1,5-diaryl-1,2,4-triazole derivatives targeting myoferlin and synthesis and use thereof

Abstract

The application discloses a kind of 1,5-diaryl-1,2,4-triazole compounds or pharmaceutically acceptable salt represented by structural formula I, II or pharmaceutical composition containing such compounds.The application also discloses the application of the compound or pharmaceutically acceptable salt in the preparation of drugs for treating various malignant tumors and related diseases of tumor metastasis.The compound represented by formula I, II of the application can inhibit the proliferation, invasion and infiltration of tumor cells such as gastric cancer cells, breast cancer cells, prostate cancer cells, colon cancer cells, liver cancer cells, non-small cell lung cancer cells and bladder cancer cells in a concentration gradient-dependent manner, has the characteristics of high efficiency and low toxicity, and has a wide application prospect in the biological medicine industry.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and relates to a novel 1,5-diaryl-1,2,4-triazole derivative targeting Myoferlin and synthesis and application thereof. BACKGROUND

[0002] Cancer, also known as malignant tumor, is one of the main causes of disease-related deaths worldwide.

[0003] Tumor metastasis is a complex process: tumor cells are released from the primary tumor site and invade the surrounding tissues, enter the blood circulation or lymphatic circulation, are captured by the capillary bed of the distal organs, invade other tissues and organs from the circulatory system, cause organ failure, and eventually cause the death of the patient. Molecular targeted drugs are a class of chemical drugs that target oncogenic proteins in cell signaling pathways, regulate signaling pathways closely related to the occurrence and development of cancer, and treat tumors. Compared with traditional chemotherapy drugs, it has better treatment selectivity, more significant effect, and less side effects. Therefore, it is currently urgent to find targets for treating tumors and develop targeted drugs that can effectively inhibit tumor metastasis.

[0004] Myoferlin (MYOF) protein belongs to the ferlin membrane protein family, which is closely related to tumor cell migration and invasion, and is involved in a series of membrane-related functions in cells, including endocytosis and cell membrane repair, vesicle transport, and protein recycling. Immunohistochemical staining of human protein atlas shows that MYOF is up-regulated to varying degrees in various types of cancer, including melanoma, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, prostate cancer, pancreatic cancer, and glioma, and the degree of malignancy of the tumor is positively correlated with the degree of MYOF expression (www.proteinatlas.org; www.cbioportal.org). During the development of cancer, cancer cells need to communicate more frequently with other cells and the surrounding environment to affect the proliferation, differentiation, invasion, and migration of cancer cells. MYOF regulates various intracellular and extracellular signals and distribution by regulating vesicle transport, membrane fusion, and endocytosis and exocytosis, thereby affecting the proliferation and metastasis of cancer cells. Therefore, MYOF plays an important accelerating function in the progression of various cancers. (CIPTA S, et al. Am J Physiol Cell Physiol, 2009, 297(3): C481-2). Studies have shown that MYOF can regulate the local plasma membrane and affect the transport of receptors and proteins on the plasma membrane in cancer cells. The epithelial-mesenchymal transition (EMT) process plays an important role in cancer metastasis and invasion. During this process, epithelial cells acquire the ability to transfer and invade interstitial cells, participate in tissue healing, organ fibrosis, and cancer occurrence processes (Gu H, et al. Curr Top Med Chem, 2020, 20(17): 1509-15.). It has been reported that in MDA-MB-231 cells, knockdown of MYOF can inhibit the EMT process of tumor cells, reduce the invasion ability of breast cancer cells, and also down-regulate the expression of matrix metalloproteinases (MMPs). Similarly, knockdown of MYOF can reverse the EMT process to inhibit breast cancer metastasis (Ruth Li, PLoS ONE 7(6): e39766). In the breast cancer-related signaling pathway of MYOF, high expression of MYOF can regulate the activity of the epidermal growth factor receptor, and co-localization of MYOF and caveolin can regulate the activated epidermal growth factor receptor (EGFR) in cells.

[0005] In view of the important role of MYOF protein in tumor metastasis, MYOF has good target innovation as a potential drug target, and the development of anti-tumor drugs targeting MYOF protein has broad market prospects. As one of the most important physicochemical properties of drugs, solubility is usually a decisive factor for the oral bioavailability of drugs. In the process of new drug development, the determination and improvement of drug solubility are essential work. At the same time, the water solubility of the drug is also crucial for its PK properties in the process of passing through the biological membrane in the form of molecules in the gastrointestinal tract and being further absorbed. In the present application, by modifying and modifying the molecular structure of the drug, compared with the published MYOF inhibitor 6y, the water solubility of the MYOF inhibitor can be increased by tens or even hundreds of times under the conditions of pH 2.0 and 7.4 (see Figure 4 ), significantly improving its physicochemical properties and improving its drugability. SUMMARY

[0006] The present application creates a class of small molecule inhibitors containing a five-membered nitrogen-containing heterocyclic ring. This class of compounds can target Myoferlin (MYOF) protein to exert its anti-tumor growth and metastasis effect. The present application creatively designs and synthesizes a class of novel 1,5-diaryl-1,2,4-triazole compounds or derivatives or their pharmaceutically acceptable salts or related analogs. Further mechanism research shows that the compound of structural formula I in the present application can specifically bind to MYOF protein, effectively inhibit the proliferation and migration of tumor cells. At the same time, compared with the existing MYOF inhibitor 6y, the water solubility of the compound of the present application is significantly improved under various pH conditions (such as pH 2.0, 7.4 and 9.0) Figure 4 ), greatly improving the drugability of the candidate compound. In summary, the compound MYOF inhibitor of the present application is expected to develop into a potential anti-tumor candidate drug.

[0007] The present application provides a class of 1,5-diaryl-1,2,4-triazole compounds and related analogs which can be used as anti-tumor lead compounds.

[0008] The present application provides a pharmaceutical composition comprising the 1,5-diaryl-1,2,4-triazole compound or its pharmaceutically acceptable salt, which can also include but is not limited to a pharmaceutically acceptable salt and a pharmaceutically acceptable carrier.

[0009] The present application provides a MYOF inhibitor comprising the 1,5-diaryl-1,2,4-triazole compound or its pharmaceutically acceptable salt or the pharmaceutical composition.

[0010] The application provides application of the 1,5-diaryl-1,2,4-triazole compound and related analogues to preparation of medicines for inhibiting diseases caused by abnormal expression of MYOF.

[0011] The application also provides application of the compound or the pharmaceutical composition containing the compound to preparation of medicines for treating various malignant tumors, in particular, breast cancer, lung cancer, liver cancer, prostate cancer, skin cancer, colon cancer, pancreatic cancer, leukemia, ovarian cancer, gastric cancer, bladder cancer, kidney cancer and oral cancer and related cancer metastasis and recurrence processes.

[0012] The application provides a 1,5-diaryl-1,2,4-triazole compound or a pharmaceutically acceptable salt, which is shown in the following structural formula I:

[0013]

[0014] Ar2 is a nitrogen-containing five-membered heterocycle, Ar1 and Ar3 are aromatic rings or aromatic heterocycles;

[0015] n is 0-6;

[0016] A, B, D and E are each independently selected from C or N atoms, and A, B and E are not simultaneously C atoms; A, B, D and E are not simultaneously N atoms;

[0017] F and G are each independently selected from C or N atoms;

[0018] Ar1 and Ar3 are one of the following aromatic rings or aromatic heterocycles: a benzene ring, a pyridine ring, a pyrimidine ring;

[0019] R1 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoroalkoxy, fluoroalkyl, carbonyl, cyano, nitro and alkoxyl in which hydrogen is replaced by its isotope deuterium, etc.

[0020] R2 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde, etc.

[0021] Further, the 1,5-diaryl-1,2,4-triazole compound or the pharmaceutically acceptable salt as described above, when Ar2 is a nitrogen-containing five-membered heterocycle and Ar3 is a benzene ring, is shown in the following structural formula II:

[0022]

[0023] n is 0-6;

[0024] A, B, D, E are each independently selected from C or N atom, and A, B, E are not simultaneously C atom; A, B, D, E are not simultaneously N atom;

[0025] Ar1 is one of the following aromatic ring or aromatic heterocycle: benzene ring, pyridine ring, pyrimidine ring;

[0026] R1 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoroalkoxy, fluoroalkyl, carbonyl, cyano, nitro and alkoxy in which hydrogen is replaced by its isotope deuterium, etc.

[0027] R2 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde group, etc.

[0028] In the present application, the pharmaceutically acceptable salt of the 1,5-diaryl-1,2,4-triazole compound is an acid addition salt formed by the 1,5-diaryl-1,2,4-triazole compound and an acid; wherein the acid includes but is not limited to hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, acetic acid, tartaric acid, salicylic acid, citric acid, methanesulfonic acid, p-toluenesulfonic acid, lactic acid, pyruvic acid, maleic acid, succinic acid, etc.

