Carrier and method for improving freezing survival rate of pig blastocysts

Abstract

The invention discloses a carrier and a method for improving the freezing survival rate of a pig blastocyst, and belongs to the technical field of livestock embryo engineering. The vector for improving the freezing survival rate of the pig blastocyst is an in-vitro transcription vector of pig hormone sensitive lipase (HSL), and a large amount of mRNA of the HSL can be obtained in vitro by applying the vector. Through micro-injection of mRNA of HSL in a pig fertilized egg, the lipid droplet enrichment level in blastocyst cells can be obviously reduced and the adverse effect of lipid droplets on blastocyst freezing can be weakened under the condition that the blastocyst development rate is not influenced. The fertilization blastocyst injected with the HSL mRNA is collected for freezing and unfreezing, and the freezing survival rate of the pig blastocyst can be remarkably improved through the treatment.

Description

Technical Field

[0001] The present invention relates to the technical field of livestock embryo engineering, and more particularly to a carrier and a method for improving the freezing survival rate of pig blastocysts. Background Art

[0002] Embryo cryopreservation technology is an important technology in the field of embryo engineering and animal reproduction. It can promote the industrialization of embryo transplantation, replace the introduction of live breeding stock, establish an animal gene bank, and preserve the genetic resources of excellent livestock and endangered animals. At present, the cryopreservation technology for human and mouse embryos is quite mature, but after using similar methods to cryopreserve pig embryos, the problems of low survival rate and low development rate have not been solved, which hinders the industrial application of high-quality pig embryos. Many factors such as the characteristics of the embryo itself, cryoprotectants, and freezing and thawing methods will affect the effect of embryo cryopreservation.

[0003] It is currently believed that one of the main reasons for the low survival rate of pig embryos during cryopreservation is that pig embryo cells contain abundant lipid droplets. The high abundance of lipid droplets will cause lipid phase change during freezing, affecting the penetration of cryoprotectants and cell membrane permeability, resulting in the formation of a large number of ice crystals during the freezing process, thereby damaging embryonic development. In order to further improve the survival rate of pig embryos during cryopreservation, how to reduce or remove lipid droplets in pig embryo cells before freezing is one of the important research directions for those skilled in the art.

[0004] Therefore, providing a carrier and method for improving the freezing survival rate of pig blastocysts without affecting the development of pig embryos is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a vector and method for improving the survival rate of porcine blastocysts during freezing. The vector is used to synthesize the mRNA of porcine hormone-sensitive lipase HSL in vitro, and the mRNA is microinjected into the cytoplasm of porcine fertilized eggs to increase the expression level of HSL protein in the embryo, so that it can exert its triglyceride and diglyceride hydrolysis activity, and finally reduce the enrichment level of lipid droplets in porcine blastocyst cells, thereby significantly improving the survival rate of frozen blastocysts.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A vector for improving the survival rate of porcine blastocysts during freezing, which is based on a pcDNA3.1(+) vector and into which a fragment containing a porcine HSL gene coding frame is inserted;

[0008] The nucleotide sequence of the porcine HSL gene coding frame is shown in SEQ ID NO.1;

[0009] The nucleotide sequence of the fragment containing the pig HSL gene coding frame is shown in SEQ ID NO.3; Kozak sequence, red fluorescent protein mCherry coding frame and restriction sites are added to both ends of the pig HSL gene coding frame.

[0010] Furthermore, the vector is used in the preparation of porcine HSL mRNA.

[0011] Furthermore, the preparation method of porcine HSL mRNA is as follows: the vector described in claim 1 is digested by ScaI restriction endonuclease to obtain a linearized vector, and then the linearized vector is used as a template to obtain HSL mRNA through an in vitro transcription experiment.

[0012] The vector comprises a T7 promoter element for in vitro transcription and a ScaI restriction site for linearizing the vector.

[0013] Furthermore, the vector or the porcine HSL mRNA is used to improve the survival rate of porcine blastocysts during freezing.

[0014] Furthermore, a method for improving the survival rate of porcine blastocysts during freezing is provided, wherein porcine HSL mRNA prepared by microinjection is used to overexpress hormone-sensitive lipase HSL in porcine fertilized eggs.

