New application of akebia quinata phenylethanoid glycoside B in preparation of MMP12 inhibitor

Abstract

The invention relates to application of akebia quinata phenylethanoid glycoside B taking MMP12 as a target spot in preparation of a medicine for treating liver cancer, discovers that the akebia quinata phenylethanoid glycoside B can inhibit M2-type polarization of macrophages in liver cancer tumors, and further, the akebia quinata phenylethanoid glycoside B can be combined with the MMP12 and inhibit protease activity of the MMP12. The invention discloses the effectiveness of the akebiaquinata phenylethanoid glycoside B in the aspect of treating the liver cancer, and further defines the key effect of the akebiaquinata phenylethanoid glycoside B on inhibiting the activity of MMP12 protease, the research result proves the potential of the akebiaquinata phenylethanoid glycoside B as a liver cancer treatment drug, and a candidate drug is provided for research and development of a new liver cancer drug.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to a new use of akebia phenylethanoid glycoside B as a preparation of a matrix metalloproteinase 12 (MMP12) inhibitor. Background Art

[0002] Matrix Metalloproteinases (MMPs), also known as matrix metallopeptidases or matrixins, are a class of zinc-dependent proteolytic enzymes that are involved in the degradation and remodeling of the extracellular matrix (ECM). Among the many members of the MMP family, MMP12 was originally identified as an elastase secreted by inflammatory macrophages, and is therefore also known as macrophage elastase. In addition to its elastase activity, MMP12 is also able to degrade a wide range of other extracellular matrix components, including type IV collagen, fibronectin, fibrillin-1, laminin, vitronectin, chondroitin sulfate, and heparin sulfate proteoglycans. Therefore, MMP12 degrades the basement membrane, allowing macrophages to penetrate damaged tissues during inflammation. Clinical and experimental studies have shown that MMP12 plays an important role in a variety of inflammatory diseases and certain types of cancer, and is closely related to the pathogenesis of these diseases. For example, in the pathological processes of chronic obstructive pulmonary disease (COPD), asthma, pulmonary fibrosis, skin diseases, arthritis, atherosclerosis, central nervous system diseases, and various tumors, overexpression of MMP12 is often accompanied by tissue destruction and increased inflammatory response, becoming a key factor in disease progression.

[0003] MMP12 consists of three different domains: an amino-terminal propeptide domain that is involved in maintaining the latent state of the zymogen; a catalytic domain that binds zinc and calcium ions; and a heme-like domain at the carboxyl terminus that determines substrate specificity. MMP12 is secreted as a 54 kDa zymogen, which is activated after a series of autolytic processes to form a 45 kDa N-terminal active form, which is processed into a mature 22 kDa active form. In addition to autolytic processing, MMP12 can also activate other MMPs, such as pro-MMP2 and pro-MMP3, which in turn can activate pro-MMP1 and pro-MMP9, which may be the potential reason why MMP12 exacerbates the proteolytic cascade, leading to the degradation of multiple extracellular matrix proteins.

[0004] Tumor immune microenvironment (TIME) plays a vital role in the occurrence, development, metastasis and response to treatment of tumors. Tumor-associated macrophages (TAMs), as an important component of TIME, are key factors affecting tumor progression. In the tumor immune microenvironment, MMP12 is closely related to TAMs. MMP12 is usually highly expressed by M2 macrophages. By degrading extracellular matrix components and regulating the expression of related cytokines, it can further promote the infiltration of TAMs, leading to tumor invasion and metastasis as well as angiogenesis. At present, there are few specific inhibitors for MMP12. Finding new, safe and effective MMP12 inhibitors is expected to provide important application prospects and help for the treatment of related diseases including tumors. Summary of the invention

[0005] In view of the important role played by MMP12 in various inflammatory diseases and related types of cancers, and the fact that there are currently few specific inhibitors of MMP12, the present invention provides a new use of Calceolarioside B (Cal-B) as a preparation of MMP12 inhibitors.

[0006] In order to achieve the above-mentioned purpose, the technical solution provided by the present invention is: Akebia trifoliata phenylethanoid glycoside B is used as a new use for preparing MMP12 inhibitors, and Akebia trifoliata phenylethanoid glycoside B inhibits the M2 polarization of tumor macrophages.