[0029] Further, the present application also provides 1,5-diaryl-1,2,4-triazole compounds or pharmaceutically acceptable salts, which include but are not limited to the following:

[0030] N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0031] N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0032] N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide;

[0033] N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methyl-2-pyridinyl)-1-1H-1,2,4-triazolyl)benzamide;

[0034] N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(4-chloro-2-pyridinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide;

[0035] 3-(3-ethyl-5-(4-methoxyphenyl)-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1H- pyrazolyl)butyl)benzamide; 3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1H- pyrazolyl)butyl)benzamide;

[0036] N-(4-(4-bromo-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1H-1,2,4- triazolyl)benzamide;

[0037] N-(4-(2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1H-1,2,4-triazolyl) benzamide;

[0038] N-(4-(2H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1H-1,2,4- triazolyl)benzamide;

[0039] N-(4-(2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1H-1,2,4- triazolyl)benzamide; N-(4-(2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(methoxy-d3)phenyl)-1H-1,2,4- triazolyl)benzamide; N-(4-(4-bromo-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1H-1,2,4- triazolyl)benzamide; N-(4-(4,5-dibromo-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1H-1,2,4- triazolyl)benzamide;

[0040] N-(4-(1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1H-1,2,4-triazolyl) benzamide;

[0041] N-(4-(1H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1H-1,2,4- triazolyl)benzamide;

[0042] N-(4-(4-bromo-l-lH-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(4-(l-lH-l,2,4-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l- lH-l,2,4-triazolyl)benzamide;

[0043] N-(4-(l-lH-l,2,4-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-l- lH-l,2,4-triazolyl)benzamide;

[0044] N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l-lH-l,2,4- triazolyl)benzamide;

[0045] N-(4-(2-2H-tetrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-l- lH-l,2,4-triazolyl)benzamide;

[0046] N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-l- lH-l,2,4-triazolyl)benzamide;

[0047] N-(4-(l-lH-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l-lH-l,2,4- triazolyl)benzamide;

[0048] N-(6-(2-2H-l,2,3-triazolyl)hexyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l-lH-l,2,4- triazolyl)benzamide;

[0049] N-(5-(2-2H-l,2,3-triazolyl)pentyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l-lH-l,2,4- triazolyl)benzamide;

[0050] N-(3-(2-2H-l,2,3-triazolyl)propyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l-lH-l,2,4- triazolyl)benzamide;

[0051] N-(2-(2-2H-l,2,3-triazolyl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l-lH-l,2,4- triazolyl)benzamide;

[0052] N-(2-(l - 1 H-pyrazolyl)ethyl)-3 -(3 -ethyl-5 -(4-methoxyphenyl)- 1 - 1 H- 1,2,4- triazolyl)benzamide;

[0053] N-(2-(l - 1 H-pyrazolyl)ethyl)-3 -(3 -ethyl-5 -(4-methoxyphenyl)- 1 - 1 H- 1,2,4- triazolyl)benzamide;

[0054] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(2-methoxyphenyl)-l -lH-l,2,4- triazolyl)benzamide;

[0055] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(3-methoxyphenyl)-l -lH-l,2,4- triazolyl)benzamide;

[0056] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-hydroxyphenyl)-l -lH-l,2,4- triazolyl)benzamide;

[0057] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-nitrophenyl)-l -lH-l,2,4- triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethoxy)phenyl)-l -lH- 1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-aminophenyl)-3-ethyl-l -lH-l,2,4- triazolyl)benzamide;

[0058] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-fluorophenyl)-l -lH-l,2,4- triazolyl)benzamide;

[0059] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-chlorophenyl)-3-ethyl-l -lH-l,2,4- triazolyl)benzamide;

[0060] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-bromophenyl)-3-ethyl-l -lH-l,2,4- triazolyl)benzamide;

[0061] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethyl)phenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0062] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-phenyl-1-1H-1,2,4-triazolyl)benzamide;

[0063] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-ethylphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0064] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-propylphenyl)-1-1H-1,2,4-triazolyl)benzamide;

[0065] N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyridyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(6-methoxy-3-pyridyl)-1-1H-1,2,4-triazolyl)benzamide.

[0066] The present application also provides a pharmaceutical composition comprising the 1,5-diaryl-1,2,4-triazole compound and / or the pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0067] The present application also provides a MYOF inhibitor comprising the 1,5-diaryl-1,2,4-triazole compound and / or the pharmaceutically acceptable salt thereof, which can also be or comprise the pharmaceutical composition.

[0068] In specific embodiments, the compound and / or the pharmaceutically acceptable salt thereof, the MYOF inhibitor, the pharmaceutical composition, etc. are formulated into an injectable fluid, an aerosol, a cream, a gel, a pill, a capsule, a syrup, a transdermal patch, or an excipient.

[0069] The present application also provides the use of the 1,5-diaryl-1,2,4-triazole compound or the pharmaceutically acceptable salt thereof, or the pharmaceutical composition or the inhibitor in the preparation of a medicament for inhibiting or binding to MYOF (myoferlin) protein.

[0070] The application further provides application of the 1,5-diaryl-1,2,4-triazole compound or the pharmaceutically acceptable salt thereof, or the pharmaceutical composition or the inhibitor in preparation of an antitumor drug.

[0071] The application further provides application of the 1,5-diaryl-1,2,4-triazole compound or the pharmaceutically acceptable salt thereof, or the pharmaceutical composition or the inhibitor in preparation of a drug for inhibiting proliferation, migration and infiltration of tumor cells, wherein the tumor cells include melanoma cells, liver cancer cells, lung cancer cells, prostate cancer cells, breast cancer cells, skin cancer cells, colon cancer cells, pancreatic cancer cells, leukemia cells, ovarian cancer cells, gastric cancer cells, bladder cancer cells, kidney cancer cells and oral cancer cells, myeloma, esophageal cancer and head and neck squamous cell carcinoma and the like.

[0072] The application further provides application of the 1,5-diaryl-1,2,4-triazole compound or the pharmaceutically acceptable salt thereof, or the pharmaceutical composition or the inhibitor in preparation of a drug for treating malignant tumors, wherein the malignant tumors include melanoma, liver cancer, lung cancer, prostate cancer, skin cancer, colon cancer, pancreatic cancer, breast cancer, leukemia, ovarian cancer, gastric cancer, bladder cancer, kidney cancer, oral cancer, myeloma, esophageal cancer, head and neck squamous cell carcinoma and the like.

[0073] The application further provides application of the 1,5-diaryl-1,2,4-triazole compound or the pharmaceutically acceptable salt thereof, or the pharmaceutical composition or the inhibitor in preparation of a drug for treating metastasis and recurrence of malignant tumors, wherein the malignant tumors include liver cancer, lung cancer, prostate cancer, skin cancer, colon cancer, pancreatic cancer, breast cancer, leukemia, ovarian cancer, gastric cancer, bladder cancer, kidney cancer, oral cancer, myeloma, esophageal cancer, head and neck squamous cell carcinoma and the like.

[0074] In the application, the 1,5-diaryl-1,2,4-triazole compound or the pharmaceutically acceptable salt thereof, or the inhibitor or the pharmaceutical composition can be used alone or in combination with other drugs.

[0075] The application further provides a preparation method of the 1,5-diaryl-1,2,4-triazole compound (HJ001-HJ034, HJ036-HJ045) with the structural formula I and II, and the reaction formula is as follows:

[0076]

[0077] Reagents and reaction conditions: (a) N,N-dimethylformamide, N,N-diisopropylethylamine, 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate, room temperature; (b) dichloro sulfoxide, methanol, 80°C; (c) acetic acid, 80°C; (d) methanol / water, lithium aluminum hydride, room temperature; (e) potassium carbonate, dimethyl sulfoxide, 60°C; (f) hydrazine monohydrate, ethanol, 40°C.

[0078] n is 0-6; A, B, D, E are each independently selected from C or N atom, and A, B, E are not simultaneously C atom, A, B, D, E are not simultaneously N atom; F, G are each independently selected from C or N atom; Ar1 and Ar3 are one of the following aromatic ring or aromatic heterocycle: benzene ring, pyridine ring, pyrimidine ring; R1 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoroalkoxy, fluoroalkyl, carbonyl, cyano, nitro and alkoxy in which hydrogen is replaced by its isotope deuterium, etc.; R2 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde group, etc.

[0079] The present application also proposes a preparation method of the 1,5-diaryl-1,2,4-triazole compound (HJ035) of the structural formula I, II, and the reaction formula is as follows:

[0080]

[0081] Reagents and reaction conditions: methanol, palladium on carbon, hydrogen, room temperature.

[0082] The beneficial effects of the present application include: the present application proposes a kind of 1,5-diaryl-1,2,4-triazole compound or its pharmaceutically acceptable salt shown in structural formula I-Ⅱ and pharmaceutical composition containing such compound, the compound or pharmaceutically acceptable salt can be used to prepare the drug, inhibitor for treating various malignant tumors and related diseases of tumor metastasis etc.In the present application, by introducing five-membered heterocycle containing multiple (2-4) nitrogen atoms as the tail of the compound, it is found that the water solubility of target compound can be significantly improved by relevant experiment verification (appendix Figure 4 ).The present application innovatively proposes the strategy and application of improving the saturated solubility of compound in water by introducing nitrogen-containing five-membered heterocycle containing multiple (2-4) nitrogen atoms, and brings significant beneficial effects in application.

[0083] The compound shown in formula I-II of the present application can inhibit the proliferation, invasion and infiltration of tumor cells such as gastric cancer cells, breast cancer cells, prostate cancer cells, colon cancer cells, liver cancer cells, non-small cell lung cancer cells and bladder cancer cells in a concentration gradient-dependent manner, has high efficiency and low toxicity, and has a wide application prospect in the biological and pharmaceutical industries. BRIEF DESCRIPTION OF DRAWINGS

[0084] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained according to these drawings without creative labor for those skilled in the art.

[0085] Figure 1 is the anti-proliferation activity test result of the compounds HJ001, HJ009, HJ021, HJ032 and HJ037 in the present application in MYOF high-expression or low-expression cells.

[0086] Figure 2 is the inhibition of the clone formation of cancer cells by the compound HJ001 in the present application.

[0087] Figure 3 is the inhibition of the migration of cancer cells by the compound HJ001 in the present application.

[0088] Figure 4 is the water solubility determination result of the compounds HJ001 and the like in the present application.

[0089] Figure 5 is the schematic diagram of detecting the binding of the compound HJ001 in the present application to MYOF protein by thermal shift experiment.

[0090] Figure 6 is the schematic diagram of detecting the sensitivity of gastric cancer cells to the preferred compound HJ001 after knocking out MYOF in the present application.