[0015] Furthermore, the method for improving the survival rate of pig blastocysts during freezing comprises the following steps:

[0016] (1) Collect porcine fertilized eggs and microinject porcine HSL mRNA;

[0017] (2) Blastocyst freezing;

[0018] (3) Blastocyst thawing;

[0019] The microinjection method is to collect pig fertilized eggs, transfer them into pig embryo operation buffer, use a microinjection needle to inject 10pL of pig HSL mRNA into the cytoplasm of the fertilized eggs, and then transfer them into pig embryo in vitro culture PZM3 culture medium, at 38.5°C and 5% CO 2 , cultured under saturated humidity conditions until the 6th day, and the blastocysts were collected and frozen;

[0020] The blastocyst freezing method comprises the following steps: immersing the fertilized porcine blastocyst in a balancing solution for incubation for 2 minutes, then immersing the blastocyst in a freezing solution for incubation for 25-30 seconds, and placing the blastocyst at the front end of a Cryotop carrier with a minimum amount of liquid within the 25-30 seconds, and rapidly immersing the blastocyst in liquid nitrogen for blastocyst freezing;

[0021] The blastocyst thawing method is to quickly take out the carrier straw containing the blastocyst from liquid nitrogen, expose it to air for 3 seconds, and then immerse it in thawing solution I, thawing solution II, and basic solution in sequence, incubate each for 5 minutes, and then transfer it to PZM3 culture solution containing 10% fetal bovine serum and incubate it at 38.5°C and 5% CO 2 , and continue culturing for 18 h under saturated humidity conditions.

[0022] Furthermore, the concentration of the microinjected porcine HSL mRNA is 100-500 ng / μL.

[0023] Further, the porcine embryo operation buffer preparation method is as follows: 10 mL of NCSU23 solution, 0.004 g of sodium chloride, 0.100 g of glucose, 0.007 g of cysteine, 0.015 g of L-glutamine, 0.088 g of taurine, and 0.055 g of hypotaurine are dissolved in 100 mL of ultrapure water, and the pH is adjusted to 7.2-7.4, and the osmotic pressure is adjusted to 295-300 mOsm;

[0024] The preparation method of the PZM3 culture medium for in vitro culture of pig embryos is as follows: 3.156g of sodium chloride, 1.053g of sodium bicarbonate, 0.373g of potassium chloride, 0.024g of potassium dihydrogen phosphate, 0.049g of magnesium sulfate heptahydrate, 0.308g of calcium lactate, 0.011g of sodium pyruvate, 0.073g of L-glutamine, 0.273g of hypotaurine, 10mL of 50×BME amino acid solution, 5mL of 100×MEM non-essential amino acid solution, 0.025g of gentamicin, 0.033g of penicillin, 0.025g of streptomycin and 1.500g of bovine serum albumin are added to 500mL of ultrapure water, the pH is adjusted to 7.2-7.4, and the osmotic pressure is adjusted to 295-300mOsm.

[0025] Further, the specific liquid preparation involved in the blastocyst freezing and thawing method is as follows:

[0026] The basal medium was prepared by adding 20% ​​fetal bovine serum to the M199 basal medium containing HEPES;

[0027] Add 10% ethylene glycol and 10% dimethyl sulfoxide to the base solution to prepare a balanced solution;

[0028] Add 20% ethylene glycol and 20% dimethyl sulfoxide to the base liquid to prepare a freezing liquid;

[0029] Add 0.3 M sucrose to the base solution to prepare thawing solution I;

[0030] 0.2 M sucrose was added to the base solution to prepare thawing solution II.

[0031] HSL (Hormone-sensitive lipase) has triglyceride and diglyceride hydrolase activity, participates in lipid metabolism and energy balance, and has the function of regulating the enrichment level of neutral lipids in lipid droplets. In the early stage of this study, it was found that the expression level of HSL protein increased significantly in the pig blastocyst stage, which was consistent with the dynamic change law that the lipid droplet structure in the cytoplasm of blastocyst cells was significantly reduced at this stage. It is speculated that HSL is directly involved in the lipid catabolism of pig embryos. Therefore, this method aims to microinject HSL mRNA into the cytoplasm of fertilized eggs, further reduce the enrichment level of lipid droplets in pig blastocyst cells, and weaken the adverse effects of lipid droplets on embryo freezing, thereby significantly improving the survival rate of frozen blastocysts.

