Rice tillering regulation gene tr4 and the protein encoded thereby

By cloning the rice tillering regulation gene TR4 and using gene editing technology to regulate the number of rice tillers, the problem of insufficient rice tillering regulation in existing technologies has been solved, resulting in a significant increase in yield per plant.

CN119351419BActive Publication Date: 2026-06-19CHINA NAT RICE RES INST

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA NAT RICE RES INST
Filing Date
2024-12-05
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Current technologies have failed to effectively regulate the number of rice tillers, thus affecting yield improvement, and there is a lack of research on efficient tiller-regulating genes.

Method used

The rice tillering regulation gene TR4 was cloned and utilized. Knockout and overexpression vectors were constructed using gene editing technology to reduce or increase the number of rice tillers, respectively, thus verifying the gene function.

Benefits of technology

It significantly regulates the number of rice tillers, increases yield per plant, and provides a genetic basis for high-yield breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119351419B_ABST
    Figure CN119351419B_ABST
Patent Text Reader

Abstract

This invention relates to the field of plant genetic engineering, specifically to the rice tillering regulatory gene TR4, its encoded protein, and its applications. This invention discloses the application of gene TR4 in rice tillering regulation; the nucleotide sequence of gene TR4 is shown in Seq ID No: 1. Overexpression of TR4 promotes an increase in effective tillers and yield per unit area in rice. Knockout of TR4 leads to a decrease in the number of effective tillers in rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, specifically to the rice tillering regulatory gene TR4 and its encoded protein and applications. Background Technology

[0002] Rice is one of the most important food crops, with more than half of the world's population relying on it as their main food source. It is also one of the food crops that my country actively promotes, strongly supports, and has the largest planting area and yield. Since the 21st century, the area of ​​rice cultivation in my country has remained relatively stable, with an annual sowing area of ​​about 30 million hectares and an annual rice production of more than 200 million tons. Rice production has been relatively stable (Wu Yuanyuan. Current Status and Development Trend of Rice Production in my country [J]. New Agriculture, 2018(7):27-28). However, in recent years, due to the continuous increase in population, the reduction of arable land area, the frequent occurrence of extreme weather, and the slow growth of crop yields, the yields of corn, rice, wheat and soybeans in about 24-39% of the global planting areas have stagnated or even declined. Therefore, high yield is still the goal that agricultural production has been pursuing (Wei S, Li X, Lu Z, Zhang H, Ye X, Zhou Y, Li J, Yan Y, Pei H, Duan F, Wang D, Chen S, Wang P, Zhang C, Shang L, Zhou Y, Yan P, Zhao M, Huang J, Bock R, Qian Q, Zhou W. A transcriptional regulator that boosts grain yields and shortens the growth duration of rice. Science, 2022, 377(6604): eabi8455).

[0003] Rice yield is determined by a variety of factors, including the number of effective tillers, the number of grains per panicle, and grain weight. Among these, the number of effective tillers is generally considered a key factor affecting rice yield. The tillering stage is an important stage in the growth and development of rice, and it has a significant impact on the yield and quality of rice. Tillering refers to the development of new stems from axillary buds at the base of the rice main stem under suitable environmental conditions, thus forming multiple branches. The occurrence of rice tillering is a very complex process, and factors such as natural conditions, plant nutrition, plant hormones, and genetics can all affect its occurrence (Liu Yang, Wang Qiangsheng, Ding Yanfeng, Wang Shaohua. Research progress on the mechanism of rice tillering [J]. Chinese Agricultural Science Bulletin, 2011, 27(3):5). In-depth research on the mechanism of rice tillering and more effectively regulating tillering will further improve rice yield and is of great significance to rice production.