[0091] Figure 7 is the schematic diagram of inhibiting gastric cancer MKN45 in vivo by the preferred compound HJ001 in the present application. DETAILED DESCRIPTION

[0092] The present application is further described in conjunction with the following specific examples and drawings, the scope of protection of the present application is not limited to the following examples. Changes and advantages that can be thought of by those skilled in the art without departing from the spirit and scope of the present application are included in the present application, and are protected by the appended claims. The process, conditions, reagents, experimental methods, etc. for implementing the present application, except for the following specifically mentioned contents, are the general knowledge and common sense in the art, and the present application has no special limitation.

[0093] 1 H-NMR was measured by Bruker 500MHz type instrument. Unless otherwise specified, all solvents and reagents were not specially treated before use; unless otherwise specified, all reactions were followed by TLC, and the saturated brine washing and anhydrous sodium sulfate drying process were used in the post-treatment; the purification of the product was carried out by column chromatography using silica gel (200-300 mesh) unless otherwise specified; the silica gel used included 200-300 mesh and GF 254 Qingdao Marine Chemical Plant or Yantai Yuanbo Silica Gel Co., Ltd.

[0094] Example 1: Preparation of each compound

[0095] Example 1-1: N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0096] Compound 4-methoxybenzoic acid (760 mg, 5.0 mmol) and propylamidine hydrochloride (640 mg, 6.0 mmol) were taken in N,N-dimethylformamide, HATU (2.9 g, 7.5 mmol) and DIEA (0.97 g, 7.5 mmol) were added under nitrogen atmosphere, stirred for 5 min in ice bath, then stirred at room temperature (25°C) for 8 h, after completion, cooled, added compound 3-hydrazinylbenzoic acid methyl ester (4.0 g, 10.0 mmol) and glacial acetic acid (3.0 g, 25.0 mmol), warmed to 80°C, reacted for 3 h, cooled to room temperature, the reaction liquid was washed twice with saturated aqueous sodium bicarbonate solution until no bubbles were generated, extracted with ethyl acetate, the ethyl acetate layer was washed with saturated brine, dried with anhydrous sodium sulfate, and the organic phase was evaporated. After column chromatography purification, compound 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzoic acid methyl ester was obtained. (1.24 g, yield: 74%): 1H NMR (500 MHz, DMSO-d6) δ 8.03 (s, 1H), 7.96 (d, J = 1.9 Hz, 1H), 7.66 - 7.56 (m, 2H), 7.38 (d, J = 2.1 Hz, 2H), 7.37 (d, J = 2.1 Hz, 2H), 6.97 (d, J = 2.1 Hz, 2H), 6.95 (d, J = 2.1 Hz, 2H), 3.87 (s, 3H), 3.77 (s, 3H), 2.75 (q, J = 7.6 Hz, 2H), 1.31 (t, J = 7.6 Hz, 3H). Compound methyl 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzoate (337 mg, 1.0 mmol) was dissolved in 6 mL of methanol, and a solution of LiOH-H2O (168 mg, 4.0 mmol) in water (1.5 mL) was added dropwise under an atmosphere of nitrogen while the mixture was cooled in an ice bath, and then the reaction was allowed to proceed at room temperature overnight. The reaction mixture was acidified with 3 M HCl and extracted twice with ethyl acetate. The organic phase was washed with water and saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give crude 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzoic acid in 94% yield. Compound 1H-pyrazole (500 mg, 7.3 mmol), potassium carbonate (1.2 g, 7.5 mmol) were dissolved in DMSO (20 ml) and reacted at 60 °C for 30 min under nitrogen atmosphere. Compound 2-(4-bromobutyl)isoindoline-1,3-dione (2.1 g, 7.3 mmol) was added and reacted at 60 °C for 5 h, and then the reaction mixture was cooled to room temperature. The reaction mixture was extracted with ethyl acetate, and the ethyl acetate layer was washed with saturated brine, dried over anhydrous sodium sulfate, and evaporated. Column chromatography gave compound 2-(4-(1H-pyrazol-1-yl)butyl)isoindoline-1,3-dione (843 mg, yield: 43%): 1HNMR (500 MHz, CDC13) δ 7.86 (dd, J = 5.1, 3.7 Hz, 2H), 7.73 (d, J = 5.0, 3.6 Hz, 2H), 7.51 (d, J = 1.8 Hz, 1H), 7.41 (d, J = 4.0 Hz, 1H), 6.25 (dd, J = 2.0 Hz, 1H), 4.21 (t, J = 7.0, 1.6 Hz, 2H), 3.73 (t, J = 7.1, 1.7 Hz, 2H), 1.98 - 1.89 (m, 2H), 1.75 - 1.66 (m, 2H). Compound 2-(4-(1H-pyrazol-1-yl)butyl)isoindole-1,3-dione (300 mg, 1.1 mmol), hydrazine hydrate (224 mg, 4.5 mmol) were dissolved in ethanol and reacted at room temperature for 10 h under nitrogen protection. The ethanol was removed by concentration under reduced pressure. A 1M potassium hydroxide solution was added and dichloromethane was extracted. The organic phase was dried over anhydrous sodium sulfate and evaporated to dryness to obtain the compound 4-(1-1H-pyrazolyl)butan-1-amine (147 mg) as a crude product. Compound 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzoic acid (150 mg, 0.6 mmol), HATU (317 mg, 0.8 mmol) and DIEA (241 mg, 0.8 mmol) were added to a flask at 0°C under nitrogen protection. After 5 min, 3 mL of DMF was added. After 5 min, 4-(1-1H-pyrazolyl)butan-1-amine (77 mg, 0.6 mmol) was added. After 15 min, the ice bath was removed and the reaction was allowed to proceed at room temperature for 3 h. The product was obtained by column chromatography after extraction with ethyl acetate and concentration under reduced pressure. The product HJ001 (172 mg, yield: 70%) was obtained after purification by column chromatography. 1 H NMR (500 MHz, CDC13) δ 7.96 - 7.87 (m, 2H), 7.55 - 7.38 (m, 6H), 6.90 - 6.78 (m, 3H), 6.28 (dd, 1H), 4.22 (d, 2H), 3.83 (d, J = 2.0 Hz, 3H), 3.52 - 3.44 (m, 2H), 2.90 (q, J = 7.5 Hz, 2H), 1.99 (dd, J = 10.0, 4.9 Hz, 2H), 1.67 - 1.59 (m, 2H), 1.44 (t, 3H).

[0097] Table 1 Preparation of 1,2,4-triazole compounds shown in Examples 1-2 to 1-45 (HJ002-045)

[0098]

[0099]

[0100]

[0101]

[0102] The following Examples 1-2 to 1-45 provide methods of making and testing the compounds HJ002-HJ045 of the present application. Example 1-2, N-(4-(l-lH-pyrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3- ethyl-l-lH-l,2,4-triazolyl)benzamide

[0103] Using a similar procedure to that used to prepare compound HJ001, 4-methoxybenzoic acid was replaced with 5-bromopyrimidine-2-carboxylic acid and compound HJ002 was obtained after purification by column chromatography in 88% yield:1H NMR (500 MHz, CDC13) δ 7.96 - 7.87 (m, 2H), 7.55 - 7.38 (m, 6H), 6.90 - 6.78 (m, 3H), 6.28 (dd, 1H), 4.22 (d, 2H), 3.83 (d, J = 2.0 Hz, 3H), 3.52 - 3.44 (m, 2H), 2.90 (q, J = 7.5 Hz, 2H), 1.99 (dd, J = 10.0, 4.9 Hz, 2H), 1.67 - 1.59 (m, 2H), 1.44 (t, 3H). Example 1-3, N-(4-(l-lH-pyrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-l-lH-l,2,4- triazolyl)benzamide

[0104] Using a similar procedure to that used to prepare compound HJ001, 4-methoxybenzoic acid was replaced with 5-methoxypyrimidine-2-carboxylic acid and compound HJ003 was obtained after purification by column chromatography in 79% yield:1H NMR (500 MHz, DMSO-d6) δ 8.59 (s, 3H), 7.93 - 7.83 (m, 2H), 7.70 (d, J = 2.2 Hz, 1H), 7.54 - 7.47 (m, 1H), 7.44 - 7.37 (m, 2H), 6.21 (dd, J = 2.1 Hz, 1H), 4.12 (d, J = 6.9 Hz, 2H), 3.94 (s, 3H), 3.26 (dd, J = 6.5 Hz, 2H), 2.79 (q, J = 7.6 Hz, 2H), 1.78 (dd, J = 7.1 Hz, 2H), 1.48 - 1.40 (m, 2H), 1.33 (t, J = 7.6 Hz, 3H).

[0105] Example 1-4, N-(4-(l-lH-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methyl-2-pyridinyl)-l-lH-l,2,4- triazolyl)benzamide

[0106] Compound HJ004 was obtained by using a similar method to that for preparing compound HJ001, replacing 4-methoxybenzoic acid with 4-methylpyridine-2-carboxylic acid, and purified by column chromatography in a yield of 78%: 1H NMR (500 MHz, CDC13) δ 8.34-8.25 (m, 1H), 7.96-7.82 (m, 3H), 7.55 (s, 1H), 7.51-7.38 (m, 3H), 7.15 (s, 1H), 6.82 (s, 1H), 6.29 (dd, J = 2.0 Hz, 1H), 4.33-4.14 (m, 2H), 3.48 (dd, J = 5.8 Hz, 2H), 2.98-2.85 (m, 2H), 2.43 (s, 3H), 2.00 (dd, J = 7.2 Hz, 2H), 1.64 (dd, J = 6.9 Hz, 2H), 1.45 (t, J = 7.6, 1.7 Hz, 3H).

