consuming about 30~40 min) accompanied by restriction endonuclease, thereby optimizing experimental process, saving detection time, also compared with the mode (CN116377036A) of fluorescence reporting, without the need to extend the detection time.

[0010] Preferably, the EGFR mutation site includes L858R and / or E19 deletion mutation; the E19 deletion mutation includes at least one of E19-E746_A750[1][2], E19-L747_P753>S, and E19-L747_T751. In a specific embodiment of the present invention, four mutations, namely L858R, E19-E746_A750[1][2], E19-L747_P753>S, and E19-L747_T751, can be detected at one time (wherein, E19-E746_A750[1][2] has two subtypes of mutations in the DNA sequence, but the amino acid sequences are identical). Moreover, E19-E746_A750[1][2], E19-L747_P753>S, and E19-L747_T751 cover 75% to 80% of E19 deletion mutations, while detecting E19-E746_A750 alone can only cover about 50% of E19 deletion mutations. It is understood that the detection system provided by the present invention can also detect any of the above-mentioned EGFR mutation sites separately.

[0011] Preferably, the detection system includes an RPA system for L858R, a reporter system for L858R, an RPA system for E19 deletion mutation, and a reporter system for E19 deletion mutation.

[0012] Preferably, the RPA system for L858R includes a restriction endonuclease for the L858R wild-type sequence, RPA primers L858R-F / R, and RPA reagents; the reporter system for L858R includes crRNA-L858R, Cas protein, and single-stranded reporter DNA; wherein the single-stranded reporter DNA is labeled with a fluorescent reporter molecule or a CRISPR lateral flow test strip reporter molecule.

[0013] Preferably, the RPA system for E19 deletion mutation includes a restriction endonuclease for the wild-type sequence of E19 deletion mutation, RPA primer E19-F / R, and RPA reagent; the reporter system for E19 deletion mutation includes crRNA-E19, Cas protein, and single-stranded reporter DNA; wherein the single-stranded reporter DNA is labeled with a fluorescent reporter molecule or a CRISPR lateral flow test strip reporter molecule, and the crRNA-E19 is selected from at least one of crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, and crRNA-E19-L747_T751, and further preferably, the crRNA-E19 includes crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, and crRNA-E19-L747_T751. In a specific embodiment of the present invention, the crRNA-E19 contains crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, and crRNA-E19-L747_T751, which are used to simultaneously detect four E19 deletion mutations, namely E19-E746_A750[1][2], E19-L747_P753>S, and E19-L747_T751, thereby covering 75% to 80% of E19 deletion mutations, which has a wider detection range than detecting E19-E746_A750 alone (covering about 50% of E19 deletion mutations).

[0014] Preferably, the restriction endonuclease cleavage site sequence for the L858R wild-type sequence is 5'-TGGCCA-3'; and the restriction endonuclease cleavage site sequence for the L858R wild-type sequence is preferably MscI.

[0015] Preferably, the target sequence amplified by RPA primer L858R-F / R is preferably:

[0016] . Wherein, the bold part TTTG is represented as the PAM sequence recognized by crRNA-L858R, and the underlined part TGGCCA is represented as the restriction endonuclease cleavage site sequence for the L858R wild-type sequence. When a mutation occurs, the underlined sequence changes, and the restriction endonuclease for the L858R wild-type sequence cannot cut the sequence in which the L858R mutation occurs. Therefore, the wild-type amplified sequence can be digested by the corresponding endonuclease, while the amplified sequence of the L858R mutation is retained and recognized by crRNA-L858R through the PAM sequence, stimulating the trans-cleavage activity of the Cas12a / crRNA complex, and the single-stranded reporter DNA marked with a fluorescent reporter molecule or a CRISPR lateral flow detection test strip reporter molecule is cut, and the released fluorescent reporter molecule or the CRISPR lateral flow detection test strip reporter molecule is identified and reported by fluorescence detection or CRISPR lateral flow detection, respectively.

[0017] Preferably, the RPA primers targeting the L858R mutation include L858R-F and L858R-R, whose sequences are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0018] Preferably, the restriction endonuclease cleavage site sequence for the E19 deletion mutant wild-type sequence is 5'-TTAA-3'; and the restriction endonuclease cleavage site sequence for the E19 deletion mutant wild-type sequence is preferably Msel.

[0019] Preferably, the target sequence amplified by RPA primer E19-F / R is:

[0020] . Among them, the bold part GAAA represents the reverse sequence of the PAM structure recognized by crRNA-E19, and the underlined part TTAA represents the restriction endonuclease cleavage site sequence for the wild-type sequence of the E19 deletion mutation. When a mutation occurs, the italic underlined part sequence TTAA changes, and the restriction endonuclease for the wild-type sequence of the E19 deletion mutation cannot cut the sequence with the E19 deletion mutation. Therefore, the wild-type amplified sequence can be digested by the corresponding endonuclease, while the amplified sequence of the E19 deletion mutation is retained and recognized by crRNA-E19 through the PAM sequence, stimulating the trans-cleavage activity of the Cas12a / crRNA complex, and the single-stranded reporter DNA labeled with a fluorescent reporter molecule or a CRISPR lateral flow detection test strip reporter molecule is cut, and the released fluorescent reporter molecule or CRISPR lateral flow detection test strip reporter molecule is identified and reported by fluorescence detection or CRISPR lateral flow detection, respectively. Among them, the italic underlined part is another restriction site, and a mismatched base should be introduced by the primer to eliminate the restriction site. Therefore, preferably, the restriction endonuclease cleavage site sequence for the wild-type sequence of the E19 deletion mutation is 5'-TTAA-3'; the RPA primers for the E19 deletion mutation include E19-F and E19-R, and the sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.

