SNP (Single Nucleotide Polymorphism) molecular marker related to egg laying time character of chicken and application

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a chicken egg laying time character and application, according to a method, egg laying time data is utilized, and the egg laying time character is subjected to whole genome association analysis (GWAS), so that a Cgt is found at the 5817488bp position on a chromosome 9 of a chicken reference genome Galusgallus.GRCg6a version; a nucleotide single base mutation is located in a PIK3CB gene, and the mutation significantly affects the laying time of chickens. Meanwhile, the invention discloses acquisition and application of the molecular marker. The invention further provides a molecular marker genetic typing detection method influencing the egg laying time of the chickens, an efficient and accurate molecular marker assisted breeding technology can be established by utilizing the method, and the molecular marker assisted breeding technology is applied to genetic improvement of the egg laying stability of the chickens, so that the egg laying performance and stress tolerance of the chickens are improved.

Description

Technical Field

[0001] The present invention relates to the field of molecular marker-assisted selection technology and animal genetic breeding technology, and in particular to a SNP molecular marker related to the egg-laying time trait of chickens and its application. Background Art

[0002] Eggs have low production costs and are rich in a variety of nutrients. They are one of the most common and cheap sources of protein for humans. However, in laying hen production, abnormal fluctuations in egg production and the short duration of the peak egg production are currently prominent problems. Therefore, if we select and breed chickens for egg-laying stability and improve their stress tolerance, the egg-laying performance of chickens will be greatly improved.

[0003] Studies have shown that the time interval between the egg-laying time of a chicken and the ovulation of the egg yolk is relatively stable, generally 23-25 ​​hours. The ovulation time of a chicken is affected by the production of the previous egg, light, hormone levels, physiological state, etc. Among them, the hormone level mainly refers to luteinizing hormone as a signal for ovulation. Its high concentration level generally appears 4-8 hours before ovulation and needs to be in a dark environment. Therefore, the ovulation time and egg-laying time of chickens under normal physiological conditions are both in the morning. Studies have shown that egg-laying time is significantly correlated with the egg-laying stability number and the number of eggs laid, that is, the earlier the average egg-laying time of a chicken, the closer it is to the state of stably laying one egg per day, and the more eggs it lays in the later period. At the same time, egg-laying time can be measured during the peak egg-laying period, which can be used as one of the early selection-related traits for the later egg-laying performance, accelerating the speed of breeding progress. In addition, the early and late egg-laying time is not only closely related to the egg-laying performance, but also the earlier and more uniform egg-laying time is more convenient for the management of the breeders and increases the benefits of the farm. Therefore, early egg-laying time can be one of the focuses of current egg-laying chicken breeding. Summary of the invention

[0004] In view of the above research background, by statistically analyzing the time of laying each egg during a period of time during the peak laying period of multiple laying hens, the phenotypic data of the laying time of a single individual can be obtained. By using high-throughput sequencing and GWAS (Genome-wide association study), SNPs related to the laying time trait of chickens can be selected quickly, efficiently and accurately. This fills the gap in the international GWAS research on the laying time trait, which is of great significance to my country's chicken breeding industry. The primary purpose of the present invention is to provide a SNP molecular marker for selecting the laying time trait of chickens. The present invention is based on a specialized maternal strain of high-yielding laying hens, and uses the method of whole genome association analysis to find SNP molecular markers related to the laying time trait of chickens, so as to serve as SNP molecular markers for marker-assisted selection of the laying time trait of chickens.

[0005] The second object of the present invention is to provide the SNP molecular markers for the above-mentioned chicken egg-laying time trait for use in chicken genetic breeding.

[0006] In order to find the SNP for the above purpose, the technical solution adopted by the present invention is: a SNP molecular marker related to the egg-laying time of chickens, the SNP molecular marker is selected from chr9_5817488, and the SNP molecular marker chr9_5817488 contains an amino acid sequence with a polymorphism of C / A at the 5817488bp position on chromosome 9 of the chicken reference genome Gallus_gallus.GRCg6a version.