[0107] Example 1-5, N-(4-(l-lH-pyrazolyl)butyl)-3-(5-(4-chloro-2-pyridinyl)-3-ethyl-l-lH-l,2,4- triazolyl)benzamide

[0108] Compound HJ005 was obtained by using a similar method to that for preparing compound HJ001, replacing 4-methoxybenzoic acid with 4-chloropyridine-2-carboxylic acid, and purified by column chromatography in a yield of 82%: 1H NMR (500 MHz, CDC13) δ 8.29 (d, J = 5.3 Hz, 1H), 8.09 (d, J = 2.0 Hz, 1H), 7.93 (dd, 2H), 7.57 (d, J = 1.9 Hz, 1H), 7.50 (d, J = 4.7 Hz, 2H), 7.47-7.43 (m, 1H), 7.32-7.29 (m, 1H), 6.92 (s, 1H), 6.32 (d, J = 2.4 Hz, 1H), 4.32-4.24 (m, 2H), 3.54-3.43 (m, 2H), 2.96-2.87 (m, 2H), 2.01 (dd, J = 7.0 Hz, 2H), 1.65 (dd, J = 6.6 Hz, 2H), 1.45 (t, J = 7.7, 1.0 Hz, 3H).

[0109] Example 1-6, 3-(3-ethyl-5-(4-methoxyphenyl)-l-lH-l,2,4-triazolyl)-N-(4-(4-fluoro-l-lH-pyrazolyl)butyl)benzamide

[0110] Compound HJ006 was obtained by using a similar method to prepare compound HJ001, replacing 4-methoxybenzoic acid with 5-methoxy-2-pyrimidinecarboxylic acid, and purified by column chromatography in a yield of 87%: 1H NMR (500 MHz, CDC13) δ 8.83-8.76 (m, 2H), 8.02-7.90 (m, 2H), 7.58-7.48 (m, 2H), 7.38 (dd, J = 16.4, 4.4 Hz, 2H), 6.86 (s, 1H), 4.17 (t, J = 6.8 Hz, 2H), 3.50 (d, J = 6.2 Hz, 3H), 3.00 (dd, J = 7.6 Hz, 2H), 2.02-1.91 (m, 2H), 1.64 (dd, J = 7.0 Hz, 2H), 1.47 (t, J = 7.6, 1.0 Hz, 3H).

[0111] Example 1-7, 3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-lH-l,2,4-triazolyl)-N-(4-(4-fluoro-lH- pyrazolyl)butyl)benzamide

[0112] Compound HJ007 was obtained by using a similar method to prepare compound HJ006, replacing 4-methoxybenzoic acid with 5-methoxy-2-pyrimidinecarboxylic acid, and purified by column chromatography in a yield of 87%: 1H NMR (500 MHz, CDC13) δ 8.83-8.76 (m, 2H), 8.02-7.90 (m, 2H), 7.58-7.48 (m, 2H), 7.38 (dd, J = 16.4, 4.4 Hz, 2H), 6.86 (s, 1H), 4.17 (t, J = 6.8 Hz, 2H), 3.50 (d, J = 6.2 Hz, 3H), 3.00 (dd, J = 7.6 Hz, 2H), 2.02-1.91 (m, 2H), 1.64 (dd, J = 7.0 Hz, 2H), 1.47 (t, J = 7.6, 1.0 Hz, 3H).

[0113] Example 1-8, N-(4-(4-bromo-lH-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-lH-l,2,4- triazolyl)benzamide

[0114] Compound HJ008 was obtained by using a similar method to that for preparing compound HJ006, replacing 4-fluoro-1H-pyrazole with 4-bromo-1H-pyrazole, and purification by column chromatography in a yield of 86%:1H NMR (500 MHz, CDCl3) δ 8.04 (d, J = 6.7 Hz, 2H), 7.71 - 7.55 (m, 3H), 7.55 - 7.39 (m, 3H), 6.93 (d, J = 8.4 Hz, 3H), 4.19 (tt, J = 12.3, 6.7 Hz, 2H), 3.86 (s, 3H), 3.51 (d, J = 6.1 Hz, 2H), 3.09 (q, J = 7.5 Hz, 2H), 1.97 (q, J = 7.1 Hz, 2H), 1.67 - 1.62 (m, 2H), 1.50 (t, J = 7.5 Hz, 3H).

[0115] Example 1-9, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0116] Compound HJ009 was obtained by using a similar method to that for preparing compound HJ001, replacing 1H-pyrazole with 2H-1,2,3-triazole, and purification by column chromatography in a yield of 89%:1H NMR (500 MHz, CDCl3) δ 7.93 - 7.85 (m, 2H), 7.63 (d, J = 0.9 Hz, 2H), 7.53 - 7.39 (m, 4H), 6.87 (d, J = 8.4 Hz, 2H), 6.46 (s, 1H), 4.53 (t, 2H), 3.84 (d, J = 0.9 Hz, 3H), 3.49 (q, J = 6.4 Hz, 2H), 2.92 (dd, J = 7.6 Hz, 2H), 2.08 (dd, J = 6.7 Hz, 2H), 1.48 - 1.42 (m, 3H).

[0117] Example 1-10, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0118] Compound HJ009 was prepared by a similar method as described in the preparation of compound HJ008, using 4-methoxybenzoic acid instead of 5-bromopyrimidine-2-carboxylic acid. Compound HJ009 was purified by column chromatography to give a white solid in 74% yield: ¾ NMR (500 MHz, CDC13) δ 8.78 (d, J = 1.2 Hz, 2H), 7.93 - 7.89 (m, 1H), 7.87 (d, J = 1.8 Hz, 1H), 7.62 (d, J = 1.2 Hz, 2H), 7.55 - 7.46 (m, 2H), 6.51 (s, 1H), 4.57 - 4.50 (m, 2H), 3.50 (q, J = 6.4 Hz, 2H), 3.24 - 3.15 (m, 7H), 3.05 - 2.89 (m, 4H), 2.08 (dq, J = 14.7, 8.2, 7.6 Hz, 3H), 1.64 (t, J = 7.2 Hz, 3H).

[0119] Example 1-11, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)- 1-1H-1,2,4-triazolyl)benzamide

[0120] Compound HJ011 was prepared by a similar method as described in the preparation of compound HJ009, using 5-methoxypyrimidine-2-carboxylic acid instead of 5-bromopyrimidine-2-carboxylic acid. Compound HJ011 was purified by column chromatography to give a white solid in 69% yield: ¾ NMR (500 MHz, CDC13) δ 8.39 (s, 2H), 7.94 - 7.85 (m, 2H), 7.62 (s, 2H), 7.54 - 7.47 (m, 2H), 6.49 (s, 1H), 4.53 (t, J = 6.7 Hz, 2H), 3.96 (s, 3H), 3.50 (td, J = 6.9, 5.2 Hz, 2H), 2.97 (q, J = 7.6 Hz, 2H), 2.13 - 2.05 (m, 2H), 1.64 (dd, J = 7.0 Hz, 2H), 1.46 (t, J = 7.6 Hz, 3H).

[0121] Example 1-12, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(methoxy-d3)phenyl)-1-1H- 1,2,4-triazolyl)benzamide

[0122] Compound HJ012 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-methoxy-d3benzoic acid, and purifying by column chromatography in a yield of 78%: 1H NMR (500 MHz, CDC13) δ 7.92-7.84 (m, 2H), 7.63 (d, J = 1.2 Hz, 2H), 7.51-7.38 (m, 4H), 6.92-6.83 (m, 2H), 6.44 (s, 1H), 4.53 (td, J = 6.7, 1.2 Hz, 2H), 3.57-3.43 (m, 2H), 2.90 (q, J = 7.6 Hz, 2H), 2.13-2.03 (m, 2H), 1.66-1.61 (m, 2H), 1.44 (dd, J = 7.6, 1.2 Hz, 3H).

[0123] Example 1-13: N-(4-(4-bromo-2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4- methoxyphenyl)-l-lH-l,2,4-triazolyl)benzamide

[0124] Compound HJ013 was obtained by using a similar method to that used for preparing compound HJ009, replacing 2H-l,2,3-triazole with 4-bromo-2H-l,2,3-triazole, and purifying by column chromatography in a yield of 59%: 1H NMR (500 MHz, CDC13) δ 7.94-7.88 (m, 1H), 7.88-7.84 (m, 1H), 7.57 (d, J = 1.2 Hz, 1H), 7.52-7.47 (m, 1H), 7.47-7.39 (m, 3H), 6.90-6.84 (m, 2H), 6.40 (s, 1H), 4.51-4.44 (m, 2H), 3.83 (d, J = 1.3 Hz, 3H), 3.53-3.44 (m, 2H), 2.94-2.84 (m, 2H), 2.06 (dd, J = 7.0 Hz, 2H), 1.64 (dd, J = 7.6 Hz, 2H), 1.49-1.40 (m, 3H).

[0125] Example 1-14: N-(4-(4,5-dibromo-2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4- methoxyphenyl)-l-lH-l,2,4-triazolyl)benzamide

[0126] Compound HJ009 was obtained in 85% yield using a similar method to that used for the preparation of compound HJ009: ¾ NMR (500 MHz, CDC13) δ 8.24 (s, 1H), 8.17 (d, J = 7.7 Hz, 1H), 7.86 (s, 2H), 7.71 (d, J = 8.4 Hz, 2H), 7.65 - 7.59 (m, 1H), 7.48 (d, J = 8.1 Hz, 2H), 6.91 (d, J = 8.4 Hz, 2H), 4.54 (s, 2H), 3.84 (d, J = 1.2 Hz, 3H), 3.53 (d, J = 6.0 Hz, 2H), 3.13 (q, J = 7.4 Hz, 2H), 2.13 - 2.04 (m, 2H), 1.71 (dd, 2H), 1.55 - 1.47 (m, 3H).