[0004] Currently, some progress has been made in the research on tillering-related QTL localization, gene cloning, and molecular regulatory mechanisms. MOC1 encodes a GRAS family protein located in the nucleus, which controls the formation of leaf axillary meristems during both vegetative and reproductive growth stages. This is the first key gene controlling tillering to be cloned in rice (Li X, Qian Q, Fu Z, Wang Y, Xiong G, Zeng D, Wang X, Liu X, Teng S, Hiroshi F, Yuan M, Luo D, Han B, Li J. Control of tillering in rice. Nature, 2003, 422(6932):618-621). Genes controlling tiller shoot growth mainly include those involved in strigolactone biosynthesis and signaling pathways. For example, the HTD1 gene, which encodes carotenoid lyase dioxygenase CCD7, inhibits tillering and negatively regulates the number of tillers in rice (Wang Y, Shang L, Yu H, Zeng L, Hu J, Ni S, Rao Y, Li S, Chu J, Meng X, Wang L, Hu P, Yan J, Kang S, Qu M, Lin H, Wang T, Wang Q, Hu X, Chen H, Wang B, Gao Z, Guo L, Zeng D, Zhu X, Xiong G, Li J, Qian Q. Astrigolactone Biosynthesis Gene Contributed to the Green Revolution in Rice. Molecular Plant, 2020, 13(6): 923-932).D14 and D53 are two key components in the strigolactone signaling process in rice. D14 is the strigolactone receptor, sensing strigolactone and triggering the ubiquitination of D53 by the D14-SCF ubiquitin ligase. Subsequently, the D53 protein is degraded by the 26S proteasome, inducing the transmission of strigolactone signaling and various downstream reactions, thereby regulating the number of tillers in rice. (Zhou F, Lin Q, Zhu L, Ren Y, Zhou K, Shabek N, Wu F, Mao H, Dong W, Gan L, Ma W, Gao H, Chen J, Yang C, Wang D, Tan J, Zhang X, Guo X, Wang J, Jiang L, Liu X, Chen W, Chu J, Yan C, Ueno K, Ito S, Asami T, Cheng Z, Wang J, Lei C, Zhai H, Wu C, Wang H, Zheng N, Wan) J. D14-SCF(D3)-dependent degradation of D53 regulates strigolactone signalling. Nature, 2013, 504(7480):406-410. Discovering genes regulating rice tillering is beneficial for elucidating the genetic basis of rice tillering and enriching rice gene resources, providing a theoretical foundation for high-yield breeding.

[0005] The invention "Application of Positive Regulation of OsNRT2-P2 Gene in Improving Crop Yield" (202411133265.9) states that overexpression of the OsNRT2-P2 gene can significantly increase the aboveground plant height and biomass of rice, with overall growth significantly better than wild type, and rice yield will also be significantly increased; it can also increase the protein content and nitrogen use efficiency of crop fruits or seeds. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide the application of the rice tillering regulatory gene TR4 and its encoded protein.

[0007] To solve the above-mentioned technical problems, the present invention provides a rice tillering regulatory gene TR4 (OsNAR2.2), the nucleotide sequence of which is shown in Seq ID No: 1 (9311).

[0008] As an improvement to the rice tillering regulation gene TR4 of the present invention: the cDNA nucleotide sequence of gene TR4 is shown in Seq ID No: 2 (9311) and Seq ID No: 3 (Peiai 64S).

[0009] The present invention also provides the protein encoded by the above-mentioned gene TR4, the amino acid sequence of which is shown in Seq ID No: 4 (9311).

[0010] The present invention also provides a knockout vector pYLCRISPR / Cas9-MH-TR4 containing the above-mentioned gene TR4: obtained by inserting the editing target sequence (i.e., SeqID No: 7) located in the exon of gene TR4 between the BsaI-BsaI restriction sites of the base vector using pYLCRISPR / Cas9-MH as the base vector.

[0011] The present invention also provides an overexpression vector containing the above-mentioned gene TR4, which is obtained by inserting the coding sequence (CDS) (Seq ID No: 2) of the 9311 gene TR4 between the SacI restriction sites of the base vector, using pCAMBIA1300-UBi as the base vector.

[0012] The present invention also provides a host cell containing the above-mentioned genes, wherein the host cell is an Escherichia coli cell or an Agrobacterium cell.

[0013] This invention also provides the use of the TR4 gene: overexpression of TR4 promotes increased effective tillering in rice and increases yield per unit area.

[0014] An improvement to the use of the gene TR4 of the present invention: a knockout vector or an overexpression vector is transformed into monocotyledonous plant (e.g., rice) cells, and the transformed monocotyledonous plant cells are then cultured into plants.