[0032] It can be seen from the above technical scheme that, compared with the prior art, the present invention discloses a vector and a method for improving the survival rate of porcine blastocysts when frozen. A large amount of porcine HSL mRNA can be obtained by in vitro transcription using the vector, and the lipid droplet enrichment level in porcine blastocyst cells can be significantly reduced by microinjecting HSL mRNA into the cytoplasm of porcine fertilized eggs. After freezing the blastocysts, the survival rate of porcine blastocysts when frozen can be significantly improved, and the quality of porcine blastocysts cultured for 18 hours after thawing has no significant difference from that of unfrozen blastocysts. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0034] Figure 1 The accompanying drawing is a schematic diagram of the pig HSL in vitro transcription vector pcDNA3.1(+)-mCherry-pigHSL of the present invention;

[0035] Figure 2 The accompanying drawings show that the HSL overexpression group of the present invention is a pig fertilized embryo microinjected with the pig HSL mRNA (100ng / μL, 500ng / μL, 1000ng / μL) prepared by the present invention, and the control group is a pig fertilized embryo microinjected with ultrapure water. The figure is a bright field image of the above four groups of embryos developed in vitro to the 6th day (blastocyst stage);

[0036] Figure 3The accompanying drawings are lipid droplet staining effect diagrams of pig fertilized blastocysts in the HSL overexpression group (500 ng / μL) and the control group of the present invention, the DIC group is a bright field effect diagram of blastocyst development, the mCherry group (red) is an expression effect diagram of HSL coupled to red fluorescent protein, the DAPI group (blue) is a blastocyst nucleus stained with DAPI, the BODIPY group (green) is a lipid droplet in the blastocyst cell stained with BODIPY 493 / 503, and the Merge group is the overlapping effect of the first four groups of photo data;

[0037] Figure 4 The accompanying drawings are bright field effect diagrams of fertilized blastocysts of the HSL overexpression group (500 ng / μL) and the control group before freezing, after thawing, and after 18 h of culturing after thawing;

[0038] Figure 5 The accompanying drawings are cell staining effect diagrams of the fertilized blastocysts of the HSL overexpression group (500 ng / μL) and the unfrozen control group cultured for 18 h after thawing of the present invention; the mCherry group (red) is the expression effect diagram of HSL-coupled red fluorescent protein, the DAPI group (blue) is the blastocyst cell nucleus stained with DAPI, the KLF4 group (green) is the blastocyst inner cell mass cells stained with KLF4, and the Merge group is the overlapping effect of the first three groups of photo data. DETAILED DESCRIPTION

[0039] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] Sources and preparation of experimental materials: M199 basal culture medium without HEPES, M199 basal culture medium with HEPE, in vitro transcription kit (catalog number AM1345), and BODIPY 493 / 503 lipid droplet staining reagent (catalog number D3922) are products of Thermo Fisher Scientific; plasmid mini-extraction kit, gel recovery kit, and reverse transcription PCR kit are products of Novazonics; micro RNA extraction kit (catalog number DP420) is a product of Tiangen; PCR amplification enzyme PrimerStar and nucleic acid ligase SolutionI are products of Bio-Medical; restriction endonucleases are products of New England Biolabs; pmCherry-C1 and pcDNA3.1(+) vectors are retained by the laboratory; fetal bovine serum (catalog number SH30070.03) is a product of Hyclone; DAPI cell nuclear staining reagent is a product of Beyotime; KLF4 (catalog number ab215036) is a product of Abcam; other reagents and consumables are products of Sigma-Aldrich.

[0041] a. Porcine follicular fluid

[0042] Fresh ovarian tissue of pigs was obtained from Shuanghui Food Co., Ltd., Wuhan, Hubei (collection time: March 2023 to September 2023), placed in a 38°C saline thermos, and transported to the laboratory within 4 hours. Subsequently, a syringe equipped with a 12G needle was used to aspirate the follicular fluid of the 2-8mm follicles on the surface of the ovary, and the follicular fluid was poured into a 50mL centrifuge tube, placed in a 38°C incubator, and allowed to stand for 30 minutes. The upper follicular fluid was centrifuged at 3000rpm for 30 minutes, and the supernatant was filtered with a 0.22μm filter to obtain sterile porcine follicular fluid.