[0127] Example 1-15, N-(4-(l-lH-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l- lH-l,2,4-triazolyl)benzamide

[0128] Compound HJ015 was obtained in 85% yield using a similar method to that used for the preparation of compound HJ009: ¾ NMR (500 MHz, CDC13) δ 8.24 (s, 1H), 8.17 (d, J = 7.7 Hz, 1H), 7.86 (s, 2H), 7.71 (d, J = 8.4 Hz, 2H), 7.65 - 7.59 (m, 1H), 7.48 (d, J = 8.1 Hz, 2H), 6.91 (d, J = 8.4 Hz, 2H), 4.54 (s, 2H), 3.84 (d, J = 1.2 Hz, 3H), 3.53 (d, J = 6.0 Hz, 2H), 3.13 (q, J = 7.4 Hz, 2H), 2.13 - 2.04 (m, 2H), 1.71 (dd, 2H), 1.55 - 1.47 (m, 3H).

[0129] Example 1-16, N-(4-(l-lH-l,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3- ethyl-l-lH-l,2,4-triazolyl)benzamide

[0130] Compound HJ016 was obtained simultaneously using a similar method to that used for preparing compound HJ010, and compound HJ016 was obtained after column chromatography purification with a yield of 83%: 1H NMR (500 MHz, CDC13) δ 8.81 (d, J = 1.2 Hz, 2H), 8.50 (s, 2H), 8.40 (s, 1H), 8.19 (d, J = 6.6 Hz, 1H), 7.63 (d, J = 6.4 Hz, 3H), 4.71 (t, J = 7.2 Hz, 2H), 3.54 (s, 2H), 3.11 (q, J = 7.6 Hz, 2H), 2.14 (d, J = 7.4 Hz, 2H), 1.52 - 1.45 (m, 3H).

[0131] Example 1-17, N-(4-(4-bromo-1-1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4- methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0132] Compound HJ017 was obtained simultaneously using a similar method to that used for preparing compound HJ013, and compound HJ017 was obtained after column chromatography purification with a yield of 80%: 1H NMR (500 MHz, CDC13) δ 7.88 (d, J = 8.8 Hz, 2H), 7.61 (d, J = 1.1 Hz, 1H), 7.55 - 7.39 (m, 4H), 6.93 - 6.84 (m, 2H), 6.41 (s, 1H), 4.48 - 4.41 (m, 2H), 3.84 (d, J = 1.1 Hz, 3H), 3.55 - 3.47 (m, 2H), 2.91 (q, J = 7.7 Hz, 2H), 2.02 (dd, J = 7.1 Hz, 2H), 1.65 (dd, J = 7.3 Hz, 2H), 1.47 - 1.40 (m, 3H).

[0133] Example 1-18, N-(4-(1-1H-1,2,4-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1- 1H-1,2,4-triazolyl)benzamide

[0134] Compound HJ009 was prepared in a similar manner as described in the preparation of compound HJ008, except that 2H-1,2,3-triazole was replaced with 1 H-1,2,4-triazole. Compound HJ018 was obtained in 74% yield after purification by column chromatography:1H NMR (500 MHz, CDCI3) δ 8.18 (s, 1 H), 7.99 (s, 1 H), 7.91 (d, J = 6.7 Hz, 2H), 7.55 - 7.44 (m, 3H), 7.41 (d, J = 7.9 Hz, 1 H), 6.88 (d, J = 8.5 Hz, 2H), 6.57 (s, 1 H), 4.28 (t, J = 6.8 Hz, 2H), 3.84 (s, 3H), 3.51 (q, J = 6.5 Hz, 2H), 2.93 (q, J = 7.6 Hz, 2H), 2.01 (p, J = 6.9 Hz, 2H), 1.65 (p, J = 7.1 Hz, 2H), 1.45 (t, J = 7.6 Hz, 3H).

[0135] Example 1-19, N-(4-(1 -1 H-1,2,4-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3- ethyl-1 -1 H-1,2,4-triazolyl)benzamide

[0136] Compound HJ019 was prepared in a similar manner as described in the preparation of compound HJ018, except that 4-methoxybenzoic acid was replaced with 5-methoxy pyrimidine-2-carboxylic acid. Compound HJ019 was obtained in 87% yield after purification by column chromatography:1H NMR (500 MHz, CDCI3) δ 9.17 (s, 1 H), 8.80 (s, 2H), 8.25 (s, 1 H), 7.99 (s, 2H), 7.53 (d, J = 4.3 Hz, 2H), 7.00 (s, 1 H), 4.40 (s, 2H), 3.53 (s, 2H), 2.92 (q, J = 7.6 Hz, 2H), 2.06 (d, J = 5.7 Hz, 2H), 1.43 (t, J = 7.6 Hz, 3H).

[0137] Example 1-20, N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1 -1 H-1,2,4- triazolyl)benzamide

[0138] Compound HJ020 was obtained in 82% yield using a similar procedure to that used for the preparation of compound HJ001, replacing 1H-pyrazole with 1H-tetrazole, and purified by column chromatography:1H NMR (500 MHz, CDC13) δ 8.54 (s, 1H), 7.91 - 7.78 (m, 2H), 7.57 - 7.37 (m, 4H), 6.93 - 6.83 (m, 2H), 6.30 (s, 1H), 4.74 (t, J = 6.8 Hz, 2H), 3.84 (s, 3H), 3.52 (dd, J = 6.6 Hz, 2H), 2.91 (q, J = 7.6 Hz, 2H), 2.14 (dd, J = 7.0 Hz, 2H), 1.69 - 1.64 (m, 2H), 1.44 (t, J = 7.6 Hz, 3H).

[0139] Example 1-21, N-(4-(2-2H-tetrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3- ethyl-1H-1, 2, 4-triazol-1-yl)benzamide

[0140] Compound HJ021 was obtained in 80% yield using a similar procedure to that used for the preparation of compound HJ020, replacing 4-methoxybenzoic acid with 5-bromo pyrimidine-2-carboxylic acid, and purified by column chromatography:1H NMR (500 MHz, CDC13) δ 8.79 (s, 2H), 8.53 (d, J = 1.4 Hz, 1H), 7.92 - 7.82 (m, 2H), 7.57 - 7.44 (m, 2H), 6.34 (s, 1H), 4.77 - 4.71 (m, 2H), 3.53 (q, J = 6.3 Hz, 2H), 2.99 - 2.89 (m, 2H), 2.15 (dd, J = 6.7 Hz, 2H), 1.71 - 1.63 (m, 2H), 1.48 - 1.40 (m, 3H). Example 1-22, N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1- 1H-1, 2, 4-triazolyl)benzamide

[0141] Compound HJ022 was obtained by using a similar method to that used for preparing compound HJ020, by replacing 4-methoxybenzoic acid with 5-methoxy- pyrimidine-2-carboxylic acid, and purified by column chromatography in a yield of 77%: 1H NMR (500 MHz, CDC13) δ 8.52 (s, 1H), 8.36 (s, 2H), 7.91 - 7.83 (m, 2H), 7.52 - 7.44 (m, 2H), 6.59 (s, 1H), 4.73 (t, J = 6.9 Hz, 2H), 3.95 (s, 3H), 3.52 (dd, J = 6.6 Hz, 2H), 2.94 - 2.86 (m, 2H), 2.13 (p, J = 7.0 Hz, 2H), 1.69 - 1.62 (m, 2H), 1.43 (q, J = 7.6, 0.9 Hz, 3H).

[0142] Example 1-23, N-(4-(l-lH-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l-lH-l,2,4- triazolyl)benzamide

[0143] Compound HJ023 was obtained by using a similar method to that used for preparing compound HJ020, and purified by column chromatography in a yield of 58%: 1H NMR (500 MHz, CDC13) δ 8.72 (s, 1H), 7.99 - 7.88 (m, 2H), 7.52 (dd, J = 17.3, 8.5 Hz, 3H), 7.43 (d, J = 7.9 Hz, 1H), 6.88 (d, J = 8.1 Hz, 2H), 6.64 (s, 1H), 4.54 (d, J = 7.1 Hz, 2H), 3.84 (d, J = 1.7 Hz, 3H), 3.54 (d, J = 6.5 Hz, 2H), 2.94 (d, J = 7.8 Hz, 2H), 2.06 (dd, J = 7.4 Hz, 2H), 1.74 - 1.64 (m, 3H), 1.48 - 1.42 (m, 3H).

[0144] Example 1-24, N-(6-(2-2H-l,2,3-triazolyl)hexyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l-lH-l,2,4- triazolyl)benzamide

[0145] Compound HJ024 was obtained by using a similar method to that for preparing compound HJ009, replacing 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(6-bromohexyl)isoindoline-1,3-dione, and purifying by column chromatography in a yield of 79%:1H NMR (500 MHz, CDC13) δ 7.93 - 7.79 (m, 2H), 7.60 (s, 2H), 7.56 - 7.39 (m, 4H), 6.88 (d, J = 8.4 Hz, 2H), 6.22 (s, 1H), 4.51 - 4.44 (m, 2H), 3.84 (s, 3H), 3.43 (dd, J = 6.6 Hz, 2H), 2.92 (q, J = 7.6 Hz, 2H), 2.00 (dd, J = 7.1 Hz, 2H), 1.61 (dd, J = 7.2 Hz, 2H), 1.49 - 1.39 (m, 5H), 1.39 - 1.31 (m, 2H).