[0007] Cell experiments have confirmed that akebia phenylethanol glycoside B can inhibit the migration-promoting effect of Raw264.7 cells on Hepa1-6 cells, and can also inhibit the migration-promoting effect of THP-1 cells on HepG2 cells.

[0008] Furthermore, akebia phenylethanoid glycoside B binds to MMP12 and inhibits the protease activity of MMP12. Specifically, akebia phenylethanoid glycoside B can form hydrogen bonds with G179, A184, P238 and Y240 in MMP12, and form carbon-hydrogen bonds with T215 and F237.

[0009] Furthermore, the tumor is specifically selected from a liver cancer model.

[0010] The beneficial effects of the present invention are that the present invention reveals the effectiveness of akebia phenylethanoid glycoside B in treating liver cancer diseases, finds that akebia phenylethanoid glycoside B can inhibit the M2 polarization of tumor-associated macrophages in a liver cancer model, and further clarifies the key role of akebia phenylethanoid glycoside B in inhibiting the activity of MMP12 protease, providing candidate drugs and scientific basis for the research and development of new drugs for liver cancer, and promoting the clinical application of anti-cancer traditional Chinese medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Cal-B inhibited the polarization of macrophages to M2 in the macrophage-hepatoma cell co-culture system. Figure 1 A is a macrophage-hepatoma cell co-culture model. Figure 1 B is the polarization of macrophages M1 (CD86) and M2 (CD206) detected by flow cytometry. Figure 1 C is the mRNA expression of M2 macrophage-related markers (ARG1, IL10, TGFB1) detected by qPCR. Figure 1 D is the expression and secretion of M2 macrophage-related markers (IL10, TGFB1) detected by ELISA. Raw264.7, mouse monocytic macrophage leukemia cells; Hepa1-6, mouse liver cancer cells; THP-1, human monocytic leukemia cells; HepG2, human liver cancer cells; compared with the control group, *, P<0.05; **, P<0.01; ns, no significant difference.

[0012] Figure 2 Cal-B inhibited the chemotactic migration of macrophages toward liver cancer cells. Figure 2 A is a Transwell co-culture model of macrophages chemotactic migration toward liver cancer cells. Figure 2 B. Representative images of chemotactic migrating macrophages on the left and statistical graphs of chemotactic migrating macrophages on the right. Cal-B, 10 μM; **, P < 0.01; ***, P < 0.001.

[0013] Figure 3 Cal-B inhibited the effect of M2 macrophages in promoting the migration of liver cancer cells. Figure 3 A is a Transwell co-culture model of macrophages promoting liver cancer cell migration; Figure 3 B. The left side shows a representative picture of migrating liver cancer cells, and the right side shows a statistical chart of the number of migrating liver cancer cells. Cal-B, 10 μM; **, P<0.01; ***, P<0.001.

[0014] Figure 4The binding site of Cal-B and MMP12 (1jk3) was predicted for molecular docking. The black dotted area on the left is enlarged to show the black dotted area in the middle, and the 2D image of the binding area of ​​Cal-B and MMP12 on the right shows its binding site and the type of intermolecular force.

[0015] Figure 5 The cell thermal shift assay (CETSA) was used to detect the potential binding effect of Cal-B on MMP12. Figure 5 A is the effect of Cal-B on the thermal stability of MMP12 in Raw264.7 cells detected by Western blot technology; Figure 5 B is the effect of Cal-B on the thermal stability of MMP12 in THP-1 cells detected by Western blot. ***, P<0.001.

[0016] Figure 6 To couple Cal-B to magnetic beads and detect the binding of Cal-B to MMP12. Figure 6 A is Coomassie brilliant blue staining showing the protein expression of each group of protein lysate; Figure 6 B is the expression of MMP12 in the protein lysate of each group detected by Western blot technology. Negative, magnetic bead control group; Block, drug blocking-drug magnetic bead group; Cal-B, Cal-B coupled magnetic bead group; Cell lysis, whole cell protein lysate; Pull-down, magnetic bead pull-down protein lysate; Input, input original protein lysate.

[0017] Figure 7 Surface plasmon resonance (SPR) technology was used to detect the affinity of Cal-B to MMP12. Figure 7 A is the kinetic test result; Figure 7 B is the result of steady-state affinity test.