[0015] This invention also provides a method for regulating rice tillering:

[0016] Transforming rice cells with the knockout vector pYLCRISPR / Cas9-MH-TR4 yielded knockout mutants, resulting in a reduced number of effective tillers in the rice.

[0017] Transforming rice cells with the overexpression vector pCAMBIA1300-UBi-TR4 resulted in an increase in the number of effective tillers in the rice.

[0018] The technical solution provided by this invention is as follows:

[0019] The rice tillering regulatory gene TR4 of this invention has the sequences shown in (a) and (b):

[0020] (a) Genomic nucleotide sequence shown in Seq ID No: 1;

[0021] (b) The nucleotide sequences of 9311 and Pei'ai 64S cDNA shown in Seq ID No: 2 and Seq ID No: 3;

[0022] The 9311 genomic nucleotide sequence shown in Seq ID No: 1 contains 998 nucleotides (including the terminator TGA), the 9311 cDNA sequence shown in Seq ID No: 2 contains 633 nucleotides (including the terminator TGA), and the PA64S cDNA sequence shown in Seq ID No: 3 contains 633 nucleotides (including the terminator TGA). Three single nucleotide polymorphisms (SNPs) are present in Seq ID No: 2 and Seq ID No: 3.

[0023] Another object of the present invention is to provide a protein encoded by the above-mentioned gene having the sequence shown in (A):

[0024] (A) The amino acid sequence (9311) shown in Seq ID No: 4;

[0025] The protein represented by Seq ID No:4 is a tillering regulatory protein with 210 amino acids.

[0026] The present invention also aims to provide a knockout and overexpression vector containing the above-mentioned rice tillering regulatory gene TR4, wherein the knockout vector is... Figure 4 As shown in Figure A, pYLCRISPR / Cas9-MH-TR4, TR4-KO1 underwent gene editing with an insertion mutation, resulting in a frameshift of the TR4 protein sequence starting from position 109, as shown in Seq ID No: 5; TR4-KO2 underwent gene editing with a two-base deletion mutation, resulting in a frameshift of the TR4 protein sequence starting from position 109, as shown in Seq ID No: 6; the overexpression vector is... Figure 4 As shown in B, the pCAMBIA1300-UBi-TR4 vector can enhance TR4 expression. The present invention also aims to provide a host cell containing the aforementioned rice gene TR4, wherein the host cell is an *E. coli* cell, an *Agrobacterium* cell, or a plant cell.

[0027] The present invention also includes the use of the above-mentioned rice tillering regulatory gene TR4 to regulate the number of rice tillers, including transforming rice cells with a knockout and overexpression vector constructed with a gene having the nucleotide sequence shown in the above-mentioned rice tillering regulatory gene TR4, and then cultivating the transformed rice cells into plants.

[0028] The aforementioned rice tillering regulatory gene TR4 can be used to regulate the number of rice tillers and increase rice yield per unit area.

[0029] The specific technical steps for implementing this invention are as follows:

[0030] I. Screening and Identification of Candidate Genes

[0031] This invention discovered a significant difference in the effective tiller number between the two parents, 9311 and Pei'ai 64S, in a rice recombinant inbred line (RIL) population. Figure 1 A and B). The effective tiller number in rice exhibits a continuous normal distribution in the RIL population, indicating that it is a quantitative heritable trait and can be analyzed using QTL. The constructed rice high-density SNP map of the RIL population (Gao ZY, Zhao SC, He WM, Guo LB, Peng YL, Wang JJ, Guo XS, Zhang XM, Rao YC, Zhang C, Dong GJ, Zheng FY, Lu CX, Hu J, Zhou Q, Liu HJ, Wu HY, Xu J, Ni PX, Zeng DL, Liu DH, Tian P,Gong LH,Ye C,Zhang GH,Wang J,Tian FK,Xue DW,Liao Y,Zhu L,Chen MS,Li JY,Cheng SH,Zhang GY,Wang J,Qian Q.Dissecting yield-associated lociin super hybrid rice byresequencing recombinant inbred lines and improving parental genomesequences.Proceedings of the National Academy of Sciences QTL mapping analysis was performed on the rice chromosome 4 in USA, 2013, 110(35):14492-14497. The results showed that there was a major QTL with an LOD value of 2.92, located between markers SNP4-271 and SNP4-290.