[0043] b. IVM culture medium for in vitro maturation of porcine oocytes

[0044] 10% porcine follicular fluid, 1 mg / mL L-cysteine, 0.44 mg / mL sodium pyruvate, 10 ng / mL epidermal growth factor, 50 ng / mL insulin, 5 IU / mL gonadotropin, 5 IU / mL chorionic gonadotropin, and 11.3 ng / mL kanamycin were added to the M199 basal culture medium without HEPES.

[0045] c. Porcine embryo in vitro culture in PZM3 medium

[0046] Add 3.156 g of sodium chloride, 1.053 g of sodium bicarbonate, 0.373 g of potassium chloride, 0.024 g of potassium dihydrogen phosphate, 0.049 g of magnesium sulfate heptahydrate, 0.308 g of calcium lactate, 0.011 g of sodium pyruvate, 0.073 g of L-glutamine, 0.273 g of hypotaurine, 10 mL of 50×BME amino acid solution (Cat. No. B6766), 5 mL of 100×MEM non-essential amino acid solution (Cat. No. M7145), 0.025 g of gentamicin, 0.033 g of penicillin, 0.025 g of streptomycin and 1.500 g of bovine serum albumin to 500 mL of ultrapure water, adjust the pH to 7.2-7.4, and adjust the osmotic pressure to 295-300 mOsm.

[0047] d. NCSU23 solution

[0048] 6.354 g of sodium chloride, 0.656 g of potassium chloride, 0.161 g of sodium dihydrogen phosphate, 0.586 g of magnesium sulfate heptahydrate, 0.075 g of kanamycin, and 0.015 g of phenol red were added to 100 mL of ultrapure water.

[0049] e. Porcine embryo operation buffer

[0050] Dissolve 10 mL of NCSU23 solution, 0.004 g of sodium chloride, 0.100 g of glucose, 0.007 g of cysteine, 0.015 g of L-glutamine, 0.088 g of taurine, and 0.055 g of hypotaurine in 100 mL of ultrapure water, adjust the pH to 7.2-7.4, and adjust the osmotic pressure to 295-300 mOsm.

[0051] f.PVA-TL HEPES buffer

[0052] Add 6.663 g of sodium chloride, 0.237 g of potassium chloride, 0.168 g of sodium bicarbonate, 0.041 g of sodium dihydrogen phosphate, 1.868 mL of sodium lactate, 0.102 g of magnesium chloride hexahydrate, 0.294 g of calcium chloride dihydrate, 2.383 g of HEPES, 0.022 g of sodium pyruvate, 0.025 g of gentamicin, 0.065 g of penicillin, 0.100 g of polyvinyl alcohol, 2.186 g of sorbitol and 0.010 g of phenol red to 1 L of ultrapure water, adjust the pH to 7.2-7.4, and adjust the osmotic pressure to 295-300 mOsm.

[0053] g. Porcine in vitro fertilization mTBM buffer

[0054] Add 0.661 g of sodium chloride, 0.224 g of potassium chloride, 0.110 g of calcium chloride dihydrate, 0.242 g of trisaminomethane, 0.198 g of glucose, 0.055 g of sodium pyruvate, 0.067 g of caffeine and 0.200 g of bovine serum albumin to 100 mL of ultrapure water, adjust the pH to 7.2-7.4, and adjust the osmotic pressure to 295-300 mOsm.

[0055] h. Embryo freezing and thawing solutions

[0056] 20% fetal bovine serum was added to the M199 basal culture medium containing HEPES as the basal solution, and on this basis, the balancing solution (10% ethylene glycol + 10% dimethyl sulfoxide), freezing solution (20% ethylene glycol + 20% dimethyl sulfoxide), thawing solution I (0.3 M sucrose), and thawing solution II (0.2 M sucrose) were prepared respectively.