[0018] Figure 8 The MMP12 fluorescent peptide substrate Mca-PLGLEEA-Dap(Dnp)-NH2 was used to detect the inhibitory effect of Akebia phenylethanoid glycoside B (Cal-B) on MMP12 enzyme activity. Figure 8 A is the detection of MMP12 enzyme activity in the supernatant of THP-1 cell culture fluid by Cal-B; Figure 8 B is the detection of recombinant human MMP12 enzyme activity by Cal-B; Figure 8C is the half inhibitory concentration of Cal-B for inhibiting MMP12 enzyme activity. CS, cell culture supernatant; rh-MMP12, human recombinant MMP12 protein.

[0019] Fig. 9 Cal-B inhibits the effect of MMP12 on the polarization and migration of M2 macrophages. Fig. 9 A is the polarization of M2 type (CD206) detected by flow cytometry; Fig. 9 B is the mRNA expression of M2 macrophage-related markers (ARG1, IL10, TGFB1) detected by qPCR; Fig. 9 C is the Transwell model of macrophage chemotaxis and migration; Fig. 9 D. The left side shows a representative picture of chemotactic migrating macrophages, and the right side shows a statistical chart of the number of chemotactic migrating macrophages. rh-MMP12, human recombinant MMP12 protein; ***, P<0.001. DETAILED DESCRIPTION

[0020] The present invention is further illustrated by the following examples, but any example or combination thereof should not be construed as limiting the scope or implementation of the present invention.

[0021] Example 1: Akebia phenylethanoid glycoside B provided by the present invention is used as a new use for preparing MMP12 inhibitors, and Akebia phenylethanoid glycoside B inhibits the polarization of M2-type tumor-associated macrophages in a liver cancer model. The specific experimental contents are as follows: 1. Experimental results: 1. Akebia trifoliata phenylethanoid glycoside B inhibits the polarization of tumor-associated macrophages to M2 type in the liver cancer model.

[0022] In order to determine the effect of oxadiazine phenylethanol glycoside B on the polarization of tumor-associated macrophages, we used a macrophage-hepatoma cell co-culture model. According to the cell species classification, mouse hepatoma cell line Hepa1-6 and mouse monocytic macrophage leukemia cell line Raw264.7 were co-cultured; human hepatoma cell line HepG2 and human monocytic leukemia cell line THP-1 were co-cultured. THP-1 cells need to be stimulated with a final concentration of 50ng / mL phorbol ester (PMA) for 24 hours to induce differentiation into macrophages. Figure 1 As shown in A, macrophage cell lines (1×10 6 ) were plated in 6-well plates for 12 hours, and the culture medium was replaced with liver cancer cell culture supernatant. Cal-B (0μM, 1μM, 10μM) was added to the culture medium for 24 hours. After 24 hours, macrophages were collected for flow cytometry and qPCR detection, and culture supernatant was collected for ELISA detection.

[0023] like Figure 1As shown in B, flow cytometry was used to detect the expression of macrophage markers (CD86, CD206). In the Raw264.7 cell line, compared with the Ctrl group, different concentrations of Cal-B had no significant effect on the expression of M1 marker CD86, but could inhibit the expression of M2 marker CD206; in the THP-1 cell line, compared with the Ctrl group, different concentrations of Cal-B had no significant effect on the expression of CD86, but could inhibit the expression of CD206. In addition, we used qPCR ( Figure 1 C) and ELISA ( Figure 1 D) M2 macrophage markers were detected, and it was found that Cal-B (10 μM) could significantly inhibit the expression of related marker genes and protein secretion. This indicates that in the co-culture system of the two species, oxadiazole glycoside B can inhibit the polarization of tumor-associated macrophages to M2 type.

[0024] 2. Akebia phenylethanoid glycoside B inhibits the chemotactic migration of macrophages toward liver cancer cells.