[0021] Preferably, the PAM sequence recognized by crRNA for L858R is 5'-TTTG-3';

[0022] Preferably, the PAM sequence recognized by crRNA for the E19 deletion mutation is 5'-TTTC-3';

[0023] Preferably, the sequence of crRNA-L858R for L858R is shown in SEQ ID NO. 5;

[0024] Preferably, the sequence of crRNA-E19-E746_A750 targeting E19-E746_A750[1][2] is shown in SEQ ID NO. 6;

[0025] Preferably, the sequence of crRNA-E19-L747_P753>S targeting E19-L747_P753>S is shown in SEQ ID NO.7;

[0026] Preferably, the sequence of crRNA-E19-L747_T751 targeting E19-L747_T751 is shown in SEQ ID NO. 8.

[0027] Preferably, the single-stranded reporter DNA labeled CRISPR lateral flow test strip reporter molecule preferably has a sequence of 5'-FAM-TTATT-biotin-3'.

[0028] Preferably, the single-stranded reporter DNA is labeled with a fluorescent reporter molecule, that is, a reporter system in which a fluorescent tracer and a fluorescent quencher are respectively labeled at both ends of the ssDNA, and the sequence is preferably 5'-FAM-TTATT-BHQ1-3'.

[0029] Preferably, the sample detected by the detection system is selected from at least one of blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, skin swab, oral swab, nasal swab or lavage; the tissue sample is selected from fresh tissue and / or paraffin-embedded tissue.

[0030] Preferably, the detection system further comprises a DNA extraction system, and the DNA extraction system comprises a nucleic acid releasing agent.

[0031] Preferably, the detection system also includes a DNA extraction system for paraffin-embedded tissue samples, which includes a dewaxing solution, a cleaning solution, and a nucleic acid release agent. Sufficient paraffin-embedded tissue samples should be used for testing. For example, paraffin sections should be 10 μM thick and the number of sections should be 4 or more. If the section thickness is 5 μM, the number of sections should be increased.

[0032] Preferably, the detection system includes an RPA system for L858R, a reporter system for L858R, an RPA system for E19 deletion mutations, and a reporter system for E19 deletion mutations; the RPA system for L858R includes a restriction endonuclease MscI with a cleavage site sequence of 5'-TGGCCA-3', RPA primers L858R-F / R with sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, and RPA reagents; the reporter system for L858R includes crRNA-L858R with a sequence as shown in SEQ ID NO. 5, Cas12a protein, and a single-stranded reporter DNA with a sequence of 5'-FAM-TTATT-biotin-3'; the RPA system for E19 deletion mutations includes a restriction endonuclease MseI with a cleavage site sequence of 5'-TTAA-3', and sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2 shown in RPA primer E19-F / R, RPA reagent; the reporter system for E19 deletion mutation includes sequences such as crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, crRNA-E19-L747_T751, Cas12a protein, and a single-stranded reporter DNA with a sequence of 5'-FAM-TTATT-biotin-3', respectively, as shown in SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8. It should be noted that in the preferred detection system of the present invention, the restriction endonuclease (MscI / MseI), RPA primer (SEQ ID NO. 1~2 / SEQ ID NO. 3~4), and crRNA (SEQ ID NO. 5 / SEQ ID NO. 6~8) for designing and screening respectively for L858R mutation and E19 deletion mutation require creative work. First, the present invention needs to design corresponding RPA primers for different mutations on different genes while considering the restriction endonuclease cleavage sites. When designing RPA primers, it is necessary to consider that the restriction endonuclease effectively cuts the wild-type sequence while also avoiding the influence of the mutation site on the restriction site. In addition, the effects of the different crRNA sequences designed on the trans-cleavage reaction also vary greatly, especially the three crRNA sequences of crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, and crRNA-E19-L747_T751 are mixed to cover 75%~80% of the E19 deletion mutations, and the detection of 1% or even 0.5% mutation frequency can still be achieved under the CRISPR lateral chromatography detection report mode, resulting in unexpected effects.In summary, obtaining the crRNA with good specificity, sensitivity, and compatibility shown in SEQ ID NO. 5 / SEQ ID NO. 6~8 of the present application and combining it with the RPA primers of SEQ ID NO. 1~2 / SEQ ID NO. 3~4 with good amplification efficiency, and then obtaining the detection system with good sensitivity and specificity claimed in the present invention cannot be obtained solely through logical analysis, reasoning or limited experiments based on the existing technology.

[0033] The present invention also provides an EGFR gene mutation detection product, comprising the detection system.

[0034] Preferably, the EGFR gene mutation detection product also includes a CRISPR lateral flow detection test strip.

[0035] The present invention also provides an in vitro non-diagnostic method for detecting EGFR gene mutations based on CRISPR / Cas12a using the detection product, comprising the following steps:

[0036] obtaining nucleic acid from a sample;

[0037] The obtained nucleic acid, a restriction endonuclease targeting the wild-type sequence of the EGFR mutation site, an RPA primer targeting the EGFR mutation site, and an RPA reagent are mixed to form an RPA reaction system, and an RPA reaction accompanied by the restriction endonuclease is performed to obtain an RPA reaction product; wherein, in the RPA reaction system, when the amount of nucleic acid used is 40 ng, the amount of the restriction endonuclease targeting the wild-type sequence of the EGFR mutation site used is not less than 10 U;

[0038] Mix crRNA targeting the EGFR mutation site with Cas protein to form an incubation system targeting the EGFR mutation site and incubate at 37-40°C for 15-30 minutes;

[0039] The RPA reaction product, single-stranded reporter DNA, and an incubation system targeting the EGFR mutation site were mixed to form a trans-cleavage reaction system, which was incubated at 37-40°C for 20-30 minutes to obtain the cleavage product.

[0040] The cleavage products are then detected by fluorescence or CRISPR lateral flow assays based on the single-stranded reporter DNA.

[0041] Preferably, the sample is selected from at least one of blood, tissue, blood cells, bone marrow, ascites, fine needle biopsy samples, body fluids containing cells, free floating nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, skin swab, oral swab, nasal swab or lavage; and the tissue sample is selected from fresh tissue and / or paraffin-embedded tissue.