[0007] The genotype of the polymorphic site contained in the SNP molecular marker chr9_5817488 is a CC genotype, indicating an advanced average egg-laying time.

[0008] The present invention also provides a primer set for amplifying the SNP molecular marker associated with the egg-laying time of chickens, wherein the primer set comprises an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

[0009] Upstream primer primer-F: TGATCTGCAAGGTCTTTTCCA (SEQ ID NO.01),

[0010] Downstream primer primer-R: TCTTGATGTGGTTGGGGTTC (SEQ ID NO.02).

[0011] A kit comprises the primer set.

[0012] The present invention also provides an application of the detection of molecular markers related to the egg-laying time trait of chickens in chicken genetic breeding, which is used for identifying chickens with different egg-laying times.

[0013] The present invention also provides a method for selecting a chicken strain with an early egg-laying time, comprising the following steps:

[0014] (1) obtaining the whole genome DNA of the chicken individual to be tested, and using it as a template, performing PCR amplification using the primer set described in claim 3 or the kit described in claim 4 to obtain a DNA fragment containing the chr9:5817488 site;

[0015] (2) Identify the genotype of the DNA fragment at the chr9:5817488 site. After Sanger sequencing, retain the individuals whose genotype of the polymorphic site contained in the SNP molecular marker chr9_5817488 of the chicken individual to be tested is CC, so as to increase the frequency of the allele C at the site, thereby advancing the average egg-laying time of the offspring chickens, thereby improving their egg-laying performance and stability. Eliminate the individuals whose genotype of the polymorphic site contained in the SNP molecular marker chr9_5817488 of the chicken individual to be tested is CA or AA.

[0016] Compared with the prior art, the invention has the following advantages and effects: the invention is the first in the world to study and determine the molecular markers related to the traits affecting the egg-laying time of chickens, verify their effects on the egg-laying time, and ultimately establish molecular assisted breeding technology, which is applied to the genetic improvement of the egg-laying performance and stability of chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Manhattan plot and QQ (Quantile-Quantile plot) plot of genome-wide association analysis of egg-laying time traits of the present invention;

[0018] Figure 2 This is a heat map of the LD within the PIK3CB gene, a candidate gene for the egg-laying time trait of the present invention;

[0019] Figure 3 The different genotypes of SNP proposed in the present invention have an impact on the phenotype of the specialized maternal strain of high-yielding laying hens;

[0020] Figure 4 It is a comparison of egg-laying time of two groups with different genotypes of SNP proposed by the present invention;

[0021] Figure 5 The distribution diagram of the SNP genotypes proposed in the present invention in different chicken populations in the public database;

[0022] Figure 6 This is a diagram of the Sanger sequencing results of different SNP genotypes proposed in the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. The reagents not described in detail separately in the present invention are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be known from the prior art. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0024] Example 1 Phenotypic Determination

[0025] A total of 507 hens of a specialized maternal strain of high-yield laying hens were raised. All the hens were of the same age and raised under the same conditions. The breeding location was the breeding farm of Hubei Shendi Agricultural Science and Technology Trade Co., Ltd. The laying time phenotypic data of each hen for each egg were collected from the peak of laying (week 26) for 30 days. Each laying time phenotypic data was converted into a numerical value, that is, the integer "hour" (24-hour system) of natural time remained unchanged, and the value of "minute" was converted into the decimal digit of "hour" through "per minute = one sixtieth of an hour". The average value of all laying time values ​​of each chicken within 30 days was calculated as its phenotypic data. The mean and dispersion of the phenotypic data were statistically analyzed, where the coefficient of variation was the ratio of the standard deviation to the mean. The descriptive statistical results of the laying time traits of 507 hens of the specialized maternal strain of high-yield laying hens are shown in Table 1.