[0057] Example 1 Preparation of porcine HSL mRNA by in vitro transcription

[0058] a. Construction of porcine HSL in vitro transcription vector

[0059] The porcine HSL gene is located on chromosome 6, with a coding sequence length of 2295 bp (as shown in SEQ ID NO.1), encoding 764 amino acids (as shown in SEQ ID NO.2). RNA from porcine ovarian tissue was extracted by a micro RNA extraction kit, and the corresponding ovarian tissue cDNA was obtained by a reverse transcription PCR kit. The full-length coding frame fragment of the HSL gene was obtained using the PCR amplification enzyme PrimerStar using this as a template, and EcoRI and BamHI restriction sites were added to the 5' segments of the upstream and downstream primers of HSL, respectively. The amplified fragment was recovered by gel electrophoresis, and then the fragment was digested with EcoRI and BamHI restriction endonucleases. The fragment was then spliced ​​into the multiple cloning site region of the pmCherry-C1 vector using a nucleic acid ligase SolutionI kit to obtain the pmCherry-C1-pigHSL vector. The pmCherry-C1-pigHSL vector was double-digested with two restriction endonucleases, NheI and BamHI, and a fragment with a band size of 3067 bp (sequence as shown in SEQ ID NO.3) was collected after gel electrophoresis for gel recovery. This fragment is the HSL coding sequence coupled to the red fluorescent protein mCherry coding frame. Subsequently, the nucleic acid ligase SolutionI kit was used to splice into the multiple cloning site region of the pcDNA3.1(+) vector. The vector was named pcDNA3.1(+)-mCherry-pigHSL( Figure 1 ).

[0060] Nucleotide sequence of HSL gene coding frame (2295 bp):

[0061] atggacctgcgcacaatgacacagtcactg cacaccggctg ggcccaccacgccgccagtctga ; SEQ ID NO.1.

[0062] Amino acid sequence of HSL gene coding frame (764):

[0063] ; SEQ ID NO.2.

[0064] The nucleotide sequence containing the Kozak sequence, the red fluorescent protein mCherry coding frame, the restriction site and the HSL gene coding frame (3067bp):

[0065]

[0066] In SEQ ID NO.3, bp 1-6 is the NheI restriction site; bp 17-22 is the Kozak sequence; bp 23-730 is the red fluorescent protein mCherry nucleotide sequence; bp 760-765 is the EcoRI restriction site; bp 767-3061 is the HSL nucleotide sequence; and bp 3062-3067 is the BamHI restriction site.

[0067] The amplification primer sequences are as follows:

[0068] HSL upstream primer:

[0069]

[0070] HSL downstream primers:

[0071]

[0072] b. In vitro transcription

[0073] The pcDNA3.1(+)-mCherry-pigHSL vector was digested with ScaI restriction endonuclease to obtain a linearized DNA template. The in vitro transcription experiment was performed using an in vitro transcription kit to obtain the mRNA of pig HSL. The HSL mRNA was dissolved in RNase-free ultrapure water to 100 ng / μL, 500 ng / μL, and 1000 ng / μL and stored at -80°C.

[0074] Example 2 Preparation of pig fertilized embryos by in vitro fertilization

[0075] a. In vitro maturation of porcine oocytes

[0076] Porcine ovaries were obtained from Wuhan Shuanghui Food Co., Ltd., Hubei Province, placed in a 38°C saline thermos, and transported to the laboratory within 4 hours. Follicular fluid from 2-8 mm follicles on the surface of the ovary was aspirated using a syringe with a 12G needle, and the follicular fluid was put into a 50 mL centrifuge tube and placed in a 38°C incubator for 30 minutes. When the cumulus granulosa cell-oocyte complex (COCs) sank to the bottom of the centrifuge tube, the upper follicular fluid was poured out, 50 mL of PVA-TL HEPES solution was added, and the COCs were resuspended by inverting. COCs with uniform cytoplasm and multiple layers of cumulus granulosa cells were selected under a stereomicroscope, and washed three times in porcine oocyte in vitro maturation IVM culture medium, and then transferred to a four-well plate containing IVM culture medium, 50 COCs were placed in every 500 μL, and incubated at 38.5°C and 5% CO 2Incubate in a 42-hour incubator. Take a 0.5 mL centrifuge tube, add 400 μL of HEPES-free M199 basal culture medium containing 0.1% hyaluronidase, then place the mature COCs in the centrifuge tube, digest at 38.5°C for 5 minutes, and centrifuge at 1000 rpm for 1 minute. Use a 200 μm glass needle to draw the COCs at the bottom of the centrifuge tube, wash three times in PVA-TL HEPES solution, and fully remove the cumulus granulosa cells on the zona pellucida of the oocyte. Finally, use a glass needle under a stereomicroscope to select the oocytes that have expelled the first polar body, and you can get mature oocytes for preparing in vitro fertilized embryos.