[0042] Preferably, when the sample is paraffin-embedded tissue, the method for obtaining nucleic acid from the sample includes: dewaxing the paraffin-embedded tissue sections using a dewaxing solution, washing the dewaxed product using a washing solution, adding a nucleic acid release agent after drying, and obtaining nucleic acid after incubation.

[0043] Preferably, when the sample is fresh tissue, the method for obtaining nucleic acid from the sample comprises: adding a nucleic acid releasing agent to the broken fresh tissue, and obtaining nucleic acid after incubation.

[0044] Preferably, in the RPA reaction system, the concentration of the RPA primers targeting the EGFR mutation site is 300-500 nM.

[0045] Preferably, for detecting the EGFR mutation site L858R, a 50 μL RPA reaction system includes: 20 μL RPA reagent, 2.5 μL 10 μM L858R-F, 2.5 μL 10 μM L858R-R, 2 μL 5 U / μL MscI, 2 μL nucleic acid, 2 μL activator, and 19 μL ddH2O. Perform the RPA reaction with restriction endonucleases to obtain the L858R-RPA reaction product. The activator should be added immediately after all other components have been added to the PCR tube and mixed thoroughly.

[0046] Preferably, when detecting deletion mutations at the EGFR mutation site E19, a 50 μL RPA reaction system includes: 20 μL RPA reagent, 2.5 μL 10 μM E19-F, 2.5 μL 10 μM E19-R, 1 μL 10 U / μL MseI, 2 μL nucleic acid, 2 μL activator, and 20 μL ddH2O. Perform the RPA reaction with restriction endonucleases to obtain the E19-RPA reaction product. The activator should be added immediately after all other components have been added to the PCR tube and mixed thoroughly.

[0047] Preferably, the RPA reaction with restriction endonuclease is carried out at 37-40° C. for 30-40 min, and then the reaction is terminated according to the requirements of the RPA reagent.

[0048] Preferably, the incubation step is performed simultaneously with the RPA reaction accompanied by restriction endonucleases.

[0049] Preferably, when detecting the EGFR mutation site L858R, the 3 μL incubation system includes: 0.6 μL LbCas12a protein, 0.6 μL 10 μM crRNA-L858R. Incubation obtains the Cas12a / crRNA-L858R complex incubation system.

[0050] Preferably, when detecting the EGFR mutation site E19 deletion mutation, the 4.5 μL incubation system includes: 0.9 μL LbCas12a protein, 0.4 μL 10 μM crRNA-E19-E746_A750, 0.4 μL 10 μM crRNA-E19-L747_P753>S, and 0.4 μL 10 μM crRNA-E19-L747_T751. Incubation obtains the Cas12a / crRNA-E19 complex incubation system.

[0051] Preferably, when detecting the EGFR mutation site L858R, the 20 μL trans-cleavage reaction system includes: 3 μL Cas12a / crRNA-L858R complex incubation system, 2 μL Cas12areaction buffer, 1 μL LFA ssDNA reporter, and 5 μL L858R-RPA reaction product.

[0052] Preferably, when detecting the E19 deletion mutation at the EGFR mutation site, the 20 μL trans-cleavage reaction system includes: 4.5 μL Cas12a / crRNA-E19 complex incubation system, 2 μL Cas12areaction buffer, 1 μL LFAssDNA reporter, and 5 μL E19-RPA reaction product. When detecting the E19 deletion mutation, the Cas12a / crRNA-E19 complex incubation system contains three crRNAs: crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, and crRNA-E19-L747_T751. Therefore, it is necessary to specifically adjust the trans-cleavage reaction system for the F19 deletion mutation to achieve a better trans-cleavage effect, so that the CRISPR lateral flow assay can detect a mutation frequency of 1% or even 0.5%.

[0053] Preferably, when using a single-stranded reporter DNA labeled with a CRISPR lateral flow assay reporter molecule, the cleavage product is subjected to CRISPR lateral flow assay using a CRISPR lateral flow assay strip, and the lower limit of detection for the mutation frequency is 0.5% to 1%. If a positive band appears on the test line on the test strip, it indicates that the test sample has the corresponding EGFR mutation site; if no positive band appears on the test line on the test strip, it indicates that the test sample does not have the corresponding EGFR mutation site.

[0054] After testing sample nucleic acids using the detection system and detection method provided by the present invention, a mutation frequency of 1% was detected for both the L858R mutation and the E19 deletion mutation, and there is potential to further reduce the detection limit to 0.5%, with the entire process controlled within 2 hours.

[0055] Preferably, when using single-stranded reporter DNA labeled with a fluorescent reporter molecule, fluorescence detection of the cleavage product is performed using a fluorescence detection device. The fluorescence detection device can be any fluorescence detection device capable of fluorescence excitation and detection in a corresponding fluorescence channel, or can be used for naked eye visualization by irradiation with blue light.

[0056] Beneficial Effects of the Invention: The present invention first studied the restriction endonuclease reaction buffer and endonuclease dosage for the isothermal amplification system, identifying an isothermal amplification reaction involving a recombinase polymerase and restriction endonuclease. This reaction, combined with the targeted crRNA in the CRISPR / Cas12a assay, effectively reduced assay specificity. In terms of assay performance, the present invention achieved detection of a 1% mutation frequency in the EGFR gene with a 20 ng standard sample input, and has the potential to further reduce the detection limit to 0.5%. Further experiments verified that the isothermal amplification step can mitigate the effects of inhibitory substances in the rapid extraction product of paraffin samples. The results of rapid extraction of paraffin samples were consistent with those obtained using standard kits and commercial samples. Finally, the present invention developed a CRISPR / Cas12a-based system and method for rapid extraction and detection of EGFR gene mutations in tissues. This method can be used for testing both fresh tissue and paraffin samples. The entire process is controlled within 2 hours, requiring only a small incubation instrument, enabling rapid and convenient detection of gene mutations with a low detection limit. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 The results of the 4150 analysis amplification and enzyme digestion fragments in Example 1 of the present invention are shown.

[0058] Figure 2 This is an optimization test of the complex incubation system in Example 2 of the present invention; A is a design diagram of multiple crRNAs for E19 deletion mutations, and B is the color development of the test strips at different incubation times.