[0025] To further simulate the characteristics of tumor-associated macrophages in the tumor microenvironment, we used a Transwell co-culture model in which macrophages migrate chemotactically toward liver cancer cells. Figure 2 As shown in A, macrophage cell lines (5×10 4 ) were plated into the Transwell chamber, 1640 culture medium was added to the lower chamber, and Cal-B (10 μM) was added to the chamber for treatment for 12 hours; another 24-well plate was taken and the liver cancer cell line (5×10 5 ) were placed in the lower chamber. After 12 hours, the Transwell chamber containing macrophages was moved to the lower chamber and cultured together for 24 hours. After 24 hours, the number of chemotactic migrating macrophages was detected. Figure 2 As shown in B, Cal-B inhibited the number of chemotactic migration cells of Raw264.7 and THP-1. This indicates that in the co-culture system of the two species, Akebia trifoliata phenylethanol glycoside B can inhibit the chemotactic migration of tumor-associated macrophages toward liver cancer cells.

[0026] 3. Akebia trifoliata phenylethanol glycoside B inhibits the effect of M2 macrophages in promoting the migration of liver cancer cells.

[0027] In the tumor immune microenvironment, anti-inflammatory factors secreted by M2 tumor-associated macrophages often promote the metastasis of tumor cells. In order to simulate the relevant characteristics, we used the Transwell co-culture model of macrophages promoting liver cancer cell migration. Figure 3 As shown in A, macrophage cell lines (2×10 5) were plated in the lower chamber of a 24-well plate, and IL-4 (20 ng / mL) and Cal-B (10 μM) were added to the culture medium for 24 hours. After 24 hours, the liver cancer cell line (5×10 4 ) were plated into the Transwell chamber and then moved into the lower chamber containing macrophages for co-culture for 24 hours. After 24 hours, the number of migrated liver cancer cells was detected. Figure 3 As shown in B, Cal-B inhibited the migration-promoting effect of Raw264.7 cells on Hepa1-6 cells, and also inhibited the migration effect of THP-1 cells on HepG2 cells; at the same time, after IL-4 stimulation, M2 macrophages significantly promoted the migration of liver cancer cells, and Cal-B also significantly inhibited the migration-promoting effect of related M2 macrophages on Hepa1-6 and HepG2 cells. This shows that in the co-culture system of the two species, Akebia trifoliata phenylethanol glycoside B can inhibit the effect of tumor-associated macrophages in promoting the migration of liver cancer cells.

[0028] 2. Materials and methods required during the experiment of Example 1 1. Cell co-culture model ① Macrophage-hepatoma cell co-culture model Hepa1-6, HepG2, and Raw264.7 cells were cultured normally and subcultured according to the experiment. After THP-1 was plated, it was stimulated with PMA (50 ng / mL) for 24 hours to differentiate into macrophages for related experiments. The culture medium of the hepatoma cells in the logarithmic growth phase was changed, and the cell culture supernatant was taken after 24 hours for subsequent experiments. In the macrophage-hepatoma cell co-culture model, the macrophage cell line (1×10 6 After 12 h of culture, the culture medium was replaced with liver cancer cell culture supernatant, and Cal-B (0 μM, 1 μM, 10 μM) was added to the culture supernatant for 24 h. After 24 h, macrophages were collected for flow cytometry and qPCR detection, and culture supernatant was collected for ELISA detection.

[0029] ② Macrophage chemotaxis and migration Transwell co-culture model Hepa1-6, HepG2 and Raw264.7 cells were cultured normally and subcultured according to the experiment. After THP-1 was plated, it was stimulated with PMA (50 ng / mL) for 24 hours and differentiated into macrophages for related experiments. 4 ) were plated into Transwell chambers (pore size 3 μm), complete culture medium was added to the lower chamber, and Cal-B (10 μM) was added for 12 h after macrophages adhered to the wall. Another 24-well plate was used to plate liver cancer cell lines (5×10 5After 12 hours, the Transwell chamber containing macrophages was moved to the lower chamber and co-cultured for 24 hours. After 24 hours, the number of chemotactic migrating macrophages was detected.

[0030] ③ Transwell co-culture model of liver cancer cell migration Hepa1-6, HepG2 and Raw264.7 cells were cultured normally and subcultured according to the experiment; THP-1 cells were cultured and differentiated into macrophages after being stimulated with PMA (50 ng / mL) for 24 hours for related experiments. 5 ) were plated in the lower chamber of a 24-well plate, and IL-4 (20 ng / mL) and Cal-B (10 μM) were added to the culture medium for 24 hours. After 24 hours, the liver cancer cell line (5×10 4 The cells were then plated into a Transwell chamber and transferred to the lower chamber containing macrophages for co-culture for 24 hours. After 24 hours, the number of migrated liver cancer cells was detected.

