Method for increasing camptothecin content in hairy roots of ophiorrhiza pumila and transgenic plants of ophiorrhiza pumila by using CaORA1

Abstract

The invention belongs to the technical field of genetic engineering, and discloses a method for increasing the content of camptothecin in hairy roots of ophiorrhiza pumila and transgenic plants of the ophiorrhiza pumila by using CaORA1. Comprising the following steps: acquiring a CaORA1 coding sequence, expressing, regulating and forming an overexpression vector, transforming agrobacterium rhizogenes, transforming ophiorrhiza pumila, inducing hairy roots, inducing a ophiorrhiza pumila transgenic plant, and measuring the content of camptothecin. A method for inducing a transgenic ophiorrhiza pumila plant through the hairy roots of the ophiorrhiza pumila is established in the invention, the overexpressed CaORA1 can promote the expression of key enzyme genes OpSTR and OpSLS in a camptothecin biosynthetic pathway, and HPLC (High Performance Liquid Chromatography) results show that the camptothecin content of the transgenic hairy roots and the transgenic plant is obviously improved.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for increasing the camptothecin content in hairy roots of short snakeroot grass and transgenic short snakeroot grass plants by utilizing CaORA1. Background Art

[0002] Camptothecin was first discovered in the anti-tumor drug screening program of the National Cancer Institute of the United States. It was extracted from Camptotheca acuminata Decne. Camptothecin is a class of monoterpene-derived indole alkaloids and is the only anticancer ingredient that exerts anti-tumor activity by inhibiting the activity of topoisomerase I. Camptothecin has anti-cancer, anti-inflammatory, and antioxidant activities, but its solubility is poor, it is easily decomposed by light, it is easy to develop drug resistance, and it has strong side effects. Therefore, its clinical application is limited. After continuous structural modification research, synthetic camptothecin derivatives have made up for most of the shortcomings of camptothecin, and camptothecin (CPTs) anti-tumor drugs with less side effects and good therapeutic effects have been successfully developed. At present, there are four CPTs anti-tumor drugs approved for use in the clinical drug market, including 10-hydroxycamptothecin, topotecan, irinotecan, and belotecan. The annual sales of camptothecin drugs in the world are about billions of dollars. However, all current camptothecin drugs are mainly synthesized using camptothecin as a raw material. Therefore, how to obtain camptothecin in large quantities is still an urgent problem that needs to be solved.

[0003] The hairy roots of D. serrata have attracted much attention as an effective material for the functional analysis of transcription factors in the camptothecin accumulation regulatory network and key enzyme genes in the camptothecin biosynthesis pathway. The key enzyme genes OpG10H, Op10HGO, and OpSLS in the iridoid pathway of D. serrata were successfully cloned, and then their overexpression and gene knockout transgenic hairy root systems were constructed, further identifying their important role in the CPT biosynthesis pathway. Although D. serrata has a shorter generation time and more stable genetics as a research object for camptothecin biosynthesis and its regulation, the establishment of a transgenic plant system, especially the induction of transgenic plants from its hairy roots, has not been reported.

[0004] AP2 / ERF transcription factors play an important role in the secondary metabolism of medicinal plants, i.e., the synthesis and accumulation of the main medicinal active ingredients in plants. They have been reported in medicinal plants such as Taxus chinensis, Nicotiana tabacum, Salvia miltiorrhiza, and Catharanthus roseus. Currently, in Camptotheca acuminata, although transcriptome data analysis shows that multiple transcription factors are related to camptothecin synthesis, their functions have not been fully verified. Previous studies have discovered and confirmed an AP2 / ERF family transcription factor, CaORA1, which was confirmed to be able to regulate camptothecin accumulation through transient overexpression and silencing in Camptotheca acuminata leaves, providing certain data basis for the study of camptothecin synthesis regulation. Summary of the invention

[0005] In order to overcome the shortcomings of the prior art, the present invention provides a method for increasing the camptothecin content in hairy roots of short snakeroot grass and transgenic short snakeroot grass plants by utilizing CaORA1, and transgenic short snakeroot grass plants are successfully induced from the transgenic hairy roots of short snakeroot grass by optimizing the culture medium, and the transgenic plants are successfully established by extracting leaf genomic DNA for PCR identification; CaORA1 in Camptotheca acuminata can promote the accumulation of camptothecin in transgenic short snakeroot grass plants, and the functional verification of the CaORA1 transcription factor of Camptotheca acuminata in the heterologous system of short snakeroot grass is realized.