[0059] Figure 3 The results of the 4150 analysis amplification and enzyme digestion fragments in Example 3 of the present invention are shown.

[0060] Figure 4 This is the color development of the test strip in Example 3 of the present invention.

[0061] Figure 5 This is the color development of the test strip in Example 4 of the present invention.

[0062] Figure 6 This is the color development of the test strip in Example 5 of the present invention. DETAILED DESCRIPTION

[0063] The following describes the embodiments of the present invention by specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. The various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the case of no conflict, the features in the following examples and embodiments can be combined with each other. In the embodiments of the present invention, unless otherwise specified, the methods used are all conventional methods, and the reagents used can be obtained from commercial sources.

[0064] The embodiments of the present invention provide RPA primers and crRNAs for L858R and E19 deletion mutations, respectively, as shown in Tables 1 and 2.

[0065] Table 1. RPA primers L858R-F / R and E19-F / R sequences

[0066] Primer name Sequence (5'→3') SEQ ID NO. L858R-F CGTACTGGTGAAAACACCGCAGCATGTCAAG SEQ ID NO. 3 L858R-R CACCTCCTTACTTTGCCTCCTTCTGCATGG SEQ ID NO. 4 E19-F <![CDATA[CAGAAGGTGAGAAAG TT C A AATTCCCGTCGCT]]> SEQ ID NO. 1 E19-R TGAGGTTCAGAGCCATGGACCCCCACACAGCA SEQ ID NO. 2

[0067] In Table 1, the underlined italic part indicates that the primer introduces a mismatched base at that position, destroying the corresponding restriction endonuclease site.

[0068] Table 2. crRNA-L858R and crRNA-E19 sequences

[0069] sequence name Sequence (5'→3') SEQ ID NO. crRNA-L858R UAAUUUCUACUAAGUGUAGAUGGCGGGCCAAACUGCUGGGUG SEQ ID NO. 5 crRNA-E19-E746_A750 UAAUUUCUACUAAGUGUAGAUGGAGAUGUUUUGAUAGCGACGGG SEQ ID NO. 6 crRNA-E19-L747_P753>S UAAUUUCUACUAAGUGUAGAUGAUUCCUUGAUAGCGACGGGAAU SEQ ID NO. 7 crRNA-E19-L747_T751 UAAUUUCUACUAAGUGUAGAUGGAGAUUCCUUGAUAGCGACGGG SEQ ID NO. 8

[0070] Example 1: Testing of a recombinase polymerase isothermal amplification system accompanied by restriction endonuclease digestion

[0071] 1. Experimental setup: A genomic gDNA standard containing 5% EGFR exon 19 p.E746_A750del[1] mutation was prepared. Based on the recombinase polymerase isothermal amplification reaction system as shown in Table 3 below, the endonuclease MseI (NEB, R0525) and the corresponding restriction endonuclease buffer were added to test the effect of the endonuclease buffer on amplification and restriction endonuclease digestion during isothermal amplification.

[0072] Table 3. RPA reaction system

[0073] Experiment number Sample type DNA dosage (ng) Endonuclease and corresponding buffer addition E19-F / R dosage (μL) RPA reagent (μL) 1 EGFR mutation samples 20 / 2.5 20 2 EGFR mutation samples 20 MseI 1 μL 2.5 20 3 EGFR mutation samples 20 5μL buffer 2.5 20 4 EGFR mutation samples 20 MseI 1μL + buffer 5μL 2.5 20 5 <![CDATA[Blank control (ddH2O)]]> / / 2.5 20

[0074] After adding water to 48 μL, 2 μL of activator was quickly added to each PCR tube and mixed. The PCR tubes were incubated at 37°C for 30 min and then incubated at 56°C for 5 min to terminate the amplification reaction.

[0075] 2. Result detection: 30 μL of each RPA reaction product was taken and purified using 1.6X (48 μL) magnetic beads. The concentration of the purified amplified product was detected by Qubit, and the distribution of amplified and enzyme-digested fragments was detected using 4150. The results are shown in Table 4 and Figure 1 In the 4150 analysis results, the EL1 band represents the electronic marker, and A1-E1 correspond to samples with experimental numbers 1-5, respectively.

[0076] Table 4. Concentration results of purified products detected by Qubit assay

[0077] Experiment number Concentration of purified product (ng / μL) 1 19 2 8.18 3 16 4 12.1 5 6.3

[0078] 3. Analysis of Results: Comparing the results of Experiments 1 and 2, the sample was significantly digested by the enzyme. The undigested fragments may contain wild-type sequences in addition to the mutant sequence, indicating complete digestion. Comparing the results of Experiments 1 and 3, while the difference in product concentration was small, the fragments in Sample 3 showed significantly fewer target fragments and a small number of diffuse bands. Combined with the results of Experiment 4, the concentration was significantly higher than that in Sample 3, without the appearance of target mutations or restriction enzyme sequence bands. Therefore, in the isothermal amplification reaction system of recombinase polymerase accompanied by restriction enzyme digestion, the addition of an endonuclease buffer is sufficient; the endonuclease works well. However, the addition of a buffer may inhibit amplification to some extent, leading to abnormal experimental results.

[0079] Example 2: crRNA design, mixing and Cas12a / crRNA complex incubation system optimization test

[0080] 1. Design of multiple crRNAs for E19 deletion mutations: E19 deletions include multiple subtypes, and the target sequences of the corresponding subtypes are different. Therefore, it is impossible to use a single crRNA to cover the detection of all E19 deletion samples. This example analyzes and demonstrates the target sequence structures of the four subtypes that account for the largest proportion of E19 deletions (see Figure 2In Figure A, delE746_A750[1] and delE746_A750[2], which have the highest proportion, differ only by a single base, while delL747_T751 and delL747_P753>S have relatively large differences. The crRNA design requires a 20-nt constant region and a 20-24-nt specific binding region. The present invention designed the E19 deletion specific binding region to be longer, 23 nt, to improve binding stability. Therefore, when delE746_A750[1] and delE746_A750[2] are designed as the same crRNA based on delE746_A750[1], the crRNA can degenerately recognize and bind to the delE746_A750[2] sequence. Furthermore, the strong crRNA binding stability also provides a basis for reducing the amount of each crRNA used and for mixing multiple crRNAs during detection. The crRNAs for delL747_T751 and delL747_P753>S were designed using the corresponding target sequences. The crRNA combination designed by the present invention can cover 75-80% of E19 deletion samples in a single reaction.