[0031] 2. Flow Cytometry Raw264.7 or Thp-1 cells were harvested, resuspended and washed with PBS under relevant conditions. At 4°C in the dark, cells were blocked with Fc block (BD) for 15 min, incubated with 100 μL Mus CD86-PE-CY7 (BD) and Ho CD86-PE-CY7 (BD) fluorescent antibodies (1:500) for 30 min, then washed twice for fixation and permeabilization (Cytofix / Cytoperm Soln Kit, BD), and incubated with Mus CD206-Alexa Fluor 647 (BD) and Ho CD206-APC (BD) for 30 min. Cells were washed and resuspended in PBS, and analyzed using a CytoFLEX flow cytometer.

[0032] 3. ELISA The macrophage culture supernatant was collected, and the absorbance (OD value) of the standard and each sample in the microplate reader was detected according to the instructions of the ELISA kit. The operation steps were strictly carried out according to the instructions of the kit. Finally, the IL-10 and TGF-β cytokine content in each sample was calculated according to the standard curve equation.

[0033] 4. Real-time fluorescence quantitative PCR Raw264.7 or Thp-1 cells were harvested under relevant conditions. Total RNA was extracted using Ttizol reagent, and reverse transcription was performed using PrimeScript™ RT kit (RR037, Takara) to prepare cDNA. The prepared cDNA was diluted 5 times for use, and the qPCR reaction mixture was prepared using SYBRGreen Master Mix kit (B21703, Selleck), and finally placed on QuantStudio 3 instrument (ABI) for amplification to obtain the cycle threshold value (Ct value). GAPDH or β-actin was used as the internal reference gene, and 2 -△△Ct The expression levels of related genes were calculated.

[0034] Gene name Species Primer direction Primer sequence (5'-3') Mouse F GAGCGAGACCCCACTAACAT R TCTCCATGGTGGTGAAGACA Mouse F CGGGAAGACAATAACTGCACCC R CGGTTAGCAGTATGTTGTCCAGC Mouse F CATTGGCTTGCGAGACGTAGAC R GCTGAAGGTCTCTTCCATCACC Mouse F GCAACATGTGGAACTCTACCAG R CAGCCACTCAGGCGTATCA Mouse F CACACTTCCCAGGAATCAAGCC R TTTGGTGACACGACGGAACAGG Human F CATGTACGTTGCTATCCAGGC R CTCCTTAATGTCACGCACGAT Human F GACTTTAAGGGTTACCTGGGTTG R TCACATGCGCCTTGATGTCTG Human F TCATCTGGGTGGATGCTCACAC R GAGAATCCTGGCACATCGGGAA Human F GGCCAGATCCTGTCCAAGC R GTGGGTTTCCACCATTAGCAC Human F GATGCTGTCACTACCGTGGGAA R CAATGCCAGATGGCAAGGTTGG 5. Transwell cell migration assay In the Transwell-related cell co-culture system, the volume of the cell culture medium in the upper chamber is 100 μL, and the volume of the cell culture medium in the lower chamber is 600 μL; a chamber with a pore size of 3.0 μm is used for macrophage migration, and a chamber with a pore size of 8.0 μm is used for liver cancer cell migration; after treatment with relevant conditions, the lower surface of the chamber is immersed in 30% paraformaldehyde solution and fixed for 30 min; crystal violet staining is used for 10 min, followed by washing with PBS 2-3 times and photographing under a microscope; cells are counted in the middle and 5 surrounding fields and the average value is calculated to calculate the number of cell migration.

[0035] Example 2: The present invention found that Akebia phenylethanol glycoside B binds to MMP12 and inhibits the protease activity of MMP12. The specific experimental content is: 1. Experimental results: 1. The potential binding effect of akebia phenylethanol glycoside B and MMP12.