[0026] Table 1 Phenotypic statistics of egg-laying time traits of specialized high-yielding egg-laying chicken lines

[0027]

[0028] Example 2 Sample Collection

[0029] Blood was collected from the 507 hens in Example 1, and genomic DNA was extracted from the blood samples and sent to Wuhan Yingzi Gene Technology Co., Ltd. for whole genome resequencing with a sequencing depth of 5×.

[0030] Example 3 GWAS of egg laying time traits

[0031] The hen whole genome resequencing data obtained in Example 2 were processed, and the processing flow included preliminary filtering, quality control, data filling, further quality control, and linkage disequilibrium (LD) trimming steps.

[0032] 1. The SNPs variant sites in the whole genome resequencing data (the data of Example 2) were detected by GATK v3.8, and low-quality variants were initially filtered out. The variant detection process followed the best practice process of GATK (https: / / software.broadinstitute.org / gatk / best-practices), and the SNPs variant sites used the following filtering criteria: QD<2.0||FS>60.0||MQ<40.0||MQRankSum<-12.5||ReadPosRankSum<-8.0;

[0033] 2. Data quality control: PLINK v1.9 was used to control the data and remove SNPs with a genotype missing rate greater than 5% (--geno 0.05).

[0034] 3. Data filling: After data quality control, missing SNPs were filled using Beagle software;

[0035] 4. Further quality control: PLINK v1.9 was used to perform further quality control on the filled SNPs. The control conditions included: removing SNPs with a minor allele frequency (MAF) less than 1% and removing SNPs that did not conform to Hardy-Weinberg equilibrium (HWE). The HWE test P value threshold was set to less than 1×10 -6 This means that if the observed genotype frequency of a SNP is significantly different from the expected genotype frequency calculated based on the allele frequency (P value is less than 0.000001), then this SNP site will be considered not to meet HWE and will be excluded from subsequent analysis (--maf 0.01--hwe 1e-6);

[0036] 5. Prune LD. Prune SNP sites with strong associations using PLINK v1.9. PLINK will calculate the r between all SNP pairs in each window according to the specified window size and step size. 2 Each window contains 50 SNPs, and the window moves 5 SNP steps each time. The difference between the combination frequency of any two SNPs in the window and the random combination frequency in the SNP population contained in the window is detected, and the r between any two SNPs in the window is guaranteed by deleting SNPs. 2 If the r between the two SNPs is greater than 0.2, 2If the p-value is greater than 0.2, it is considered that they have strong linkage disequilibrium (LD). The whole genome is tested repeatedly through the above process until all SNPs have been evaluated, which can reduce the multicollinearity problem caused by LD (--indep-pairwise 50 5 0.2). After all the above steps, 343,843 single nucleotide polymorphism (SNP) sites are finally retained for subsequent analysis;

[0037] 6. Based on the above 343843 single nucleotide polymorphism (SNP) sites, GCTA v1.94.1 was used to calculate the kinship matrix (--bfile genotype--make-grm--out grm), where --bfilegenotype specifies the genotype data file, --make-grm indicates that a kinship matrix is ​​to be created, and --outgrm specifies the prefix of the output file.

[0038] The single trait model in GCTA v1.94.1 (y = Xb + Wu + e, where y is the n × 1 phenotype vector (i.e., the egg-laying time of each sample), n is the sample size, X is the design matrix of fixed benefits, b is the vector of fixed effects, u is the vector of SNP effects, e is the vector of residual effects, and W is the standardized genotype matrix, i.e., the SNP loci of each sample) was used to estimate the heritability of the egg-laying time trait by calculating the heritability using the restricted maximum likelihood method (--grm grm--phenopheno.txt--reml--out h 2 ), --grmgrm is used to specify the kinship matrix file, --pheno pheno.txt is used to specify the phenotypic data file, --reml indicates the use of restricted maximum likelihood method for estimation, and --out h 2 The prefix of the specified output file is heritability. The result of heritability estimation will provide information on the proportion of phenotypic variance of egg laying time traits of different genotypes to the total phenotypic variance. Heritability and significance are shown in Table 2. In Table 2, the heritability of 0.46 means that the genetic effect can explain 46% of the phenotypic variance in Table 1, that is, when the phenotypic variance of a certain genotype is 0.71 2 , a heritability of more than 0.4 is considered high heritability, which confirms that egg-laying time has significant and high heritability, and subsequent GWAS can be conducted;