[0081] 2. L858R mutant crRNA design: Since the L858R mutant targeting sequence differs only by a single base from the wild type, the present invention designs the crRNA length to 21 nt to reduce binding stability, avoid nonspecific recognition, and bind to wild-type sequences with smaller sequence differences. At this time, the amount of crRNA used is appropriately increased to ensure high sensitivity recognition of the mutant sequence.

[0082] 3. Optimization test of Cas12a / crRNA complex incubation system: The present invention adopts the test strip method to detect, and the reaction signal required for the color development of this method is stronger, which ensures the specificity of the detection, but at the same time has higher requirements for the recognition and shearing efficiency of the Cas12a / crRNA complex. The present invention adopts the method of incubating the Cas12a / crRNA complex in advance, preparing the corresponding incubation system, and screening the appropriate incubation time to improve the complex recognition and shearing efficiency and enhance the reaction signal. When the Cas12a / crRNA complex is incubated, the Cas12a protein concentration can be 2 μM, and the crRNA dosage is 1-1.5 times that of the Cas12a protein. Combined with different crRNA design lengths and detection site characteristics, the Cas12a / crRNA complex incubation systems of L858R and E19 are finally obtained in Tables 7 and 12.

[0083] 3.1. Experimental setup: Taking the E19 deletion detection system as an example, three incubation time gradients were set, namely 0 min, 15 min and 30 min, to test the positive detection of the weak positive standard sample of delE746_A750[1] with a mutation frequency diluted to 2.5% on the test strip. The samples were repeated three times.

[0084] 3.2 Sample Preparation: Perform RPA amplification of the sample using the system in No. 2 in Table 3. Add 2 μL of activator, mix thoroughly, and incubate at 37°C for 30 minutes, followed by incubation at 56°C for 5 minutes to terminate the amplification reaction. A single sample amplification is sufficient for subsequent testing.

[0085] 3.3. Group detection of amplification products: Prepare the same 9-tube E19-Cas12a / crRNA complex incubation system according to Table 12, and divide it into 3 groups of experiments with 3 tubes in each group. The three groups of experiments were incubated for 0 min (proceed to the next step immediately after the preparation), 15 min and 30 min, and the amplification products of the weak positive standard were subjected to trans-cleavage experiments according to the system in Table 13.

[0086] 3.4. CRISPR lateral flow test strip test: Add 30 μL ddH2O to the Cas12a trans-cleavage product to ensure that the test strip has sufficient sample liquid absorption, insert the test strip sample pad into the liquid surface, and place it at room temperature for 5-10 minutes. The color of the test strip will be as follows: Figure 2 Middle B.

[0087] 3.5. Analysis of results: By incubating the Cas12a / crRNA complex structure in advance, the trans-cleavage efficiency can be effectively improved. For the RPA amplification product of the weak positive sample, when the complex is incubated for 15 min, the signal generated by trans-cleavage can only excite a weaker test strip color development signal; when the incubation time is extended to 30 min, the signal generated by trans-cleavage can stably excite a sufficiently obvious test strip positive band result. Therefore, the present invention can improve the recognition of the target sequence by the Cas12a protein and the trans-cleavage efficiency of the ssDNA reporter by incubating the Cas12a / crRNA complex structure in advance at 37 ° C for 15 to 30 min, thereby ensuring the color development signal of the weak positive sample in the test strip detection.

[0088] Example 3: Restriction endonuclease dosage optimization test

[0089] 1. Experimental Setup: Because L858R is a point mutation, incomplete digestion of the wild-type fragment can easily lead to false-positive results. Therefore, an excess of 40 ng of wild-type gDNA was used for L858R site amplification. The product amplification and digestion performance, as well as the corresponding crRNA-L858R detection results, were tested when different amounts of endonuclease were added during the amplification step as shown in Table 5.

[0090] Table 5. RPA reaction system

[0091] Experiment number Sample type DNA dosage (ng) MscI endonuclease dosage (U) L858R-F / R dosage (μL) RPA reagent (μL) 1 Wild-type samples 40 / 2.5 20 2 Wild-type samples 40 5 2.5 20 3 Wild-type samples 40 7.5 2.5 20 4 Wild-type samples 40 10 2.5 20

[0092] After adding water to 48 μL, 2 μL of activator was quickly added to each PCR tube and mixed. The PCR tubes were incubated at 37°C for 30 min and then incubated at 56°C for 5 min to terminate the amplification reaction.

[0093] 2. Amplification product detection: 30 μL of L858R-RPA reaction product was taken and purified using 1.6X (48 μL) magnetic beads. The concentration of the purified amplification product was detected by Qubit, and the distribution of amplified and enzyme-digested fragments was detected using 4150. The results are shown in Table 6 and Figure 3 In the 4150 analysis results, the EL1 band represents the electronic marker, and A1-D1 correspond to samples with experimental numbers 1-4, respectively.

[0094] Table 6. Qubit assay results for purified product concentration

[0095] Experiment number Concentration of purified product (ng / μL) 1 34.0 2 25.0 3 17.9 4 8.9

[0096] 3. CRISPR / Cas12a combined test strips to detect the amplification product additivity test results:

[0097] a) Prepare the Cas12a / crRNA complex incubation system according to Table 7 and mix by pipetting. The reaction conditions are: 37°C for 30 min.

[0098] Table 7. Cas12a / crRNA-L858R complex incubation system

[0099] Components Dosage (μL) LbCas12a 0.6 crRNA-L858R (10 μM) 0.6 <![CDATA[ddH2O]]> 1.8

[0100] b) Prepare the L858R-Cas12a trans-cleavage reaction system according to Table 8 and pipette to mix thoroughly. The reaction conditions are: 40°C for 20-30 min.