[0032] To precisely locate this major QTL, this invention constructed a BC4F2 population with 9311 and Pei'ai 64S as parents, and analyzed the sequence between the two molecular markers SNP4-271 and SNP4-290, developing new molecular markers. Ultimately, the major QTL was precisely located within a physical distance of approximately 43.5 kb between the insertion / deletion (InDel) markers INDEL4-3 and INDEL4-4. Figure 2 By analyzing the open reading frame (ORF) of this region, the candidate gene TR4 was inferred. Figure 3 ).

[0033] II. Identification and Functional Analysis of the TR4 Gene

[0034] Using transgenic technology, this invention obtained gene knockout and overexpression plants of the TR4 gene. Figure 4 The effective tiller number was statistically determined by this invention to obtain rice plants with changes in the effective tiller number. Knockout plants showed a significant decrease in the effective tiller number, resulting in a decline in yield per plant; overexpression plants showed a significant increase in the effective tiller number, thereby increasing yield per plant. Figure 5 This result confirms the existence of the tillering regulatory gene TR4 cloned in this invention.

[0035] This invention employs map-based cloning technology, utilizing the BC4F2 populations of Pei'ai 64S and 9311 for further localization, along with gene annotation and sequencing, to identify the tillering regulatory gene TR4. The gene function was then confirmed through transgenic knockout and overexpression experiments. The cloning and application of the TR4 gene provides valuable genetic resources for breeding high-yielding varieties.

[0036] It should be emphasized that currently, only the sequences described in Seq ID No: 1 to Seq ID No: 4 are publicly available on NCBI. Previous gene family analyses have found that they predict the encoding of a nitrate transporter chaperone protein (Xu N, Yu B, Chen R, Li S, Zhang G, Huang J. OsNAR2.2 plays a vital role in the root growth and development by promoting nitrate uptake and signaling in rice. Plant Physiology and Biochemistry, 2020, 149: 159-169), but there are no reports on this gene regulating rice tillering.

[0037] Most of the known genes related to rice tillering regulation are involved in strigolactone biosynthesis and signaling pathways (Takai T. Potential of rice tillering for sustainable food production. Journal of Experimental Botany, 2024, 75(3):708-720). However, the rice tillering regulation gene TR4 of this invention is involved in the nitrate metabolism pathway.

[0038] In summary, existing technologies cannot provide technical inspiration for this invention. The research on the regulation of rice tillering by the TR4 gene of this invention can provide an important foundation for the breeding of high-yield varieties. Attached Figure Description

[0039] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0040] Figure 1(A) is the phenotype of rice varieties 9311 and Pei'ai 64S plants, and the scale bar is 20 cm; (B) is the comparison of the effective tiller numbers of 9311 and Pei'ai 64S. * indicates that there is a highly significant difference in the t-test at the 0.01 < P < 0.05 level.

[0041] Figure 2 It is the fine mapping map of the TR4 gene.

[0042] Figure 3 It is the difference of the CDS of the TR4 gene between 9311 and Pei'ai 64S.

[0043] Figure 4 They are vector diagrams, transgenic molecular identification, and plant phenotypes; Figure 4 Among them: (A) pYLCRISPR / Cas9-MH-TR4 knockout vector; (B) pCAMBIA1300-UBi-TR4 overexpression vector; (C) sequencing sequences near the editing sites of wild-type Nipponbare and the TR4 gene knockout lines; (D) relative expression levels of the transcription levels of the TR4 gene in Nipponbare and knockout lines (TR4-KO1, TR4-KO2). (E) Relative expression levels of the transcription levels of the TR4 gene in Nipponbare and overexpression lines (TR4-OE1, TR4-OE2). The values represent the mean and standard deviation of three biological replicates; ** indicates that there is a highly significant difference in the t-test at the 0.001 < P < 0.01 level.