[0039] Table 2 Heritability of egg-laying time traits in specialized maternal strains of high-yielding laying hens

[0040]

[0041] 7. Based on the above 343843 single nucleotide polymorphism (SNP) sites and the values ​​described in Example 1 as phenotypic data, the linear mixed model (LMM, Linear Mixed Model, Y ilm =μ i +K l +G m +e ilm , where Y ilm is the phenotypic value, μ i is the average value, K l is the kinship matrix, G m is the effect of the SNP, e ilm The random residual was used, and the Wald test was used to determine the significance of the association). The individual kinship matrix (-bfile genotype-gk 2-ppheno.txt) was added to conduct a genomic association study on egg-laying time (GWAS, -bfile genotype-k output / result.sXX.txt-p pheno.txt-lmm1). The Bonferroni method was used to determine the genome-level significant threshold line of 0.05 / 343843 and the recommended threshold line of 1 / 343843, that is, in 343843 independent tests, when the significance level of each test was 0.05 / 343843, the false positive rate at the whole genome level was controlled within 0.05, thereby determining the SNP associated with the egg-laying time of chickens.

[0042] GWAS results show that ( Figure 1 A in the figure, two SNPs were located at 170867650bp on chromosome 1 and 5817488bp on chromosome 9. The QQ plot of GWAS shows ( Figure 1 B), which shows that there is no obvious outlier phenomenon in the results, indicating that there are no significant outliers or observations that deviate from the expected distribution in the GWAS results. The lambda value is the expansion factor between the actual observed P value distribution in the QQ plot and the expected uniform distribution, and the lambda value is within the ideal range, indicating that the P value distribution in the GWAS results has not been significantly expanded or compressed, indicating that the GWA results are credible. The specific information of the associated SNPs obtained by GWA is shown in Table 3.

[0043] Table 3 SNPs associated with egg-laying time in specialized maternal strains of high-yielding laying hens

[0044]

[0045] Of the two associated SNPs, the SNP on chromosome 9 is located inside a gene. This gene (PIK3CB) is mainly involved in intracellular signal transduction and regulates a variety of biological processes, including cell proliferation, survival, differentiation, and movement. Studies have shown that this gene plays a key role in metabolic balance and plays an important role in follicle proliferation and long-term memory formation. Its function may affect the egg-laying stability of laying hens. The P value of the SNP on chromosome 9 is lower than that of the SNP on chromosome 1, so the SNP on chromosome 9 was selected as the target molecular marker.

[0046] Results of linkage disequilibrium (LD) analysis of the PIK3CB gene located by the chr9_5817488 SNP ( Figure 2 ) showed that there were multiple highly linked blocks within the PIK3CB gene, and these blocks had a strong linkage relationship with chr9_5817488, including some missense mutations of the PIK3CB gene, further supporting the reliability of this SNP as a key gene molecular marker.

[0047] Example 4 Verification of Phenotypic Effects of Target Molecular Markers in Multiple Populations 1

[0048] First, the results of whole genome sequencing were used to classify the 507 high-producing egg-laying chickens of the specialized maternal strain in Example 1 according to the genotype of the egg-laying time SNP molecular marker chr9_5817488, and the egg-laying time of groups with different genotypes was counted. The results are shown in Table 4 and Figure 3 .