[0101] Table 8. L858R trans-cleavage reaction system

[0102] Components Dosage (μL) Cas12a / crRNA-L858R complex incubation system 3 Cas12a reaction buffer 2 LFA ssDNA reporter 1 L858R-RPA reaction products 5 <![CDATA[ddH2O]]> 9

[0103] c) CRISPR lateral flow test strips (TOLOBIO, 31203): Add 20-30 μL of ddH2O to the Cas12a trans-cleavage product to ensure that the test strip has sufficient sample liquid absorption. Insert the sample pad of the test strip into the liquid surface as required. After standing at room temperature for 5-10 minutes, the color of the test strip will be as follows: Figure 4 .

[0104] 4. Analysis of Results: During 1.6X magnetic bead purification, digestion product fragments smaller than 75 bp were not recovered, indicating that the purified product primarily consisted of wild-type fragments that were not fully digested. Analysis of the purified amplification product concentration and fragment size indicated that as the amount of endonuclease increased, the amount of remaining wild-type fragments decreased. At 10 U of endonuclease, the wild-type band was faint. In combination with the crRNA sequence, which is specifically recognized by CRISPR / Cas12a, the remaining undigested wild-type fragments did not cause nonspecific positive detection signals. In summary, at a 10 U endonuclease dosage, combined with the targeted crRNA sequence, the specificity of the detection results can be guaranteed with an appropriate amount of DNA input.

[0105] Example 4: Detection limit test of standard samples

[0106] 1. Experimental setup: Standard samples (samples 1-6) with mutation frequencies of 5%, 1%, and 0.5% for EGFR gene L858R and E746_A750del[1] and the corresponding wild-type sample (sample 7) were collected. The DNA sample concentration was 10 ng / μL. The detection was performed according to the process of the present invention. The lower limit of detection of the mutation frequency of the target site was preliminarily evaluated. The sample information is shown in Table 9 below.

[0107] Table 9. Standard sample information

[0108] Sample name mutation site Mutation frequency (%) Sample 1 L858R 5 Sample 2 L858R 1 Sample 3 L858R 0.5 Sample 4 E746_A750del[1] 5 Sample 5 E746_A750del[1] 1 Sample 6 E746_A750del[1] 0.5 Sample 7 / /

[0109] 2. RPA reaction with restriction endonucleases: Using the Genentech Basic Isothermal Amplification Reagent (KS101), amplification was performed at the L858R site for Samples 1, 2, 3, and 7, and at the E19 site for Samples 4, 5, 6, and 7. The endonucleases used were MscI (NEB, R0534) and MseI (NEB, R0525), respectively. The sample systems were prepared as shown in Tables 10 and 11. The activator was added immediately after all other components were added to the PCR tube and mixed thoroughly. The tubes were incubated at 37°C for 30 minutes, followed by incubation at 56°C for 5 minutes to terminate the amplification reaction.

[0110] Table 10. L858R mutation RPA reaction system

[0111] Components Volume (μL) RPA reagent 20 L858R-F (10 μM) 2.5 L858R-R (10μM) 2.5 MscI (5U / μL) 2 DNA samples 2 <![CDATA[ddH2O]]> 19 Activator 2

[0112] Table 11. E19 deletion mutation RPA reaction system

[0113] Components Volume (μL) RPA reagent 20 E19-F (10 μM) 2.5 E19-R (10 μM) 2.5 MseI (10 U / μL) 1 DNA samples 2 ddH2O 20 Activator 2

[0114] 3. CRISPR / Cas12a combined with test strips to detect mutation sites:

[0115] 1) Sample 1, sample 2, sample 3, and sample 7 were prepared with a Cas12a / crRNA-L858R complex incubation system, and sample 4, sample 5, sample 6, and sample 7 were prepared with a Cas12a / crRNA-E19 complex incubation system. Xianda gene Cas12a protein and buffer reaction reagent (EM124) were selected to prepare Table 7 and Table 12. The reaction conditions are: incubation at 37 ° C for 30 minutes. This step can be performed simultaneously during the RPA amplification reaction.

[0116] Table 12. Cas12a / crRNA-E19 complex incubation system

[0117] Components Dosage (μL) LbCas12a 0.9 crRNA-E19-E746_A750[1][2](10 μM) 0.4 crRNA-E19-L747_P753>S (10 μM) 0.4 crRNA-E19-L747_T751 (10 μM) 0.4 <![CDATA[ddH2O]]> 2.4

[0118] 2) Prepare the Cas12a trans-cleavage experiment reaction system for the sample according to Tables 8 and 13 and mix by pipetting. The reaction conditions are: incubation at 40°C for 20 min.

[0119] Table 13. E19 trans-cleavage reaction system

[0120] Components Dosage (μL) Cas12a / crRNA-E19 complex incubation system 3 Cas12a reaction buffer 2 LFA ssDNA reporter 1 E19-RPA reaction products 5 <![CDATA[ddH2O]]> 9

[0121] 3) CRISPR lateral flow test strip test: Add 30 μL ddH2O to the Cas12a trans-cleavage product to ensure that the test strip has sufficient sample liquid absorption, insert the test strip sample pad into the liquid surface, and place it at room temperature for 5-10 minutes. The color of the test strip will be as follows: Figure 5 .

[0122] 4) Analysis of results: The results of the test strips for the EGFR gene L858R and E19 deletion standard samples showed that obvious positive bands (detection line position) were observed in the detection of samples with 5% and 1% mutation frequencies, while only quality control line bands appeared in the wild-type standard. For the 0.5% frequency sample, the positive band was relatively weak. Therefore, it is believed that the lower limit of mutation detection of the present invention is 0.5%~1% at a sample dosage of 20ng, and the detection results for positive samples with lower frequencies may not be obvious enough.