[0077] b. In vitro fertilization

[0078] The frozen semen straw was quickly removed from the liquid nitrogen and placed in a 50°C water bath for 16 seconds. The two ends of the frozen semen straw were cut off and the semen was added to 10 mL of porcine in vitro fertilization mTBM buffer. After premixing, it was placed in a 36°C water bath for 5 minutes. The mixture was gently inverted every 1.5 minutes and then centrifuged at 1900 rpm for 4 minutes. After removing the supernatant, 100 μL of mTBM buffer was taken to resuspend the sperm and dilute to 1×10 6 50 μL of sperm suspension and 30 mature oocytes were added to a droplet made of 50 μL mTBM buffer and incubated at 38.5°C and 5% CO 2 After 5 hours of fertilization in the incubator, pig fertilized eggs can be obtained.

[0079] c. Microinjection

[0080] The above fertilized eggs were collected, and the sperm attached to the zona pellucida was washed away by blowing with a glass needle. The fertilized eggs were transferred into the pig embryo operation buffer, and 0.5 μL of 100 ng / μL, 500 ng / μL, and 1000 ng / μL of HSL mRNA were added into the microinjection needle using an RNase-free micropipette tip. After the injection needle was installed, it was connected to the microinjection air pump, and about 10 pL of HSL mRNA was injected into the cytoplasm of the fertilized eggs. Then, the eggs were transferred into the pig embryo in vitro culture medium PZM3 and cultured at 38.5°C and 5% CO. 2 , cultured under saturated humidity conditions.

[0081] d. Embryo freezing and thawing

[0082] The blastocysts with significant fat removal and good quality on the 6th day were selected for freezing. The freezing method is as follows:

[0083] ① Before freezing, take 600 μL of equilibration solution and freezing solution into a four-well plate and preheat it on a 38.5℃ hot plate for 15 minutes.

[0084] ② When freezing, immerse the blastocyst in the balancing solution to rinse twice, incubate for 2 minutes, then immerse the blastocyst in the freezing solution, transfer the blastocyst to the front end of the Cryotop carrier with the least amount of liquid, and quickly immerse it in liquid nitrogen. The time required for the blastocyst from being transferred to the freezing solution to being immersed in liquid nitrogen is 25-30 seconds.

[0085] ③ Before thawing, take 600 μL of thawing solution I, thawing solution II, basal solution and PZM3 culture medium containing 10% fetal bovine serum into a four-well plate and preheat it on a 38.5℃ hot plate for 15 minutes.

[0086] ④ When thawing, quickly remove the carrier from liquid nitrogen, wait for 3 seconds in the air, and then transfer to thawing solution I, thawing solution II, and basal solution in turn, incubating for 5 minutes each. Then transfer the thawed blastocysts to PZM3 culture medium containing 10% fetal bovine serum and incubate at 38.5℃, 5% CO 2 The cells were cultured under saturated humidity conditions for 18 h, and the reswelling survival rate was counted. The blastocyst cells were counted by immunofluorescence staining to determine the impact on the blastocyst quality.

[0087] Test results:

[0088] Figure 2 The bright field images of the fertilized embryos of the 100 ng / μL, 500 ng / μL, and 1000 ng / μL HSL mRNA microinjection overexpression group and the control group prepared by the present invention at the 6th day (blastocyst stage). Figure 2 As shown, microinjection of 100ng / μL and 500ng / μL HSL mRNA had no significant effect on the development of pig fertilized embryos, with blastocyst rates of 23.67±6.75% and 21.87±5.01%, respectively, and the blastocyst rate of the control group was 27.00±6.68%. In addition, Figure 2 It can be seen that microinjection of 500 ng / μL of HSL mRNA can reduce the level of lipid droplet enrichment in the fertilized blastocyst.