[0049] Table 4 Effects of different genotypes of SNP molecular markers for egg-laying time on the phenotypes of specialized maternal strains of high-yielding laying hens

[0050]

[0051] The results in Table 4 show that the average egg-laying time of individuals with the CC genotype of the SNP molecular marker chr9_5817488 is 1.28 hours earlier than that of individuals with the CA genotype. Figure 3 result.

[0052] Then, the egg-laying time of 1177 Jingmen black-feathered green-shelled laying hens with poor egg-laying performance at the same age was statistically analyzed using the same method (the method described in Example 1). The results showed that the average egg-laying time of the Jingmen black-feathered green-shelled laying hens was delayed by 1.1 hours compared with the specialized maternal strain of high-producing laying hens (Table 5, Table 1), and the difference was significant (P<0.001).

[0053] At the same time, through molecular detection of SNP markers related to egg-laying time in 1177 Jingmen black-feathered green-shell laying hens, it was found that the number of individuals with chr9_5817488 genotypes of CA and AA in the Jingmen black-feathered green-shell laying hens group was significantly higher than that in the high-yielding laying hens group ( Figure 4 B) in Figure 4 The A in further indicates that the average egg-laying time of 1177 Jingmen black-feathered green-shell laying hens is delayed compared with the specialized maternal strain of high-producing laying hens, so the CA and AA genotypes have a delayed effect on the average egg-laying time. Combined with the results shown in Table 4, only the CC genotype has the effect of advancing the egg-laying time, while the other two genotypes will delay the egg-laying time.

[0054] Table 5 Phenotypic statistics of egg-laying time of Jingmen black-feathered green-shell laying hens

[0055]

[0056] Example 5 Verification of Phenotypic Effects of Target Molecular Markers in Multiple Populations 2

[0057] The genome sequencing data of 1181 individual chickens with clear breed information were obtained from the NCBI database. The molecular marker chr9_5817488 of each individual was genotyped by comparing and genotyping the original sequencing files (fastq). Among them, the genotypes of 9 individuals were not detected. The remaining 1172 individuals were divided into five groups according to their breed sources: red jungle fowl, domestic local chickens, foreign local chickens, high-yield broilers, and high-yield laying hens. The genotypes of the molecular marker chr9_5817488 were counted separately. The results are shown in the figure. Figure 5 .

[0058] Figure 5 The results showed that the SNP molecular marker was highly polymorphic in the original breed of domestic chicken, the red junglefowl, with a large distribution of the three genotypes, and the CC genotype accounted for about half; the polymorphism of domestic local chickens (Yunyang chicken, Huaibei Ma chicken, Silky chicken, Tibetan chicken, etc.) and foreign local chickens (Japanese bantam chicken, Brahman chicken, Guifei chicken, Alacana chicken, etc.) was second, with the CC genotype accounting for about three-quarters; the CC genotype accounted for nearly 90% in high-yield broilers (Cornish chicken, White Rock chicken, Cobb commercial broiler chicken, etc.), and reached more than 95% in high-yield laying hens (Leghorn chicken, Rock Island Red chicken, New Hampshire chicken, etc.). Therefore, the frequency of the CC genotype has gradually increased with people's selection of egg-laying performance. In the future genetic breeding work to improve the egg-laying performance and stress tolerance of laying hens, the frequency of the CC genotype can be further increased through molecular breeding, especially for the breeding of local laying hens with relatively more CA and AA genotypes.

[0059] Example 6 Detection and Verification of Molecular Markers

[0060] 1) Design primers for the SNP molecular marker chr9_5817488. The designed primer DNA sequences are as follows:

[0061] Upstream primer primer-F: TGATCTGCAAGGTCTTTTCCA (SEQ ID NO.01), downstream primer primer-R: TCTTGATGTGGTTGGGGTTC (SEQ ID NO.02).