[0044] Figure 5 They are the comparisons of the mature plant phenotypes (A), effective tiller numbers (B), and per-plant yields (C) of Nipponbare, the TR4 gene knockout mutants (TR4-KO1, TR4-KO2), and overexpression plants (TR4-OE1, TR4-OE2). The scale bar is 20 cm; the values represent the mean and standard deviation of three biological replicates; a, b, c indicate that there is a significant difference in the t-test at the P < 0.05 level. Detailed implementation manners

[0045] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0046] Example 1: QTL mapping and candidate gene determination

[0047] 1. Rice materials

[0048] The indica rice varieties are (Oryza sativa L. indica) "9311" and "Pei'ai 64S". A recombinant inbred line (RIL) population was constructed with 9311 and Pei'ai 64S as parents, and a BC4F2 segregation population obtained after backcrossing and selfing of Pei'ai 64S and �311.

[0049] 2. Location of effective tiller number QTL qTR4

[0050] Preliminary localization of qTR4: This invention found a significant difference in the effective tiller number between the two parents, 9311 and Pei'ai 64S, in the rice RIL population. Figure 1 A, B). A RIL population consisting of 131 lines of 9311 and Pei'ai 64S was used as the QTL mapping population. Based on the published high-resolution genetic map of indica rice 9311 and Pei'ai 64S, QTL mapping analysis revealed a major-effect QTL for tiller regulation, qTR4, between markers SNP4-271 and SNP4-290 on rice chromosome 4. Figure 2 A), with a LOD value of 2.92.

[0051] Fine mapping of qCR4: Using the BC4F2 population, which was a result of backcrossing and self-crossing Pei'ai 64S and 9311, as the fine mapping population, the sequence between the two markers SNP4-271 and SNP4-290 was analyzed. Based on the sequences of indica rice 9311 and Pei'ai 64S, six InDel markers were developed (as shown in Table 1). Finally, the major QTL was precisely located within a physical distance of approximately 43.5 kb between markers INDEL4-3 and INDEL4-4. Figure 2 B, C).

[0052] Table 1. Molecular markers developed for fine-targeting

[0053]

[0054] *F: forward primer; R: reverse primer.

[0055] 3. Gene prediction and comparative analysis:

[0056] Screening for annotated genes related to tillering within a 43.5 kb region revealed a gene, OsNAR2.2, predicted to encode a nitrate transporter chaperone protein. Because it is located on chromosome 4, it was named TR4 (Tillering Regulation 4). Figure 2 C). Comparison of genomic DNA and cDNA (sequences such as Seq ID No: 1 and Seq ID No: 2) shows that the gene contains 1 intron and 2 exons. Comparison with the whole genome sequence of 9311 reveals that the gene is a single copy.

[0057] This invention designed sequencing primers for this gene and used PCR to amplify the TR4 gene from the genomes of 9311 and Peiai 64S for sequencing analysis. Sequence alignment revealed that the coding regions of 9311 and Peiai 64S contain a total of 3 SNPs, one of which causes an amino acid change, specifically alanine in 9311. 605In 64S, it is valine. 605 ( Figure 3 This differential site may lead to changes in protein function, and this TR4 gene is highly likely to be a candidate gene for qTR4.

[0058] Example 2: Plant Transformation and Functional Analysis

[0059] I. Obtaining TR4 gene knockout mutants

[0060] 1. TR4 was knocked out using the pYLCRISPR / Cas9-MH gene editing vector (provided by Professor Liu Yaoguang's research group at South China Agricultural University). The sequence CGACGACCTGAGCAAGGACA in the CDS region of the TR4 gene was selected as the editing target site (i.e., the editing target sequence located in exon 2 of the TR4 gene). Figure 4 C). The primer sequences for vector construction are as follows:

[0061] TR4-sgRNA-F: TGCATGTCCTGCTCAGGTCGTCG

[0062] TR4-sgRNA-R: AAACCGACGACCTGAGCAAGGACA

[0063] FR-F: CTCCGTTTTACCTGTGGAATCG

[0064] FR-R: CGGAGGAAAATTCCATCCAC

[0065] B1-F:TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG

[0066] B1-R: GCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC

[0067] SP1: CCCGACATAGATGCAATAACTTC

[0068] SP2: GGCCGGTGTCATCTATGTTACT

[0069] The concentration of all the above primers was 10 μM.