[0036] According to the above experimental results, Cal-B can inhibit the polarization of tumor-associated macrophages to M2 type. However, the target and mechanism of Cal-B are still unclear. We predicted the potential targets of Cal-B by SwissTargetPrediction (http: / / www.swisstargetprediction.ch / ). The results showed that Cal-B has potential binding effects with PRKCA (Protein kinase C alpha), MMP12 (Matrix metalloproteinase 12), MMP2 (Matrix metalloproteinase 2), etc., among which the potential binding probability with MMP12 is 47.7%. Given that MMP12 is secreted by macrophages and plays an important physiological and pathological role in the tumor immune microenvironment and in various diseases, we further predicted the potential binding sites of Cal-B and MMP12 by molecular docking. The crystal structure file of human MMP12 protein (PDB: 1JK3) was obtained through RCSBPDB (https: / / www.rcsb.org / ), which consists of 158 amino acids (106-263). Molecular docking experiments were performed using CB-DOCK2 (https: / / cadd.labshare.cn / cb- dock2 / php / blinddock.php) to determine its optimal binding conformation. The binding conformation and position of Akebia trifoliata phenylethanol glycoside B in MMP12 are shown in Figure 2. Figure 4 As shown in the figure, the binding free energy of Cal-B and MMP12 is -9.9 kcal / mol. Cal-B forms hydrogen bonds with G179, A184, P238 and Y240 in MMP12, and forms carbon-hydrogen bonds with T215 and F237. This indicates that Cal-B may interact with MMP12, thereby inhibiting the protease activity of MMP12 and inhibiting the M2 polarization of macrophages.

[0037] The cellular thermal shift assay (CETSA) was used to further verify the binding of Cal-B to MMP12. This experiment determines whether a small molecule drug interacts with the target protein based on the degree to which it increases the stability of the target protein. Figure 5As shown in the figure, the expression level of MMP12 zymogen protein (54kDa) gradually decreases with the increase of temperature; in Raw264.7 cells, compared with the Ctrl group, the expression level of Cal-B group increased significantly when the temperature exceeded 37°C; in THP-1 cells, compared with the Ctrl group, the expression level of Cal-B group increased significantly when the temperature exceeded 42°C. The above results indicate that Cal-B can bind to MMP12 protein.

[0038] Akebia phenylethanol glycoside B was coupled to the surface of magnetic beads to construct drug-coupled magnetic beads (Candidate Bio). The target protein was captured by pulldown experiment to further verify the binding effect of Cal-B and MMP12. In the protein lysate of Raw264.7 cells, ① blank magnetic beads were added, ② Cal-B (50μM) was added after blocking and drug magnetic beads were added, and ③ drug magnetic beads were added. Figure 6 As shown in A, Coomassie Brilliant Blue staining shows the expression of magnetic bead pulldown proteins in each group; Figure 6 As shown in B, MMP12 protein was pulled down by Cal-B coupled magnetic beads, which was significantly upregulated compared with groups ① and ②. In summary, Cal-B and MMP12 protein have a binding effect.

[0039] Surface plasmon resonance (SPR) was used to detect the affinity of Cal-B to MMP12. Figure 7 As shown in A, the kinetic dissociation constant (KD) of Cal-B binding to MMP12 is 3.096 μM. The smaller the KD value, the higher the stability of the binding. Figure 7 As shown in B, the affinity dissociation constant of Cal-B binding to MMP12 is 41.81 μM. The lower the KD value, the higher the affinity. The above results suggest that Cal-B has a strong binding with MMP12.

[0040] Therefore, based on the thermal stability of protein interactions, drug magnetic bead pulldown experiments and SPR experimental results, MMP12 may be a potential target for the inhibition of macrophage M2 polarization by akebia phenylethanoid glycoside B.

[0041] 2. Akebia trifoliata phenylethanol glycoside B inhibited the activity of MMP12 protease.

[0042] The results of previous experiments showed that Cal-B binds to MMP12. To further investigate whether Cal-B has an inhibitory effect on the protease activity of MMP12, we synthesized the human MMP12 fluorescent peptide substrate Mca-PLGLEEA-Dap(Dnp)-NH2 to detect the effect of Cal-B on the enzyme activity of MMP12. We detected the protease activity of MMP12 in the supernatant of THP-1 cell culture medium and recombinant human MMP12 (rh-MMP12), respectively. Figure 8 As shown in A, the fluorescence intensity was continuously detected at multiple time points using an ELISA instrument, and it was found that the fluorescence intensity of the THP-1 cell culture supernatant treated with Cal-B (50 μM) decreased significantly; Figure 8 As shown in B, rh-MMP12 (0.5 ng / μL) was treated with different concentrations of Cal-B (0-50 μM). As the concentration of Cal-B increased, the fluorescence intensity decreased significantly and showed a dose-dependent relationship. The half-maximal inhibitory concentration was calculated by statistical software, as shown in Figure 8 As shown in Figure C, when treated for 10 min, 20 min, and 30 min, its IC50 was 19.82 μM, 20.50 μM, and 20.71 μM, respectively. The above results show that Cal-B can significantly inhibit the activity of MMP12 protease.