[0006] The above object of the present invention is achieved through the following technical scheme: a method for increasing the camptothecin content in the hairy roots of short snakeroot using CaORA1, the steps comprising:

[0007] 1. Clone the coding sequence of the Camptotheca acuminata CaORA1 gene from the Camptotheca acuminata cDNA library;

[0008] 2. Connecting the CaORA1 gene to an expression regulatory sequence to form a plant overexpression vector containing CaORA1;

[0009] 3. Transform the plant overexpression vector containing the CaORA1 gene into Agrobacterium rhizogenes to obtain an Agrobacterium rhizogenes strain having the plant overexpression vector described in step 2;

[0010] 4. Transform the short snakeroot grass using the Agrobacterium rhizogenes strain constructed in step 3, obtain hairy roots through antibiotic screening, and then detect the hairy roots positive by PCR as transgenic short snakeroot grass hairy roots;

[0011] 5. Determine the camptothecin content of the transgenic short snakeroot hairy roots obtained in step 4, and then obtain a short snakeroot hairy root strain with increased camptothecin content.

[0012] Furthermore, a method for increasing the camptothecin content in snakeroot using CaORA1 comprises the following steps:

[0013] 1.1. The CaORA1 transgenic hairy roots were transferred into 200 mL 6,7-V liquid culture medium to grow plantlets.

[0014] 1.2. Transfer the seedlings from step 1.1 to MS medium for propagation.

[0015] 1.3. Extract genomic DNA from the plants in step 1.2, and obtain transgenic short snakeroot plants if positive by PCR identification;

[0016] 1.4. Determine the camptothecin content of the transgenic short snakeroot obtained in step 1.3, and then obtain a short snakeroot strain with increased camptothecin content.

[0017] Furthermore, in step 3, the transformation method is freeze-thaw method, and the Agrobacterium rhizogenes is C58C1 strain.

[0018] In a further preferred embodiment of the present invention, the PCR detection method in step 4 is as follows: designing specific primers for the rooting gene rolB, performing PCR amplification, and detecting by agarose gel electrophoresis. The presence of the target band indicates a positive clone.

[0019] In a further preferred embodiment of the present invention, the PCR detection method in step 4 is as follows: extracting genomic DNA of transgenic snakeroot, performing PCR amplification using specific primers of CaORA1-F / R, and detecting by agarose gel electrophoresis. The presence of the target band indicates a positive clone.

[0020] Further preferred of the present invention, in step 5, the camptothecin content of the hairy roots of transgenic short snakeroot is determined by high performance liquid chromatography, and the high performance liquid chromatography is as follows: 10 μL of crude camptothecin extract is taken from each transgenic strain and injected into a high performance liquid chromatograph. The chromatographic conditions used are: the chromatographic column uses a C-18 reverse phase silica gel column, acetonitrile: water = 55:45 (V:V) as the mobile phase, the column temperature is set to 30°C, the flow rate is 1mL / min, and the detection wavelength is 254nm. The method for detecting the camptothecin content of transgenic short snakeroot in transgenic plants is consistent with the above method.

[0021] Furthermore, in step 1.1, the culture conditions are 25° C., 110 rpm, and 1 / 23 hour light / darkness.

[0022] Furthermore, in the step 1.2, the expansion culture conditions are 25° C., 16 / 8 hours light / darkness, and the culture medium is MS medium supplemented with NAA, 6-BA and IBA.

[0023] In one embodiment of the present invention, qRT-PCR is used to detect the expression of key enzyme genes OpSTR and OpSLS in the camptothecin biosynthesis pathway in the hairy roots of transgenic short snakeroot grass. The qRT-PCR detection method is as follows: total RNA is extracted from clones identified as positive by PCR, quantified to 1 μg, and reverse transcribed into cDNA; quantitative primers for key enzyme genes OpSTR and OpSLS in the camptothecin biosynthesis pathway and internal reference gene OpActin are designed, and quantitative PCR analysis is performed using the same amount of cDNA as a template; 2 -ΔΔct Methods The expression of related genes was analyzed.