[0146] Example 1-25, N-(5-(2-2H-1,2,3-triazolyl)pentyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0147] Compound HJ025 was obtained by using a similar method to that for preparing compound HJ009, replacing 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(5-bromopentyl)isoindoline-1,3-dione, and purifying by column chromatography in a yield of 69%:1H NMR (500 MHz, CDC13) δ 7.88 (d, J = 7.7 Hz, 1H), 7.83 (s, 1H), 7.59 (d, J = 1.2 Hz, 2H), 7.53 - 7.45 (m, 3H), 7.42 (d, J = 7.9 Hz, 1H), 6.94 - 6.83 (m, 2H), 6.22 (s, 1H), 4.54 - 4.44 (m, 2H), 3.84 (s, 3H), 3.45 (d, J = 6.5 Hz, 2H), 2.93 (q, J = 7.6 Hz, 2H), 2.08 - 1.99 (m, 2H), 1.67 (dd, J = 7.4 Hz, 2H), 1.45 (dd, J = 7.6, 1.1 Hz, 3H), 1.41 - 1.35 (m, 2H).

[0148] Example 1-26, N-(3-(2-2H-1,2,3-triazolyl)propyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0149] Compound HJ026 was obtained by using a similar method to that for preparing compound HJ009, replacing 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(3-bromopropyl)isoindoline-1,3-dione, and purifying by column chromatography in a yield of 65%:1H NMR (500 MHz, CDC13) δ 7.94 - 7.83 (m, 2H), 7.64 (s, 2H), 7.53 - 7.40 (m, 4H), 6.91 - 6.79 (m, 3H), 4.64 - 4.54 (m, 2H), 3.82 (s, 3H), 3.46 (q, J = 6.2 Hz, 2H), 2.91 (dd, J = 7.6 Hz, 2H), 2.27 (dd, J = 6.4 Hz, 2H), 1.45 (t, J = 7.6 Hz, 3H).

[0150] Example 1-27, N-(2-(2H-1,2,3-triazol-2-yl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1H-1,2,4-triazol-1- yl)benzamide

[0151] Compound HJ027 was obtained by using a similar method to that for preparing compound HJ009, replacing 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(2-bromoethyl)isoindoline-1,3-dione, and purifying by column chromatography in a yield of 58%:1H NMR (500 MHz, CDC13) δ 7.85 (d, J = 8.0 Hz, 2H), 7.66 (d, J = 1.8 Hz, 2H), 7.54 - 7.41 (m, 4H), 6.88 (dd, J = 8.8, 1.8 Hz, 3H), 4.74 - 4.64 (m, 2H), 4.05 - 3.99 (m, 2H), 3.84 (d, J = 1.7 Hz, 3H), 2.93 (dd, J = 7.7 Hz, 2H), 1.45 (t, J = 7.6, 1.7 Hz, 3H).

[0152] Example 1-28, N-(2-(1-1H-pyrazolyl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0153] Compound HJ028 was obtained by using a similar method to that for preparing compound HJ001, replacing 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(2-bromoethyl)isoindoline-1,3-dione, and purifying by column chromatography in a yield of 76%:1H NMR (500 MHz, CDCl3) δ 7.95-7.84 (m, 2H), 7.63-7.38 (m, 6H), 7.29 (s, 1H), 6.94-6.87 (m, 2H), 6.31 (dd, J = 2.3 Hz, 1H), 4.44-4.30 (m, 2H), 3.95-3.87 (m, 2H), 3.85 (q, J = 1.2 Hz, 3H), 3.08-2.95 (m, 2H), 1.53-1.44 (m, 3H).

[0154] Example 1-29, N-(2-(1-1H-pyrazolyl)ethyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0155] Compound HJ029 was obtained by using a similar method to that for preparing compound HJ002, replacing 2-(4-bromobutyl)isoindoline-1,3-dione with 2-(2-bromoethyl)isoindoline-1,3-dione, and purifying by column chromatography in a yield of 47%:1H NMR (500 MHz, CDCl3) δ 8.79 (d, J = 1.2 Hz, 2H), 7.96 (dd, J = 3.6, 1.4 Hz, 1H), 7.90 (s, 1H), 7.73-7.68 (m, 1H), 7.59 (d, J = 2.4 Hz, 1H), 7.58-7.50 (m, 3H), 6.46-6.40 (m, 1H), 4.68-4.58 (m, 2H), 3.99 (dd, J = 5.5 Hz, 2H), 2.95 (dd, J = 7.6, 1.1 Hz, 2H), 1.49-1.42 (m, 3H).

[0156] Example 1-30, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(2-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0157] Compound HJ030 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 2-methoxybenzoic acid, and purifying by column chromatography in a yield of 87%: 1H NMR (500 MHz, CDC13) δ 7.81 (d, J = 7.5 Hz, 1H), 7.76 (s, 1H), 7.62 (d, J = 17.6 Hz, 3H), 7.50 - 7.33 (m, 3H), 7.13 - 7.04 (m, 1H), 6.83 (d, J = 8.4 Hz, 1H), 6.35 (s, 1H), 4.52 (d, J = 6.7 Hz, 2H), 3.49 - 3.41 (m, 2H), 3.36 (s, 3H), 2.95 (q, J = 7.6 Hz, 2H), 2.06 (dd, J = 6.9 Hz, 2H), 1.61 (dd, J = 7.1 Hz, 2H), 1.46 (t, J = 7.6 Hz, 3H).

[0158] Example 1-31, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(3-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0159] Compound HJ031 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 3-methoxybenzoic acid, and purifying by column chromatography in a yield of 58%: 1H NMR (500 MHz, CDC13) δ 7.94 - 7.85 (m, 2H), 7.63 (d, J = 1.2 Hz, 2H), 7.50 (dd, J = 7.8 Hz, 1H), 7.42 (d, J = 8.0 Hz, 1H), 7.26 - 7.21 (m, 1H), 7.18 (s, 1H), 6.98 (dd, J = 7.1, 6.1, 1.9 Hz, 2H), 6.46 (s, 1H), 4.58 - 4.49 (m, 2H), 3.78 (d, J = 1.1 Hz, 3H), 3.49 (dd, J = 6.1 Hz, 2H), 2.95 (q, J = 7.6 Hz, 2H), 2.14 - 2.03 (m, 2H), 1.64 (dd, J = 6.9, 6.1 Hz, 2H), 1.46 (t, 3H).

[0160] Example 1-32, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-hydroxyphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0161] Compound HJ032 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-hydroxybenzoic acid, and purifying by column chromatography, in a yield of 67%: 1H NMR (500 MHz, DMSO-d6) δ 9.95 (s, 1H), 8.60 (d, J = 5.5 Hz, 1H), 7.95 - 7.87 (m, 2H), 7.76 (d, J = 1.0 Hz, 2H), 7.58 - 7.51 (m, 1H), 7.47 - 7.40 (m, 1H), 7.24 (d, J = 8.4 Hz, 2H), 6.78 - 6.70 (m, 2H), 4.50 - 4.41 (m, 2H), 3.27 (d, J = 6.4 Hz, 2H), 2.73 (q, J = 7.5 Hz, 2H), 1.89 (dd, J = 7.0 Hz, 2H), 1.45 (dd, J = 7.0 Hz, 2H), 1.33 - 1.27 (m, 3H).

[0162] Example 1-33, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-nitrophenyl)-1-1H-1,2,4- triazolyl)benzamide

[0163] Compound HJ033 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-nitrobenzoic acid, and purifying by column chromatography, in a yield of 64%: 1H NMR (500 MHz, CDC13) δ 8.27 - 8.21 (m, 2H), 7.95 (d, J = 8.3 Hz, 2H), 7.77 (dd, J = 8.7, 1.5 Hz, 2H), 7.63 (d, J = 1.4 Hz, 2H), 7.58 - 7.52 (m, 1H), 7.43 - 7.38 (m, 1H), 6.55 (s, 1H), 4.57 - 4.49 (m, 2H), 3.50 (q, J = 6.2 Hz, 2H), 3.02 - 2.93 (m, 2H), 2.09 (dd, J = 7.0 Hz, 2H), 1.65 (dd, J = 7.1 Hz, 2H), 1.48 (t, J = 7.5, 1.4 Hz, 3H).

[0164] Example 1-34, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethoxy)phenyl)-1-1H-1,2,4- triazolyl)benzamide

[0165] Compound HJ034 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-trifluoromethoxybenzoic acid, and purifying by column chromatography in a yield of 71 %:1H NMR (500 MHz, CDCI3) δ 7.90 (m, J = 6.2, 1.8 Hz, 2H), 7.63 (d, J = 1.8 Hz, 2H), 7.57 - 7.47 (m, 3H), 7.41 - 7.35 (m, 1H), 7.20 (d, J = 8.2 Hz, 2H), 6.57 - 6.45 (m, 1H), 4.53 (d, J = 6.8, 1.8 Hz, 2H), 3.54 - 3.44 (m, 2H), 2.90 (q, J = 7.6, 1.8 Hz, 2H), 2.13 - 2.04 (m, 2H), 1.68 - 1.60 (m, 2H), 1.44 (t, J = 7.6, 1.8 Hz, 3H).

[0166] Example 1-35, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-aminophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0167] HJ033 was dissolved in methanol, and a catalytic amount of palladium-carbon was added, and the reaction was carried out in a hydrogen atmosphere at room temperature for 24 h, and then filtered, and purified by column chromatography to obtain HJ035. Yield: 82 %.1H NMR (500 MHz, CDCI3) δ 8.25 - 8.21 (m, 2H), 7.93 (d, J = 8.3 Hz, 2H), 7.87 (dd, J = 8.7, 1.5 Hz, 2H), 7.61 (d, J = 1.4 Hz, 2H), 7.55 - 7.52 (m, 1H), 7.41 - 7.35 (m, 1H), 6.45 (s, 1H), 5.42 (s, 2H), 4.59 - 4.42 (m, 2H), 3.54 (q, J = 6.2 Hz, 2H), 3.07 - 2.96 (m, 2H), 2.19 (dd, J = 7.0 Hz, 2H), 1.75 (dd, J = 7.1 Hz, 2H), 1.46 (t, J = 7.5, 1.4 Hz, 3H).