[0043] 3. Akebia trifoliata phenylethanol glycoside B inhibited the promoting effect of MMP12 on M2 polarization and migration of macrophages.

[0044] The previous experiments confirmed the binding of Cal-B to MMP12 and its inhibitory effect on its enzyme activity. Based on the fact that Cal-B can inhibit the polarization of macrophages to M2, we further explored the effect of Akebia phenylethanol glycoside B on the polarization and migration of M2 macrophages by inhibiting MMP12. After THP-1 cells were induced into macrophages by PMA, rh-MMP12 was added. Fig. 9 As shown in A, flow cytometry was used to detect the expression of M2 macrophage marker (CD206). Compared with the Ctrl group, rh-MMP12 significantly promoted the expression of CD206 in THP-1 cells, while the addition of Cal-B (10 μM) significantly inhibited the expression of CD206 promoted by rh-MMP12. Fig. 9 As shown in Figure B, qPCR detected the mRNA expression levels of M2 macrophage markers and found that rh-MMP12 significantly promoted the expression of ARG1, IL10 and TGFB1, while Cal-B inhibited the effect of rh-MMP12; then we further observed the effect of Cal-B on rh-MMP12 promoting THP-1 chemotaxis and migration ( Fig. 9D), it was found that rh-MMP12 can significantly promote the migration of THP-1, while Cal-B can inhibit the related promotion effect. In summary, these results indicate that MMP12 can promote the polarization of macrophages to M2 type and promote the chemotactic migration of macrophages, while Cal-B inhibits its related promotion effect by inhibiting the enzyme activity of MMP12.

[0045] 2. Materials and methods required during the experiment of Example 2 1. Molecular docking experiment Molecular docking experiments were performed using CB-DOCK2 (https: / / cadd.labshare.cn / cb-dock2 / php / blinddock.php) online software. First, the molecular structure file of Cal-B (PubChem CID: 5273567) was obtained through PubChem (https: / / pubchem.ncbi.nlm.nih.gov / ), and the crystal structure file of human MMP12 protein (PDB: 1JK3) was obtained through RCSB PDB (https: / / www.rcsb.org / ). The ligand (Cal-B) and protein (MMP12) structures were uploaded for blind docking based on the protein-ligand structure: AutoDock Vina-based docking was performed in each detected cavity. The software will rank the potential binding sites of the query ligand according to the Vina score (kcal / mol) and determine the optimal binding conformation between Cal-B and MMP12. The optimal binding conformation was analyzed using Discovery Studio software to obtain the binding site and intermolecular force type between Cal-B and MMP12.

[0046] 2. Cellular thermal shift assay (CETSA) The cultured macrophages Raw264.7 and Thp-1 were divided into a blank control group and a Cal-B group. Cal-B (10 μM) was added to the Cal-B group, and an equal volume of complete medium was added to the blank control group. After incubation in the incubator for 3 h, the cells were collected. The cells were lysed using a neutral RIPA lysis buffer containing a protease inhibitor cocktail, and the lysate was aliquoted into 7 PCR tubes. Six temperature points were set between 37 and 70 °C, and the lysate of each sample was heated for 5 min using a PCR instrument, cooled to 4 °C, centrifuged at 12000 r / min for 20 min, the supernatant was taken, and 5× loading buffer was added and boiled for 10 min. The expression of MMP12 protein in each group was detected by Western blot.