[0089] Table 1 Effects of microinjection of HSL mRNA on the in vitro development of pig fertilized embryos

[0090]

[0091] Each experiment was repeated three times, and the results are expressed as mean ± standard deviation. The same lowercase letters in the same column indicate that the difference is not statistically significant (P>0.05), and different lowercase letters in the same column indicate that the difference is statistically significant (P<0.05). The number of embryos is the total number of embryos in the three repeated experiments. The development rates of 2-cell embryos, 4-cell embryos and blastocysts were counted on the 2nd, 3rd and 6th day of embryo culture (the day of the in vitro fertilization experiment was day 0), and the proportion of embryos in the corresponding stage to the total number of cultured embryos was calculated.

[0092] Figure 3 The results are lipid droplet staining of pig fertilized blastocysts in the HSL overexpression group (500ng / μL) and the control group, the DIC group is a bright field effect of blastocyst development, the mCherry group (red) is the expression effect of HSL coupled to red fluorescent protein, the DAPI group (blue) is the DAPI-stained blastocyst nucleus, the BODIPY 493 / 503 group (green) is the lipid droplets in the blastocyst cells stained by BODIPY 493 / 503, and the Merge group is the overlap effect of the first four groups of photo data. The results showed that overexpression of 500ng / μL HSL mRNA can significantly reduce the level of lipid droplet enrichment in pig fertilized blastocyst cells.

[0093] Figure 4 The bright field effect pictures of fertilized blastocysts in the HSL overexpression group (500 ng / μL) and the control group before freezing, after thawing, and after 18 hours of culturing after thawing. Figure 4 As shown in Table 2, the reswelling survival rate of the fertilized blastocysts in the 500 ng / μL HSL mRNA overexpression group after thawing (86.00±4.11%) was significantly higher than that in the control group (17.50±3.54%).

[0094] Table 2 Effects of microinjection of HSL mRNA on freezing of porcine in vitro fertilized blastocysts

[0095]

[0096] Each experiment was repeated three times, and the results are expressed as mean ± standard deviation. The same lowercase letters in the same column indicate that the difference is not statistically significant (P>0.05), and the different lowercase letters in the same column indicate that the difference is statistically significant (P<0.05). The reswelling survival rate is the ratio of the number of frozen fertilized blastocysts that reswelled 18 hours after thawing to the total number of thawed blastocysts.

[0097] Figure 5 The following are the cell staining effects of the HSL overexpression group (500ng / μL) and the unfrozen control group fertilized blastocysts cultured for 18 hours after thawing. The mCherry group (red) is the expression effect of HSL coupled to red fluorescent protein, the DAPI group (blue) is the blastocyst nucleus stained with DAPI, the KLF4 group (green) is the blastocyst inner cell mass cells stained with KLF4, and the Merge group is the overlapping effect of the first three groups of photo data. Figure 5 As shown in Table 3, injection of 500 ng / μL HSL mRNA had no effect on the total cell number, inner cell mass number, and inner cell mass cell number / total cell number of fertilized blastocysts after thawing.

[0098] Table 3 Effect of microinjection of HSL mRNA on the quality of porcine in vitro fertilized blastocysts after thawing

[0099]

[0100] Each experiment was repeated three times, and the results are expressed as mean ± standard deviation. Data in the same column marked with the same lowercase letters indicate that the difference is not statistically significant (P>0.05).

[0101] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A carrier for improving the survival rate of porcine blastocysts during freezing, characterized in that: The pcDNA3.1(+) vector was used as the basic vector, and a fragment containing the coding frame of the porcine HSL gene was inserted; The nucleotide sequence of the porcine HSL gene coding frame is shown in SEQ ID NO.1; The nucleotide sequence of the fragment containing the pig HSL gene coding frame is shown in SEQ ID NO.

3.