[0024] The beneficial effects of the present invention compared with the prior art are:

[0025] The invention discloses a metabolic engineering method for increasing the camptothecin content in short snakeroot grass by using CaORA1 transcription factor. The invention successfully cloned the CaORA1 transcription factor from Camptotheca acuminata, constructed an overexpression vector, genetically transformed short snakeroot grass stem segment explants, obtained transgenic hairy roots, and obtained transgenic short snakeroot grass plants by induction and optimization of culture medium conditions. The expression of key enzyme genes for camptothecin synthesis in the hairy roots was analyzed by qRT-PCR. The camptothecin content of the transgenic hairy roots and transgenic plants was analyzed by high performance liquid chromatography. The invention establishes a method for inducing transgenic short snakeroot grass plants by hairy roots of short snakeroot grass, and overexpressed CaORA1 can promote the expression of key enzyme genes OpSTR and OpSLS in the camptothecin biosynthesis pathway. The HPLC results show that the camptothecin content of the transgenic hairy roots and transgenic plants is significantly increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0027] Figure 1 This is the induction of the hairy roots of short snakeroot grass in the example of the present invention, indicating that the hairy roots of short snakeroot grass were successfully induced using Agrobacterium.

[0028] Figure 2 This is the identification of the transgenic short snakeroot hairy roots in the example of the present invention, showing that the transgenic short snakeroot hairy roots were successfully induced using Agrobacterium.

[0029] Figure 3 In the present invention, qRT-PCR was used to detect the expression of key enzyme genes OpSTR and OpSLS in the hairy roots of transgenic short snakeroot, indicating that the expression of OpSTR and OpSLS was increased.

[0030] Figure 4 In the embodiment of the present invention, HPLC was used to detect the content of camptothecin in the hairy roots of transgenic short snakeroot, indicating that the content of camptothecin was significantly increased.

[0031] Figure 5 This is the induction and cultivation optimization of the transgenic plants of D. serpentina in the embodiment of the present invention, indicating that D. serpentina grows vigorously after adding plant hormones.

[0032] Figure 6 The genomic DNA extraction and PCR identification of the transgenic snakeroot in the embodiment of the present invention indicate that the transgenic snakeroot was successfully induced.

[0033] Figure 7In the embodiment of the present invention, HPLC was used to detect the content of camptothecin in the transgenic snakeroot, indicating that the content of camptothecin was significantly increased. DETAILED DESCRIPTION

[0034] The present invention is described in detail below by specific examples, but the protection scope of the present invention is not limited. Unless otherwise specified, the experimental methods used in the present invention are all conventional methods, and the experimental equipment, materials, reagents, etc. used can be obtained from commercial channels.

[0035] Example 1: Cloning of the Camptotheca acuminata CaORA1 gene

[0036] 1. Extraction of Total RNA from Camptotheca acuminata

[0037] Take a small amount of Camptotheca acuminata leaves, freeze them quickly in liquid nitrogen, grind them in a mortar, add them to a 2 ml EP tube containing lysis buffer, and extract total RNA according to the instructions of the TIANGEN kit. Use agarose gel electrophoresis to detect RNA quality, and then measure RNA content in an ultra-micro spectrophotometer.

[0038] 2. Cloning of Camptotheca acuminata CaORA1 gene and construction of overexpression vector

[0039] The extracted RNA was used as a template and reverse transcribed into cDNA. Specific primers were designed according to the CaORA1 gene sequence. The CaORA1 gene was amplified from the total cDNA by PCR amplification. The CaORA1 gene was constructed on the plant expression vector pBI1211GD. In order to construct the expression vector, the forward primer introduced the XbaI restriction site and the reverse primer introduced the KpnI restriction site. The primers are shown in Table 1.