[0047] 3. Drug magnetic bead pulldown experiment The Candidate Bio Biotarget validation custom kit was used to construct the Akebia phenylethanol glycoside B-coupled magnetic beads, and the control group was blank magnetic beads. Raw264.7 was plated in a 10 cm culture dish for culture. After the cells were fully grown, they were rinsed with PBS buffer for 2-3 times, and the collected cells were lysed with NP40 lysis buffer, and the cell debris was removed by centrifugation at 4°C. The cell lysate was quantified to 600 μg / mL using the BCA method, with a volume of 2-3 mL, and then divided into 3 groups with equal volumes: blank control group, blocking group, and drug magnetic bead group. Cal-B (50 μM) was added to the cell lysate of the blocking group, and incubated at 4°C for 1 hour. After that, blank magnetic beads were added to the blank control group, and equal volumes of Cal-B-coupled magnetic beads were added to the blocking group and drug magnetic bead group, and incubated at 4°C for 24 hours. The three groups of magnetic bead incubation solutions were placed on a magnetic rack for 1 minute to separate the input and magnetic beads of each group. The magnetic beads were gently washed twice with PBS buffer, separated by standing on a magnetic stand, and then PBS (60 μL) and 5× loading buffer (15 μL) were added and boiled for 10 min. The pulldowns of each group were collected for subsequent electrophoresis and Western blot experiments.

[0048] 4. Western blot experiment Western blot experiments were performed on the protein lysates of each group obtained from the CETSA experiment, as well as the Raw264.7 cell lysates, and the input and pulldown protein lysates of each group in the drug magnetic bead pulldown experiment. In short, gel preparation (10% SDS-PAGE), sample loading, electrophoresis (80v-120v) and transfer (300mA) were performed, and then 5% skim milk powder was used for blocking, and then the primary antibody MMP12 (1:1000, SAB) and HRP-conjugated secondary antibody (1:2000, Thermo) were incubated in sequence, and ECL luminescent solution was added for exposure, and the FlourChem M chemiluminescent imaging analyzer (ProteinSimple) was used for detection.

[0049] 5. Surface Plasmon Resonance Technology The interaction of Cal-B with MMP12 was detected using a BIAcore T200 biomolecular interaction analyzer (GE Healthcare) and a CM5 sensor chip (GE Healthcare). Briefly, rh-MMP12 (Sino-Biological, Cat: 10266-HNAE) was immobilized on a CM5 chip in sodium acetate buffer (50 μg / ml, pH 4.5) and analyzed against a concentration gradient of Cal-B. Cal-B was injected at a flow rate of 30 μL / min using PBS buffer. The binding time was 120 seconds and the dissociation time was 240 seconds. The chip surface was regenerated for 30 seconds with Tris-HCl buffer (pH 2.0). The binding constants were obtained by BIAcore software using a 1:1 Langmuir binding model.

[0050] 6. MMP12 protease activity detection The human MMP12 fluorescent peptide substrate Mca-PLGLEEA-Dap(Dnp)-NH2 (Peptide Biotechnology) was used to detect changes in MMP12 enzyme activity. A working buffer (50mM Tris-HCl pH6.8, 10mM CaCl2) was prepared for dilution of rh-MMP12, Cal-B and fluorescent substrate. For the detection of MMP-12 in the culture supernatant of THP-1 cells, each well of the 100μL reaction system contained 50μL of culture supernatant, 50μM Cal-B, 10μM fluorescent substrate, and the blank group contained only 10μM fluorescent substrate; for the inhibitory effect of different concentrations of Cal-B on MMP12, each well of the 100μL reaction system contained rh-MMP12 (0.5ng / μL), Cal-B (0-50μM), 10μM fluorescent substrate, and the blank group contained only 10μM fluorescent substrate. Four replicate wells were set for each group. The fluorescence intensity of each well was detected by Ensight ELISA (PE) (ex: 320nm, em: 340nm), and the fluorescence intensity of each well at different times was recorded.

[0051] The above contents are examples and explanations of the present invention, but do not mean that the advantages that can be achieved by the present invention are limited thereto. Any simple changes in the structure that may be made during the practice of the present invention, and / or one or more of the advantages achieved in some embodiments are within the scope of protection of this application.

Claims

1. A new use of Akebia phenylethanol glycoside B as a preparation of MMP12 inhibitors, characterized in that: Akebia phenylethanoid glycoside B inhibits M2 polarization of tumor macrophages.

2. The use according to claim 1, characterized in that Akebia phenylethanoid glycoside B binds to MMP12 and inhibits MMP12 protease activity.

3. The use according to claim 1, characterized in that The tumor is specifically selected from a liver cancer model.

Images