[0123] Example 5: Rapid extraction and testing of paraffin samples from patients tested for EGFR mutations

[0124] 1. Sample preparation: Six patient samples obtained from Hangzhou Ruipu Medical Laboratory, which had been commercially tested (using a complete pre-test kit for paraffin sample extraction), were used for the validation experiment of the present invention. These samples included four EGFR mutation-positive samples and two EGFR mutation-negative samples. The sample mutation information can be found in Table 14 below.

[0125] Table 14. Sample mutation information

[0126] Sample name Sample type Mutation and frequency Slice thickness Number of slices Sample 1 L858R positive L858R 16.70% 10 μM 5 Sample 2 L858R positive L858R 3.49% 10 μM 8 Sample 3 E19-del positive p.E746_A750del[2] 4.22% T790M 3.35% 10 μM 7 Sample 4 E19-del positive p.L747_T753>S 16.84% 10 μM 7 Sample 5 L858R and E19-del negative p.G719A 1.9% 10 μM 6 Sample 6 L858R and E19-del negative / 10 μM 6

[0127] 2. Sample rapid extraction experiment:

[0128] 1) Transfer the slice sample to a 1.5 mL centrifuge tube, add 1 mL of deparaffinization solution (Beijing Jiuzhou Berlin Biotechnology, BLB-01), and incubate at 56°C for 3 min.

[0129] 2) After incubation, centrifuge at 12,000 g for 2 min and discard the supernatant.

[0130] 3) Add 1 mL of anhydrous ethanol, centrifuge at 12,000 g for 2 min, discard the supernatant, and repeat this step twice.

[0131] 4) After opening the lid and letting it stand for 5 minutes to dry, add 150 μL of nucleic acid release agent (Xinda Gene, NR201) and incubate at 95°C for 3-5 minutes. After incubation, the sample rapid extraction product, i.e., nucleic acid, is obtained for subsequent testing.

[0132] 3. RPA reaction with restriction endonucleases: Using the Genentech Basic Isothermal Amplification Reagent (KS101), amplification was performed at the L858R site for Samples 1, 2, 5, and 6, and at the E19 site for Samples 3, 4, 5, and 6. The endonucleases used were MscI (NEB, R0534) and MseI (NEB, R0525). The sample preparations are shown in Table 15. The activator was added immediately after all other components were added to the PCR tube and mixed thoroughly. The tubes were incubated at 37°C for 30 minutes, followed by incubation at 56°C for 5 minutes to terminate the amplification reaction.

[0133] Table 15. RPA reaction system for rapid sample extraction

[0134] L858R locus amplification E19 site amplification Components Volume (μL) Components Volume (μL) solvent 20 solvent 20 L858R-F (10 μM) 2.5 E19-F (10 μM) 2.5 L858R-R (10μM) 2.5 E19-R (10 μM) 2.5 MscI (5U / μL) 2 MseI (10 U / μL) 1 Rapid sample extraction products 3 Rapid sample extraction products 3 <![CDATA[ddH2O]]> 18 <![CDATA[ddH2O]]> 19 Activator 2 Activator 2

[0135] 4. CRISPR / Cas12a combined with test strips to detect mutation sites:

[0136] a) A Cas12a / crRNA-L858R complex incubation system was prepared for samples 1, 2, 5, and 6, and a Cas12a / crRNA-E19 complex incubation system was prepared for samples 3, 4, 5, and 6. Xianda Gene Cas12a protein and buffer reaction reagent (EM124) were used, and the preparation tables are shown in Tables 7 and 12. The reaction conditions are: incubation at 37°C for 30 minutes. This step can be performed simultaneously with the RPA amplification reaction.

[0137] b) Prepare the Cas12a trans-cleavage reaction system for the sample according to Table 16 below and pipette to mix. The reaction conditions are: incubate at 40°C for 20 minutes.

[0138] Table 16. Trans-cleavage reaction system for rapid sample extraction

[0139] L858R trans-cleavage reaction system E19 trans-cleavage reaction system Components Dosage (μL) Components Dosage (μL) Cas12a / crRNA-L858R complex incubation system 3 Cas12a / crRNA-E19 complex incubation system 4.8 10X Cas12a reaction buffer 2 10X Cas12a reaction buffer 2 LFA ssDNA reporter (10 μM) 1 LFA ssDNA reporter 1 L858R amplification product 5 E19 amplified products 5 <![CDATA[ddH2O]]> 9 <![CDATA[ddH2O]]> 7.2

[0140] c) CRISPR lateral flow test strip test: Add 30 μL of ddH2O to the Cas12a trans-cleavage product to ensure that the test strip has sufficient sample liquid absorption. Insert the sample pad of the test strip into the liquid surface and leave it at room temperature for 5-10 minutes. The color of the test strip will be as follows: Figure 6 .

[0141] 5. Analysis of Results: The test strip assay showed that samples 1, 2, 3, and 4 were all positive, while samples 5 and 6 were negative in both the L858R and E19 detection systems. These results were consistent with those of commercially available tests, demonstrating that the present invention is effective for rapid extraction and testing of paraffin-embedded tissue samples. Considering that extraction from paraffin-embedded tissue samples results in DNA degradation and the presence of high levels of inhibitory substances, resulting in poorer extraction efficiency than fresh tissue, these results also confirm the present invention's applicability to testing fresh tissue samples.

[0142] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection of the present invention.

Claims

1. A CRISPR / Cas12a-based EGFR gene mutation detection reagent, characterized in that: Including RPA system and reporting system; The RPA system includes a restriction endonuclease targeting the wild-type sequence of the EGFR mutation site, an RPA primer targeting the EGFR mutation site, and an RPA reagent; The reporter system includes crRNA, Cas protein, and single-stranded reporter DNA targeting the EGFR mutation site; wherein the single-stranded reporter DNA is labeled with a CRISPR lateral flow test strip reporter molecule; The EGFR mutation site includes E19 deletion mutation; the E19 deletion mutation includes E19-E746_A750[1][2], E19-L747_P753>S, E19-L747_T751; The restriction endonuclease cleavage site sequence for the E19 deletion mutant wild-type sequence is 5′-TTAA-3′; RPA primers targeting the E19 deletion mutation include E19-F and E19-R, whose sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; The sequence of crRNA-E19-E746_A750 targeting E19-E746_A750[1][2] is shown in SEQ ID NO. 6; The sequence of crRNA-E19-L747_P753>S targeting E19-L747_P753>S is shown in SEQ ID NO. 7; The sequence of crRNA-E19-L747_T751 targeting E19-L747_T751 is shown in SEQ ID NO.