[0040] Table 1 PCR primers

[0041] Primer name Primer sequence (5'-3') ORA1-FL-XbaI-F GCTCTAGAATGTACCATCAAATAGCAAGTG ORA1-FL-KpnI-R GGGGTACCATGTACCATCAAATAGC

[0042] In this example, the transcription factor CaORA1 involved in regulating camptothecin synthesis was operably linked to the expression regulatory sequence to construct a plant overexpression vector pBI1211GD-CaORA1 containing the CaORA gene.

[0043] The method can be used to increase the camptothecin content in snakeroot through metabolic engineering strategies.

[0044] Example 2: Genetic transformation of short snakeroot with CaORA1 overexpression vector mediated by Agrobacterium rhizogenes to obtain transgenic hairy roots

[0045] 1. Obtaining engineered Agrobacterium rhizogenes containing CaORA1 overexpression

[0046] The plant expression vector containing CaORA1 in Example 1 was transferred into Agrobacterium rhizogenes C58C1 by freeze-thaw method, and the bacterial liquid was identified by PCR.

[0047] 2. Genetic transformation of CaORA1 gene into short snakeroot mediated by Agrobacterium rhizogenes

[0048] 2.1 Pre-culture of explants

[0049] Select robust aseptic stem segments of short snakeroot seedlings and place them in B5 culture medium at 25°C for pre-culture for 2 days.

[0050] 2.2 Co-cultivation of Agrobacterium and explants

[0051] The bacterial solution with an OD600 nm of 0.5 and the pre-cultured explants were shaken at 100 rpm in a 28°C shaker for 10 min, and the explants were transferred to B5 medium and co-cultured at 25°C for 2 days.

[0052] 2.3 Obtaining single clones of hairy roots of D. serrata

[0053] Transfer the explants containing rhizogenes Agrobacterium to a sterilized solid culture medium (B5+300mg / L Cb), continue to culture at room temperature in the dark, replace the culture medium according to the growth of Agrobacterium, and increase the antibiotic ratio of the culture medium appropriately to inhibit the growth of rhizogenes Agrobacterium colonies. After 15 days, callus tissue will first form at the incision of the explant. About 14-20 days, yellow hairy roots will slowly grow. Transfer the stem segments with hairy roots in batches to the culture medium, B5+200mg / L Cb, to make the short snakeroot explants grow rapidly. When the hairy roots grow to more than 3cm and have branches, cut the short snakeroot hairy root single clones with better growth from the explants by sterile operation, inoculate them on the culture medium (B5+100mg / L Cb) and culture them in the dark for 14 days. After the growth of the hairy roots is stable, transfer them to the B5 solid culture medium without antibiotics. Figure 1 .

[0054] 2.4 Expansion of hairy roots

[0055] Take the tip of the hairy root of the same branch, about 1 cm, and put it into B5 liquid (150 mL) culture medium. Place it in a constant temperature shaker in the dark and shake at 25°C and 100 rpm to obtain transgenic hairy roots.

[0056] Identification of transgenic hairy roots of short snakeroot by 3PCR

[0057] In order to identify the root culture obtained in this experiment as the hairy roots of D. serpentinae induced by Agrobacterium rhizogenes C58C1, Table 2 was designed based on the sequence of the C58C1 marker gene rolC. The hairy roots of D. serpentinae, the genomic DNA of wild roots of D. serpentinae, and the C58C1 plasmid were used as templates to screen positive hairy roots. The positive results were identified by agarose gel electrophoresis. Figure 2 .

[0058] Table 2 PCR primers

[0059] Primer name Primer sequence (5'-3') RolC-F CTCCTGACATCAAACTCGTC RolC-R TGCTTCGAGTTATGGGTACA

[0060] In this example, the plant expression vector is transformed into Agrobacterium rhizogenes to obtain an Agrobacterium rhizogenes strain containing a plant overexpression vector of the CaORA1 gene for transforming short snakeroot grass, and the Agrobacterium rhizogenes is used to infect short snakeroot grass stem segments to obtain transgenic short snakeroot grass hairy roots detected by PCR. The acquisition of transgenic short snakeroot grass hairy roots provides direct material for screening short snakeroot grass hairy roots with a higher camptothecin content.