2. Use of the vector according to claim 1 in preparing porcine HSL mRNA.

3. The use according to claim 2, characterized in that: The method for preparing porcine HSL mRNA is as follows: the vector described in claim 1 is digested by ScaI restriction endonuclease to obtain a linearized vector, and then the vector is used as a template to obtain HSL mRNA through an in vitro transcription experiment.

4. Use of the vector according to claim 1 or the porcine HSL mRNA according to claim 3 in improving the survival rate of porcine blastocysts during freezing.

5. A method for improving the survival rate of porcine blastocysts during freezing, characterized in that: Microinjection of the porcine HSL mRNA prepared according to claim 3.

6. A method for improving the survival rate of porcine blastocysts during freezing according to claim 5, characterized in that: The following steps are involved: (1) Collect porcine fertilized eggs and microinject porcine HSL mRNA; (2) Blastocyst freezing; (3) Blastocyst thawing; The microinjection method comprises collecting pig fertilized eggs, transferring them into pig embryo operation buffer, injecting 10 pL of pig HSL mRNA into the cytoplasm of the fertilized eggs using a microinjection needle, and then transferring them into a pig embryo in vitro culture PZM3 culture medium, culturing them at 38.5°C, 5% CO2, and saturated humidity until the 6th day, and collecting blastocysts for freezing; The blastocyst freezing method comprises the following steps: immersing the fertilized porcine blastocyst in a balancing solution for incubation for 2 minutes, then immersing the blastocyst in a freezing solution for incubation for 25-30 seconds, and placing the blastocyst at the front end of a Cryotop carrier with a minimum amount of liquid within the 25-30 seconds, and rapidly immersing the blastocyst in liquid nitrogen for blastocyst freezing; The blastocyst thawing method is to quickly take out the carrier straw containing the blastocyst from liquid nitrogen, expose it to the air for 3 seconds, and then immerse it in thawing solution I, thawing solution II, and basic solution in turn, incubate each for 5 minutes, and then transfer it to PZM3 culture solution containing 10% fetal bovine serum, and continue to culture for 18 hours under the conditions of 38.5°C, 5% CO2, and saturated humidity.

7. A method for improving the survival rate of porcine blastocysts during freezing according to claim 6, characterized in that: The concentration of the microinjected porcine HSL mRNA is 100-500 ng / μL.

8. A method for improving the survival rate of porcine blastocysts during freezing according to claim 6, characterized in that: The porcine embryo operation buffer solution is prepared as follows: 10 mL of NCSU23 solution, 0.004 g of sodium chloride, 0.100 g of glucose, 0.007 g of cysteine, 0.015 g of L-glutamine, 0.088 g of taurine, and 0.055 g of hypotaurine are dissolved in 100 mL of ultrapure water, and the pH is adjusted to 7.2-7.4, and the osmotic pressure is adjusted to 295-300 mOsm; The preparation method of the PZM3 culture medium for in vitro culture of pig embryos is as follows: 3.156g of sodium chloride, 1.053g of sodium bicarbonate, 0.373g of potassium chloride, 0.024g of potassium dihydrogen phosphate, 0.049g of magnesium sulfate heptahydrate, 0.308g of calcium lactate, 0.011g of sodium pyruvate, 0.073g of L-glutamine, 0.273g of hypotaurine, 10mL of 50×BME amino acid solution, 5mL of 100×MEM non-essential amino acid solution, 0.025g of gentamicin, 0.033g of penicillin, 0.025g of streptomycin and 1.500g of bovine serum albumin are added to 500mL of ultrapure water, the pH is adjusted to 7.2-7.4, and the osmotic pressure is adjusted to 295-300mOsm.

9. A method for improving the survival rate of porcine blastocysts during freezing according to claim 6, characterized in that: The specific liquid preparation involved in the blastocyst freezing and thawing method is as follows: The basal medium was prepared by adding 20% ​​fetal bovine serum to the M199 basal medium containing HEPES; Add 10% ethylene glycol and 10% dimethyl sulfoxide to the base solution to prepare a balanced solution; Add 20% ethylene glycol and 20% dimethyl sulfoxide to the base liquid to prepare a freezing liquid; Add 0.3 M sucrose to the base solution to prepare thawing solution I; 0.2 M sucrose was added to the base solution to prepare thawing solution II.

Images