8.

2. The detection reagent according to claim 1, wherein The EGFR mutation site also includes L858R.

3. The detection reagent according to claim 2, characterized in that Contains at least one of the following: (1) The restriction endonuclease cleavage site sequence for the L858R wild-type sequence is 5'-TGGCCA-3'; (2) The sequence of crRNA-L858R targeting L858R is shown in SEQ ID NO.

5.

4. The detection reagent according to claim 1, wherein Including RPA system for L858R, reporter system for L858R, RPA system for E19 deletion mutation, reporter system for E19 deletion mutation; The RPA system for L858R includes a restriction endonuclease with a cleavage site sequence of 5'-TGGCCA-3', RPA primers L858R-F / R with sequences as shown in SEQ ID NO. 3 and SEQ ID NO. 4, and RPA reagents; The reporter system for L858R includes crRNA-L858R, Cas12a protein, and a single-stranded reporter DNA with a sequence of 5'-FAM-TTATT-biotin-3' as shown in SEQ ID NO. 5; The RPA system for E19 deletion mutations includes a restriction endonuclease with a cleavage site sequence of 5'-TTAA-3', RPA primers E19-F / R with sequences as shown in SEQ ID NO. 1 and SEQ ID NO. 2, and RPA reagents; The reporter system for the E19 deletion mutation includes crRNA-E19-E746_A750, crRNA-E19-L747_P753>S, crRNA-E19-L747_T751, Cas12a protein, and a single-stranded reporter DNA with a sequence of 5'-FAM-TTATT-biotin-3', as shown in SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO.

5. The detection reagent according to claim 1, wherein Contains at least one of the following: (1) The sample detected by the detection reagent is selected from tissue; the tissue is selected from fresh tissue and / or paraffin-embedded tissue; (2) The detection reagent further includes a DNA extraction system, and the DNA extraction system includes a nucleic acid releasing agent; (3) The detection reagent also includes a DNA extraction system for paraffin-embedded tissue samples, and the DNA extraction system for paraffin-embedded tissue samples includes a dewaxing solution, a cleaning solution, and a nucleic acid release agent.

6. A product for detecting EGFR gene mutation, characterized in that: The method comprises the detection reagent according to any one of claims 1 to 5.

7. A method for detecting EGFR gene mutations based on CRISPR / Cas12a using the detection product of claim 6 for non-diagnostic in vitro purposes, characterized in that: The following steps are involved: obtaining nucleic acid from a sample; The obtained nucleic acid, a restriction endonuclease targeting the wild-type sequence of the EGFR mutation site, an RPA primer targeting the EGFR mutation site, and an RPA reagent are mixed to form an RPA reaction system, and an RPA reaction accompanied by the restriction endonuclease is performed to obtain an RPA reaction product; wherein, in the RPA reaction system, when the amount of nucleic acid used is 40 ng, the amount of the restriction endonuclease targeting the wild-type sequence of the EGFR mutation site used is not less than 10 U; Mix crRNA targeting the EGFR mutation site with Cas protein to form an incubation system targeting the EGFR mutation site and incubate at 37-40°C for 15-30 min; The obtained RPA reaction product, single-stranded reporter DNA, and an incubation system targeting the EGFR mutation site are mixed to form a trans-cleavage reaction system to obtain a cleavage product; CRISPR lateral flow detection of cleavage products based on single-stranded reporter DNA.

8. The method according to claim 7, wherein Contains at least one of the following: (1) The sample is selected from tissue; the tissue is selected from fresh tissue and / or paraffin-embedded tissue; (2) When the sample is paraffin-embedded tissue, the method for obtaining nucleic acid from the sample includes: dewaxing the paraffin-embedded tissue section using a dewaxing solution, washing the dewaxed product using a washing solution, adding a nucleic acid release agent after drying, and obtaining nucleic acid after incubation; (3) When the sample is fresh tissue, the method for obtaining nucleic acid from the sample includes: adding a nucleic acid releasing agent to the broken fresh tissue, and obtaining nucleic acid after incubation.

9. The method according to claim 7, wherein Contains at least one of the following: (1) When detecting the EGFR mutation site L858R, the 3 μL incubation system includes: 0.6 μL LbCas12a protein, 0.6 μL 10 μM crRNA-L858R; (2) When detecting the deletion mutation of EGFR mutation site E19, the 3 μL incubation system includes: 0.9 μL LbCas12a protein, 0.4 μL 10 μM crRNA-E19-E746_A750, 0.4 μL 10 μM crRNA-E19-L747_P753>S, and 0.4 μL 10 μM crRNA-E19-L747_T751.

10. The method according to claim 7, wherein: When a single-stranded reporter DNA labeled with a CRISPR lateral flow assay strip reporter molecule is used, the cleavage products are subjected to CRISPR lateral flow assay using the CRISPR lateral flow assay strip.

Citation Information

Patent Citations

  • Kit for multi-site joint detection of EGFR (epidermal growth factor receptor) gene

    CN118240940A

  • EGFR (epidermal growth factor receptor) gene mutation site detection kit

    CN102808027A

  • CRISPR (clustered regularly interspaced short palindromic repeats)-based gene mutation frequency digital quantitative detection method and application

    CN116162702A

  • CRISPR / Cas12a-based lung cancer patient peripheral blood EGFR gene mutation detection system and method

    CN116377036A

  • CRISPR (clustered regularly interspaced short palindromic repeats)-lateral flow nucleic acid detection test paper based on chain hybridization and detection probe thereof

    CN116656786A