[0061] Example 3 Induction and identification of transgenic plants of short snakeroot

[0062] 3.1 Plant induction of positive transgenic hairy roots

[0063] The well-growing hairy roots were transferred to a liquid culture medium containing 6,7V (containing 2 mg / L 6-BA) and cultured at 110 rpm with 1 / 23 hour light and dark. Short snakeroot root buds gradually grew during the culture process. The hairy root buds were cultured in a rooting medium (supplemented with 0.5 mg / L NAA, 2 mg / L 6-BA) with 168 hours of light and dark for 3 weeks and then transferred to MS medium containing 0.5 mg / L NAA, 2 mg / L 6-BA, and 0.5 mg / L IBA for expansion.

[0064] 3.2 Identification of transgenic snakeroot plants

[0065] In order to identify that the transgenic plants obtained in the present invention are transgenic plants induced by Agrobacterium C58C1 and contain CaORA sequences, genomic DNA of short snakeroot plants was extracted, and specific primers were designed with the CaORA1 gene sequence to perform PCR identification and screening of positive transgenic plants. The positive results were identified by agarose gel electrophoresis. Figure 6 .

[0066] Example 4 Detection of the expression of key enzyme genes OpSLS and OpSTR for camptothecin synthesis in transgenic short snakeroot hairy roots using qRT-PCR

[0067] RNA was extracted from the transgenic short snakeroot hairy roots and then reverse transcribed into cDNA. The effect of CaORA1 gene on the transcriptional expression level of camptothecin biosynthesis genes OpSLS and OpSTR was analyzed by qRT-PCR (primers are shown in Table 3). The results of qRT-PCR analysis showed that the expression levels of camptothecin biosynthesis genes OpSLS and OpSTR were also significantly increased in the transgenic short snakeroot hairy roots (see Figure 3 )

[0068] Table 3 qRT-PCR primers

[0069] Primer name Primer sequence (5'-3') OpACTIN-QF AGCAGCATGAAGATTAAGGTTGTG OpACTIN-QR CACATCTGCTGGAAAGTGCTG OpSLS-QF AAGCATCCCGAATGGCAAGA OpSLS-QR GAAGCATCACCGTTGGCATC OpSTR-QF AGCCATGGTTGTGTCGATTCT OpSTR-QR TTCACCATCGGAGTCAAAAGC

[0070] Example 5 Determination of Camptothecin Content in Transgenic Short Snakeroot Hairy Roots and Transgenic Short Snakeroot Plants by HPLC

[0071] 4.1. Extraction of camptothecin from hairy roots and snakeroot

[0072] Cut an appropriate amount of hairy roots into a tube, dry in an oven overnight, weigh the dry weight of the sample, add 1 mL of methanol, grind at 50 Hz for 100 s, shake and mix for 5 min, let stand at 4 ° C for 1 h, slowly pipette the supernatant into a new 2 mL centrifuge tube, put it into a vacuum rotary evaporator, and spin dry the liquid. Add 1 mL of methanol to the remaining precipitation tube and spin dry in a vacuum for about 1 h. Repeat the operation three times to finally obtain the spin-dried extract, filter it with a 0.22 μm organic phase filter membrane, and obtain the crude extract of camptothecin after filtration and store it at -20 ° C for use.

[0073] 4.2. HPLC determination of camptothecin in hairy roots and short snakeroot

[0074] A C18 reverse column was used, the column temperature was 30℃; the mobile phase was methanol and ultrapure water 0.22μm filter membrane, the ratio of methanol to water was 55:45; the UV detector, the detection wavelength was 254nm; the sample injection volume was 5μL, the flow rate was set to 1mL / min, and the sample detection time was set to 22min. Sample pretreatment, the extract obtained by spin drying was added with 500μL of methanol, and the pipette was repeatedly blown to make it completely dissolved, and then filtered with a 0.22μm organic filter membrane, loaded into a new centrifuge tube, 200μL was taken and loaded into the sample bottle of the automatic sampler, after the test, the peak area of ​​the camptothecin component of each sample was recorded in HPLC, the peak area was substituted into the above standard curve, and the calculated result was the camptothecin content in the sample.