[0168] Example 1-36, N-(4-(2H-1,2,3-triazol-2-yl)butyl)-3-(3-ethyl-5-(4-fluorophenyl)-1H-1,2,4-triazol-1-yl)benzamide

[0169] Compound HJ036 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-fluorobenzoic acid, and purifying by column chromatography in a yield of 75%: 1H NMR (500 MHz, CDC13) δ 7.91-7.86 (m, 2H), 7.63 (s, 2H), 7.51-7.45 (m, 3H), 7.39-7.35 (m, 1H), 7.10-7.02 (m, 2H), 6.57-6.50 (m, 1H), 4.53 (t, J = 6.7 Hz, 2H), 3.49 (dd, J = 6.5 Hz, 2H), 2.89 (q, J = 7.6 Hz, 2H), 2.12-2.03 (m, 2H), 1.63 (dd, J = 7.0 Hz, 2H), 1.44 (t, J = 7.6 Hz, 3H).

[0170] Example 1-37, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-chlorophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0171] Compound HJ037 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-chlorobenzoic acid, and purifying by column chromatography in a yield of 86%: 1H NMR (500 MHz, CDC13) δ 7.94-7.83 (m, 2H), 7.66-7.58 (m, 2H), 7.53-7.47 (m, 1H), 7.47-7.40 (m, 2H), 7.40-7.31 (m, 3H), 6.54 (s, 1H), 4.54 (dd, J = 6.7, 1.3 Hz, 2H), 3.50 (dd, J = 6.4 Hz, 2H), 2.90 (qd, J = 7.6, 1.4 Hz, 2H), 2.09 (p, J = 6.9 Hz, 2H), 1.64 (dd, J = 7.4 Hz, 2H), 1.44 (t, J = 7.8, 2.1 Hz, 3H).

[0172] Example 1-38, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(4-bromophenyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide

[0173] Compound HJ038 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-bromobenzoic acid, and purifying by column chromatography in a yield of 55%: 1H NMR (500 MHz, CDC13) δ 7.77 (dd, J = 4.6, 2.5 Hz, 2H), 7.65 (d, J = 0.8 Hz, 2H), 7.63 - 7.59 (m, 1H), 7.52 - 7.48 (m, 1H), 7.46 - 7.40 (m, 1H), 7.40 - 7.30 (m, 3H), 6.36 (s, 1H), 4.54 (t, J = 6.7 Hz, 2H), 3.46 (dd, J = 6.5 Hz, 2H), 2.94 (dd, J = 7.5 Hz, 2H), 2.07 (p, J = 6.9 Hz, 2H), 1.61 (dd, J = 7.1 Hz, 2H), 1.46 (td, 3H).

[0174] Example 1-39, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethyl)phenyl)-1-1H-1,2,4-triazolyl)benzamide

[0175] Compound HJ039 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-trifluoromethylbenzoic acid, and purifying by column chromatography in a yield of 76%: 1H NMR (500 MHz, CDC13) δ 7.95 - 7.89 (m, 2H), 7.63 (dd, J = 4.0, 2.1 Hz, 6H), 7.54 - 7.48 (m, 1H), 7.39 - 7.34 (m, 1H), 6.51 (t, J = 5.7 Hz, 1H), 4.53 (td, J = 6.7, 2.1 Hz, 2H), 3.54 - 3.46 (m, 2H), 2.91 (qd, J = 7.6, 2.1 Hz, 2H), 2.12 - 2.06 (m, 2H), 1.67 - 1.59 (m, 2H), 1.45 (q, J = 7.7, 2.1 Hz, 3H).

[0176] Example 1-40, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-phenyl-1-1H-1,2,4-triazolyl)benzamide

[0177] Compound HJ040 was obtained by using a similar method to that for preparing compound HJ009, replacing benzoic acid with 4-methoxybenzoic acid, and purification by column chromatography in a yield of 47%: 1H NMR (500 MHz, CDC13) δ 7.91 - 7.86 (m, 1H), 7.84 (dd, J = 1.7 Hz, 1H), 7.63 (d, J = 1.2 Hz, 2H), 7.53 - 7.33 (m, 7H), 6.42 (s, 1H), 4.52 (dd, J = 6.7, 1.2 Hz, 2H), 3.53 - 3.43 (m, 2H), 2.91 (q, J = 7.6, 1.2 Hz, 2H), 2.11 - 2.02 (m, 2H), 1.61 (dd, J = 7.3 Hz, 2H), 1.49 - 1.40 (m, 3H).

[0178] Example 1-41, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(p-tolyl)-1-1H-1,2,4- triazolyl)benzamide

[0179] Compound HJ041 was obtained by using a similar method to that for preparing compound HJ009, replacing benzoic acid with 4-methylbenzoic acid, and purification by column chromatography in a yield of 58%: 1H NMR (500 MHz, CDC13) δ 7.93 - 7.83 (m, 2H), 7.63 (s, 2H), 7.51 - 7.44 (m, 1H), 7.42 - 7.34 (m, 3H), 7.16 (d, J = 7.9 Hz, 2H), 6.44 (s, 1H), 4.53 (t, J = 6.7 Hz, 2H), 3.49 (dd, J = 6.7 Hz, 2H), 2.90 (q, J = 7.6 Hz, 2H), 2.37 (s, 3H), 2.08 (dq, J = 9.1, 6.9 Hz, 2H), 1.62 (dd, J = 7.0 Hz, 2H), 1.44 (t, 3H).

[0180] Example 1-42, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(p-tolyl)-1-1H-1,2,4- triazolyl)benzamide

[0181] Compound HJ042 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-propylbenzoic acid, and purified by column chromatography in a yield of 70%: 1H NMR (500 MHz, CDC13) δ 7.94 - 7.86 (m, 2H), 7.63 (d, J = 1.2 Hz, 2H), 7.52 - 7.45 (m, 1H), 7.44 - 7.37 (m, 3H), 7.17 (d, J = 7.8 Hz, 2H), 6.48 (s, 1H), 4.57 - 4.47 (m, 2H), 3.53 - 3.43 (m, 2H), 2.91 (q, J = 7.7 Hz, 2H), 2.60 (dd, J = 7.7 Hz, 2H), 2.13 - 2.02 (m, 2H), 1.68 - 1.59 (m, 4H), 1.44 (t, J = 7.6, 1.3 Hz, 3H), 0.93 (t, J = 7.3, 1.2 Hz, 3H).

[0182] Example 1-43, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-propylphenyl)-1-1H-1,2,4-triazolyl)benzamide

[0183] Compound HJ043 was obtained by using a similar method to that used for preparing compound HJ009, replacing 4-methoxybenzoic acid with 4-propylbenzoic acid, and purified by column chromatography in a yield of 70%: 1H NMR (500 MHz, CDC13) δ 7.94 - 7.86 (m, 2H), 7.63 (d, J = 1.2 Hz, 2H), 7.52 - 7.45 (m, 1H), 7.44 - 7.37 (m, 3H), 7.17 (d, J = 7.8 Hz, 2H), 6.48 (s, 1H), 4.57 - 4.47 (m, 2H), 3.53 - 3.43 (m, 2H), 2.91 (q, J = 7.7 Hz, 2H), 2.60 (dd, J = 7.7 Hz, 2H), 2.13 - 2.02 (m, 2H), 1.68 - 1.59 (m, 4H), 1.44 (t, J = 7.6, 1.3 Hz, 3H), 0.93 (t, J = 7.3, 1.2 Hz, 3H).

[0184] Example 1-44, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyridinyl)-1-1H-1,2,4-triazolyl)benzamide

[0185] Compound HJ044 was obtained by using the similar method to prepare compound HJ009, replacing 4-methoxybenzoic acid with 5-methoxypyridinecarboxylic acid, and purified by column chromatography in a yield of 85%: 1H NMR (500 MHz, CDCl3) δ 8.15-8.09 (m, 1H), 8.05 (s, 1H), 7.91-7.85 (m, 2H), 7.62 (d, J = 2.0 Hz, 2H), 7.53-7.44 (m, 2H), 7.28-7.25 (m, 1H), 6.50 (s, 1H), 4.57-4.48 (m, 2H), 3.89 (d, J = 2.0 Hz, 3H), 3.49 (qd, J = 6.9, 2.0 Hz, 2H), 2.99-2.89 (m, 2H), 2.12-2.06 (m, 2H), 1.63 (dd, J = 15.1, 1.9 Hz, 2H), 1.52-1.41 (m, 3H).

[0186] Example 1-45, N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(6-methoxy-3-pyridinyl)-1-1H-1,2,4-triazolyl)benzamide

[0187] Compound HJ045 was obtained by using the similar method to prepare compound HJ009, replacing 4-methoxybenzoic acid with 6-methoxynicotinic acid, and purified by column chromatography in a yield of 67%: 1H NMR (500 MHz, CDCl3) δ 8.29-8.24 (m, 1H), 7.93-7.85 (m, 2H), 7.75-7.68 (m, 1H), 7.63 (d, J = 1.6 Hz, 2H), 7.55-7.49 (m, 1H), 7.44-7.40 (m, 1H), 6.74 (dd, J = 8.7, 1.5 Hz, 1H), 6.52 (s, 1H), 4.53 (td, J = 6.7, 1.5 Hz, 2H), 3.95 (s, 3H), 3.49 (dt, J = 7.3, 5.6 Hz, 2H), 2.95-2.85 (m, 2H), 1.63 (dq, J = 14.0, 6.7, 6.3 Hz, 2H), 1.47-1.40 (m, 3H).

[0188] 1. Cell culture

[0189] The cells used in the experiment were purchased from the American Type Culture Collection (ATCC) and the Chinese Academy of Sciences Cell Bank. 10% FBS and 1% penicillin-streptomycin double antibody were added to the cell culture medium, and the culture medium was prepared according to the culture requirements provided when the cells were purchased. The cells were cultured in a 37°C incubator with a 5% CO2 concentration.