[0070] 2. TR4 gene knockout vector construction steps:

[0071] Preparation of target adapters: Take 10 μl of each of the TR4-sgRNA-F and TR4-sgRNA-R primers and put them into 80 μl of water. Incubate at 94°C for 1 minute and cool to room temperature to form primer dimers.

[0072] sgRNA expression cassette preparation reaction system: 1 μl pYLgRNA-U3 plasmid (provided by Professor Liu Yaoguang's research group at South China Agricultural University); 1 μl target adapter; 0.5 μl restriction endonuclease BsaI (NEB); 0.5 μl T4 ligase (NEB); 1 μl T4 buffer; 6 μl ddH2O.

[0073] sgRNA expression cassette preparation reaction procedure: (1) 37℃, 5 minutes; (2) 20℃, 5 minutes; repeat steps (1)-(2) for 7 cycles.

[0074] The first round of sgRNA expression cassette PCR reaction system consisted of: 25 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl sgRNA expression cassette; 1 μl each of primers FR-F and FR-R; and 21 μl ddH2O.

[0075] The first round of amplification program is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 60℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 25 cycles.

[0076] The second-round amplification sgRNA expression cassette PCR reaction system consisted of: 25 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl of the first-round amplification product; 1 μl each of primers B1-F and B1-R; and 21 μl ddH2O.

[0077] The second round of amplification procedure is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 60℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 25 cycles.

[0078] The sgRNA and pYLCRISPR / Cas9-MH gene editing vector were digested with restriction endonuclease BsaI at a temperature of 37℃ for 15 minutes. The digestion reaction system consisted of: 1 μl of the second-round amplified sgRNA expression cassette; 1 μl of pYLCRISPR / Cas9-MH plasmid; 0.5 μl of restriction endonuclease BsaI (NEB); and 12.5 μl of ddH2O.

[0079] Add 0.5 μl of T4 ligase and 1.7 μl of T4 buffer to the product and perform ligation and digestion reaction simultaneously. The reaction program is as follows: (1) 37℃, 5 minutes; (2) 10℃, 5 minutes; (3) 20℃, 5 minutes; (4) 12℃, hold; repeat steps (1)-(3) for 20 cycles.

[0080] The above reaction products were transformed into E. coli cells, and the transformed single colonies were identified by PCR. The reaction system was as follows: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); single colonies picked; 0.2 μl each of primers SP1 and SP2; 4.6 μl ddH2O.

[0081] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 95℃, 15 seconds; (3) 60℃, 15 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.

[0082] Single colonies containing the TR4 gene-specific target sequence (i.e., Seq ID No: 7) were screened using primer SP2 sequencing, and the plasmid extracted was the desired recombinant knockout vector pYLCRISPR / Cas9-MH-TR4.

[0083] 3. The pYLCRISPR / Cas9-MH-TR4 gene with the TR4-specific target site was transformed into the rice variety Nipponbare. The sequences at both ends of the target site were amplified using knockout identification primers and then sequenced for identification.

[0084] The knockout identification primer sequences are as follows:

[0085] TR4-CRISPR-F1:ATGGCTCGGTTTGGGGCGG

[0086] TR4-CRISPR-R1:TCTTCTTCTTGTTCTCGAGGAC

[0087] PCR reaction system for identifying mutant transgenic plants: 5 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl DNA from transgenic plant leaves; 0.2 μl each of primers TR4-CRISPR-F1 and TR4-CRISPR-R1; 2.6 μl lddH2O.

[0088] The amplification program is as follows: (1) 94℃, 4 minutes; (2) 98℃, 30 seconds; (3) 60℃, 30 seconds; (4) 68℃, 60 seconds; (5) 68℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.

[0089] TR4 gene knockout mutants were obtained by comparison with Seq ID No:1. The obtained gene knockout mutants TR4-KO1 and TR4-KO2 carried insertion and deletion mutations, respectively. Figure 4C) The amino acid sequences of the gene knockout mutants are shown in Seq ID No: 5 and Seq ID No: 6. Using the pYLCRISPR / Cas9 vector identification primers, plants without the Cas9 tag in the progeny were screened to obtain stably inherited rice TR4-KO1 and TR4-KO2 mutant plants.