[0062] 2) PCR amplification

[0063] PCR amplification was performed using primers primer-F and primer-R, with the whole genomic DNA of the chicken to be tested as a template. The PCR reaction system was: 40ul reaction system, including 4.0ul DNA template, 12ul double distilled water, 20ul MasterMix, 2ul upstream primer, and 2ul downstream primer. The PCR reaction conditions were 95℃ pre-denaturation for 5min; 94℃ denaturation for 15s, 68℃ annealing for 15s, 72℃ extension for 30s, and 14 cycles, with the annealing temperature reduced by 1℃ each cycle; 94℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 30s, and 25 cycles; 72℃ final extension for 5min.

[0064] 3) DNA sequence determination

[0065] Finally, the product after PCR amplification was sequenced. The sequence determination was completed by Qingke Company. The gene fragment sequencing required reverse sequencing using primer-R primers. The sequencing results were as follows Figure 6 As shown, Figure 6 A in is CC type, Figure 6 The B in is CA type, Figure 6 The C in is AA type.

[0066] The present invention provides a method for identifying a SNP molecular marker related to the egg-laying time trait of a chicken, identifies a SNP molecular marker related to the egg-laying time trait of a chicken, and provides a molecular detection method for the marker. In the genetic breeding of chickens, individuals with the CC genotype at the site are selected and retained through molecular detection, and individuals with the CA and AA genotypes are eliminated to increase the frequency of the allele C at the site, thereby advancing the average egg-laying time of the offspring chickens, effectively advancing the egg-laying time and egg-laying stability of the chickens, and improving the egg-laying performance and stress tolerance of the chickens.

[0067] Based on the above results, the identification method, mutation site and detection method of the present invention can be used as potential genetic markers for improving egg-laying performance and stress tolerance of chickens in the field of genetic breeding.

[0068] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with egg-laying time in chickens, characterized in that: The SNP molecular marker is selected from chr9_5817488, and the SNP molecular marker chr9_5817488 contains an amino acid sequence with a polymorphism of C / A at the 5817488 bp position on chromosome 9 of the chicken reference genome Gallus_gallus.GRCg6a version.

2. The SNP molecular marker according to claim 1, characterized in that: The genotype of the polymorphic site contained in the SNP molecular marker chr9_5817488 is a CC genotype, indicating an advanced average egg-laying time.

3. A primer set for amplifying the SNP molecular marker associated with chicken egg-laying time according to claim 1 or 2, characterized in that: The primer set includes an upstream primer as shown in SEQ ID NO.01 and a downstream primer as shown in SEQ ID NO.

02.

4. A kit, characterized in that: Comprising the primer set described in claim 3.

5. Use of the SNP molecular marker according to claims 1-2, the primer set according to claim 3 or the kit according to claim 4 in chicken breeding: identifying chickens with different egg-laying times.

6. A method for selecting a chicken strain with early egg-laying time, characterized in that: The following steps are involved: (1) obtaining the whole genome DNA of the chicken individual to be tested, and using it as a template, performing PCR amplification using the primer set described in claim 3 or the kit described in claim 4 to obtain a DNA fragment containing the chr9:5817488 site; (2) Identify the genotype of the DNA fragment at the chr9:5817488 site. After Sanger sequencing, retain the individuals whose genotype of the polymorphic site contained in the SNP molecular marker chr9_5817488 of the chicken individual to be tested is CC, and eliminate the individuals whose genotype of the polymorphic site contained in the SNP molecular marker chr9_5817488 of the chicken individual to be tested is CA or AA.

7. The method according to claim 6, characterized in that In step (1), the reaction system of PCR amplification is: 40ul reaction system, including 4.0ul DNA template, 12ul double distilled water, 20ul Master Mix, 2ul upstream primer, and 2ul downstream primer; In step (1), the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 15 s, annealing at 68°C for 15 s, extension at 72°C for 30 s, for 14 cycles, with the annealing temperature decreasing by 1°C each cycle; denaturation at 94°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 30 s, for 25 cycles; final extension at 72°C for 5 min.

Images