[0075] In the present invention, the camptothecin content of the transgenic hairy roots is significantly increased compared with the wild type and the control group, and the camptothecin content of the transgenic short snakeroot plants is significantly increased compared with the wild type.

[0076] The above-described embodiments are only preferred embodiments of the present invention, but not all feasible embodiments of the present invention. For those skilled in the art, any obvious changes made thereto without departing from the principles and spirit of the present invention should be considered to be included in the scope of protection of the claims of the present invention.

Claims

1. A method for increasing the camptothecin content in the hairy roots of short snakeroot using CaORA1, characterized in that the steps include: S1, the coding sequence of the Camptotheca acuminata CaORA1 gene was cloned from the Camptotheca acuminata cDNA library; S2, connecting the CaORA1 gene to an expression regulatory sequence to form a plant overexpression vector containing CaORA1; S3, transforming Agrobacterium rhizogenes with the plant overexpression vector containing the CaORA1 gene to obtain an Agrobacterium rhizogenes strain having the plant overexpression vector described in step 2; S4, using the Agrobacterium rhizogenes strain constructed in step S3 to transform short snakeroot grass, and obtaining hairy roots through antibiotic screening, and then the hairy root strains that are positive through PCR detection are transgenic short snakeroot grass hairy roots; S5. Determine the camptothecin content of the transgenic scutellaria hairy roots obtained in step S4, and thereby obtain a scutellaria hairy root strain with increased camptothecin content.

2. The method for increasing the camptothecin content in the hairy roots of short snakeroot using CaORA1 according to claim 1, characterized in that: The transformation method in step S3 is freeze-thaw method, and the Agrobacterium rhizogenes is C58C1 strain.

3. The method for increasing the camptothecin content in the hairy roots of short snakeroot using CaORA1 according to claim 1, characterized in that: The PCR detection method in step S4 is as follows: design specific primers for the rooting gene rolB, perform PCR amplification, and perform agarose gel electrophoresis detection. The presence of the target band indicates a positive clone.

4. The method for increasing the camptothecin content in the hairy roots of short snakeroot using CaORA1 according to claim 1, characterized in that: The PCR detection method in step S4 is as follows: extract the genomic DNA of the transgenic short snakeroot, perform PCR amplification using specific primers of CaORA1-F / R, and detect by agarose gel electrophoresis. The presence of the target band indicates a positive clone.

5. The method for increasing the camptothecin content in the hairy roots of short snakeroot using CaORA1 according to claim 1, characterized in that: In step S5, the camptothecin content of the hairy roots of transgenic short snakeroot is determined by high performance liquid chromatography, and the high performance liquid chromatography is as follows: 10 μL of crude camptothecin extract is taken from each transgenic strain and injected into a high performance liquid chromatograph. The chromatographic conditions used are: the chromatographic column uses a C-18 reverse phase silica gel column, acetonitrile: water = 55:45 (V:V) as the mobile phase, the column temperature is set to 30°C, the flow rate is 1mL / min, and the detection wavelength is 254nm. The method for detecting the camptothecin content of transgenic short snakeroot in transgenic plants is consistent with the above method.

6. A method for increasing the camptothecin content in snakeroot using CaORA1, characterized in that: Based on the step of claim 1, the following steps are performed: S1.

1. Transfer the CaORA1 transgenic hairy roots into 200 mL 6,7-V liquid culture medium to grow plant seedlings. S1.

2. Transfer the seedlings from step S1.1 to MS medium for propagation. S1.3, extracting genomic DNA from the plants in step S1.2, and obtaining transgenic short snakeroot plants if positive by PCR identification; S1.4, measuring the camptothecin content of the transgenic short snakeroot obtained in step S1.3, and thereby obtaining a short snakeroot strain with increased camptothecin content.

7. The method for increasing the camptothecin content in snakeroot using CaORA1 according to claim, characterized in that: In step S1.1, the culture conditions are 25° C., 110 rpm, and 1 / 23 hour light / darkness.

8. The method for increasing the camptothecin content in snakeroot using CaORA1 according to claim, characterized in that: In step S1.2, the expansion culture conditions are 25° C., 16 / 8 hours light / darkness, and the culture medium is MS medium supplemented with NAA, 6-BA and IBA.

Images