[0090] PCR reaction system for identifying Cas9 tags in mutant transgenic plants: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); 2 μl DNA from transgenic plant leaves; 0.2 μl each of primers Cas9-F and Cas9-R; 2.6 μl ddH2O.

[0091] The primer sequences for Cas9 tag amplification are as follows:

[0092] Cas9-F: ACCAGACACGAGACGACTAA

[0093] Cas9-R: ATCGGTGCGGGCCTCTTC

[0094] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 95℃, 15 seconds; (3) 60℃, 15 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.

[0095] When the amplification result shows that the positive control has the Cas9 tag but the identification sample does not, it is a stable genetic mutant rice, and the offspring do not contain the Cas9 tag.

[0096] II. Obtaining TR4 gene overexpression lines

[0097] The CDS sequence (Seq ID No: 2) of the TR4 gene from 9311 was amplified and ligated between the SacI restriction sites of the vector pCAMBIA1300-UBi (provided by Aibiwei Biotechnology Co., Ltd.) to obtain the pCAMBIA1300-UBi-TR4 fusion expression vector. Figure 4 B). The correctly sequenced plasmid was transformed into the rice variety Nipponbare, and two overexpression transgenic lines were obtained by quantitative expression detection. Figure 4 E). The primer sequences involved are as follows:

[0098] TR4-OVER-F: TGTTACTTCTGCAGGAGCTCATGGCTCGGTTTGGGGCG

[0099] TR4-OVER-R: CTCACCATGGATCCGGTACCCTTGTTCTTCTTCTTGTTCTCGAGG

[0100] TR4-F: ATGGCTCGGTTTGGGGCG

[0101] GFP-R: CTTCATGTGGTCGGGGTAGC

[0102] PCR reaction system for amplifying the CDS sequence of the TR4 gene: 25 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl cDNA obtained by reverse transcription of total RNA from the 9311 aerial parts; 1 μl each of primers TR4-OVER-F and TR4-OVER-R; 21 μl ddH2O.

[0103] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 58℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.

[0104] PCR reaction system for identifying overexpressing transgenic plants: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); 2 μl DNA from transgenic plant leaves; 0.2 μl each of primers TR4-F and GFP-R; 2.6 μl ddH2O.

[0105] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 95℃, 15 seconds; (3) 58℃, 15 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.

[0106] III. Determination of TR4 gene expression levels in TR4 gene knockout mutants and overexpression lines

[0107] Sequencing revealed that gene editing in the knockout transgenic lines resulted in base insertion and deletion mutations. Figure 4 C). Compared to the wild type, the transcriptional expression level of the TR4 gene was significantly decreased in the knockout plants. Figure 4 D), the transcriptional expression level of the TR4 gene was significantly increased in overexpressing plants. Figure 4 E).

[0108] IV. Investigation of effective tiller number and yield per plant in TR4 gene knockout mutants and overexpression lines

[0109] The effective tiller number and yield per plant at maturity were determined in the TR4 gene knockout mutant and overexpression lines in the Hangzhou Fuyang transgenic nursery. Figure 5 A). The results showed that the effective tiller number of the TR4 gene knockout mutant was significantly reduced compared to the control Nipponbare. Figure 5B), the yield per plant decreased significantly ( Figure 5 C); The effective tiller number of TR4 gene overexpression lines was significantly increased compared with the control Nipponbare. Figure 5 B), the yield per plant increased significantly ( Figure 5 C). This indicates that the TR4 gene can regulate rice tillering and yield.

[0110] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. gene TR4 In the application of regulating tillering in rice, characterized in that: Gene TR4 The nucleotide sequence is shown in Seq IDNo: 2; overexpression TR4 It promotes the increase of effective tillering in rice, thus increasing yield per unit area.

2. A method for regulating tillering in rice, characterized by: Genes TR4 The corresponding overexpression vector was used to transform rice cells, and the transformed rice cells were then cultured into plants; the resulting rice showed an increased number of effective tillers; the gene... TR4 The nucleotide sequence is shown in Seq ID No:

2.

3. The method for regulating rice tillering according to claim 2, characterized in that: The overexpression vector is pCAMBIA1300-UBi- TR4 .