[0190] 2. SRB (sulfonylrhodamine) method for determining cell proliferation

[0191] Tumor cells expressing high levels of MYOF were seeded at appropriate densities into 96-well Corning plates and cultured at 37°C for 24 h. Then, a diluted concentration of the compound prepared in Example 1 of this invention was added to each well, resulting in final concentrations of 0.01 μM, 0.05 μM, 0.1 μM, 0.5 μM, and 1.0 μM, respectively. An equal volume of DMSO was added to the control group. Three accessory wells were included in each group. After culturing for another 48 h, 25 μl of pre-cooled TCA (trichloroacetic acid, 50%, w / v) was added to each well and gently mixed. Cells were fixed by incubation at 4°C for 1 h, gently rinsed five times with distilled water, and air-dried. 50 μl of SRB staining solution (4%, w / v) was added to each well, and the cells were incubated at room temperature for 30 min. The staining solution was aspirated, and the cells were quickly rinsed multiple times with 1% acetic acid to remove unbound dye. After air-drying, 100 μl of 10 mmol / L Tris solution was added to each well, and the bound SRB dye was dissolved by shaking. The 96-well plate was placed in a microplate reader (SPECTRAMAX 190), and the OD value was measured at a wavelength of 515 nm. Statistical data were analyzed using a GraphPad Prism 7 to assess the effect of the drug on cell proliferation. Cell viability was calculated using the following formula, and the effect of the compound prepared in Example 1 of this invention on cell proliferation was statistically analyzed.

[0192]

[0193] Furthermore, experiments were conducted on the proliferation inhibition effects of the compounds prepared in Example 1 of this invention on various tumor cells, including liver cancer cells, lung cancer cells, prostate cancer cells, skin cancer cells, colon cancer cells, pancreatic cancer cells, breast cancer cells, leukemia cells, ovarian cancer cells, gastric cancer cells, bladder cancer cells, kidney cancer cells, and oral cancer cells, and similar significant inhibitory effects were achieved in all cases.

[0194] The experimental results are attached. Figure 1 As shown in Table 2, the compound HJ001 prepared in Example 1 of the present invention can significantly inhibit the proliferation of tumor cells with high MYOF expression at a low nanomolar concentration, while it basically loses its inhibitory effect on tumor cells or normal cells with low MYOF expression. This also preliminarily indicates that the compound HJ001 prepared in Example 1 of the present invention has a certain selectivity for tumor cells with high MYOF expression.

[0195] Table 2. Results of in vitro antitumor proliferative activity tests of compounds HJ001-HJ045 in this invention.

[0196]

[0197]

[0198] Example 3: Clonogenic Assay

[0199] Gastric cancer cells were digested and seeded in 6-well plates at appropriate density. After 24h incubation, different concentrations of compound HJ001 prepared in Example 1 were added to the cells, and the same volume of DMSO was added to the control group. After 7-14 days of incubation, the cells were fixed with 4% paraformaldehyde for 30 min, and stained with 0.2% crystal violet for 10 min. After washing with PBS to remove the unbound crystal violet dye, the plates were air-dried at room temperature. The number of colonies in each group was counted after taking pictures with a camera. As shown in FIG. 2A, compound HJ001 prepared in Example 1 could significantly inhibit the clonogenicity of gastric cancer cells at a concentration of 50 nM / L and 100 nM / L. As shown in FIG. 2B, the inhibitory effect of compound HJ001 prepared in Example 1 on the clonogenicity of gastric cancer cells was concentration-dependent. In addition, similar experiments also showed that other compounds of the present application also had similar effects on inhibiting the clonogenicity of cancer cells. Figure 2 A, compound HJ001 prepared in Example 1 could significantly inhibit the clonogenicity of gastric cancer cells at a concentration of 50 nM / L and 100 nM / L. As shown in FIG. 2B, the inhibitory effect of compound HJ001 prepared in Example 1 on the clonogenicity of gastric cancer cells was concentration-dependent. In addition, similar experiments also showed that other compounds of the present application also had similar effects on inhibiting the clonogenicity of cancer cells. Figure 2 B, the inhibitory effect of compound HJ001 prepared in Example 1 on the clonogenicity of gastric cancer cells was concentration-dependent. In addition, similar experiments also showed that other compounds of the present application also had similar effects on inhibiting the clonogenicity of cancer cells.

[0200] Example 4: Transwell Migration Assay

[0201] 1. Pretreat gastric cancer cells with 1.10 μg / mL mitomycin C for 2h to eliminate the interference of cell proliferation during migration. After digestion and centrifugation, resuspend the cells in serum-free medium;

[0202] 2. Use forceps to clamp the Transwell chamber and place it in the center of the 24-well plate (upper chamber). Add 300 μL of serum-free medium containing an appropriate amount of cells to the upper chamber, and add 600 μL of complete medium containing 10% serum to the lower chamber of each well of the 24-well plate to induce cell migration;

[0203] 3. Add different concentrations of compound HJ001 prepared in Example 1 to the upper and lower chambers of the Transwell, with 3 replicates for each concentration;

[0204] 4. After 12-36h of incubation in a 37°C incubator, remove the 24-well plate and fix the cells in the Transwell with 4% paraformaldehyde for 30 min

[0205] 5. Carefully wipe off the surface of the upper chamber of the Transwell with wet cotton to remove the un-migrated cells;

[0206] 6. Soak the Transwell chamber in 0.2% crystal violet dye for 5 min, then wash off the excess dye with water and carefully wipe it off with cotton;

[0207] 7. Collect the cell migration situation in multiple different fields under an inverted microscope.

[0208] The experimental results are shown in Figures 1-3. Figure 3 As shown in Figure 1, the compound HJ001 prepared in Example One of the present application can significantly inhibit the migration of gastric cancer cells with high expression of MYOF in a low concentration-dependent manner. As shown in Figure 2, the compound HJ001 prepared in Example One of the present application can significantly inhibit the migration of gastric cancer cells at concentrations of 62.5 nanomoles per liter, 125 nanomoles per liter, and 250 nanomoles per liter. As shown in Figure 3, the inhibition of gastric cancer cell migration by the compound HJ001 prepared in Example One of the present application is concentration-dependent. In addition, similar experiments have also shown that other compounds of the present application also have similar effects on inhibiting the migration of cancer cells. Figure 3 Figure 3 As shown in Figure 3, the inhibition of gastric cancer cell migration by the compound HJ001 prepared in Example One of the present application is concentration-dependent. In addition, similar experiments have also shown that other compounds of the present application also have similar effects on inhibiting the migration of cancer cells.

[0209] Example Five: Test method for the saturated solubility of the compound of the present application in water

[0210] In the present application, the determination method is the saturated shake flask method for determining the thermodynamic solubility. The thermodynamic solubility refers to how much of the compound is dissolved in the solution.

[0211] 1. Determine the chromatographic conditions

[0212] 2. Prepare a standard curve

[0213] Precisely weigh 1 mg of the test compound, add methanol solution to prepare a 10 mM clear solution (for poorly soluble compounds, DMSO can be used instead of methanol), and dilute with methanol to become 200, 100, 50, 25, 12.5, 6.25, 3.125, 1.5625 μM of 100 μL series of control solution. Precisely pipette 20 μL of each series of control solution into the high performance liquid chromatograph, record the peak area, measure twice for each concentration, and calculate the average value of the peak area. Perform linear regression with the mass concentration as the abscissa and the peak area (A) as the ordinate to obtain the linear regression equation.

[0214] 3. Prepare phosphate buffer solutions with different pH values

[0215] Prepare PBS solutions with pH values of 2.0, 7.4, and 9.0.

[0216] Buffer: 50 mM phosphate buffer, pH 2.0: 1.44 g H3PO4, dissolved in a flask with about 240 mL water. Then adjust the pH to 2.0 with 5N NaOH, then transfer to a 250 mL volumetric flask and add water to the final level.

[0217] ​Buffer solution: 50 mM phosphate buffer, pH 7.4: Dissolve 0.78 g NaH₂PO₄·2H₂O and 2.805 g Na₂HPO₄ in approximately 240 mL of water in a flask, mix thoroughly, and adjust the pH to 7.4 with 5N NaOH. Transfer to a 500 mL volumetric flask and add water to the final level. Buffer solution: 50 mM phosphate.

[0218] Buffer solution, 50mM phosphate buffer, pH 9.0: 0.78g NaH2PO4·2H2O, 2.805g Na2HPO4, dissolved in about 240mL of water in a flask, then mixed thoroughly and adjusted to pH 9.0 with 5N NaOH, then transferred to a 500mL volumetric flask, and finally added water to the final level.

[0219] 4. Determination of thermodynamic solubility

[0220] Weigh the sample powder into separate EP tubes. Add 450 μL of pH 2, pH 7.4, and pH 9.0 buffer solutions to the EP tubes to obtain supersaturated suspensions. Vortex the samples for at least 2 minutes to determine their solubility. Shake the EP tubes at 800 rpm for 24 hours at room temperature. Centrifuge for 20 minutes (e.g., 12000 rpm). Filter the supernatant through a 0.45 μm filter membrane and inject it into an HPLC system. Calculate the concentration using a standard curve. (See attached...) Figure 4 As shown, compared with the previously reported MYOF inhibitor 6y, the water solubility of multiple compounds in this invention, such as HJ001, HJ002, HJ003, HJ009, HJ010, HJ011 and HJ032, is significantly improved under multiple pH conditions (2.0, 7.4 and 9.0).

[0221] Example 6: Cell thermal transfer analysis experiment to determine the binding of the compound of the present invention with MYOF.

[0222] 1. Seed MKN45 cells at an appropriate density into 10cm culture dishes and cultured in a 37℃ incubator for 24h. Then, treat the cells with test compounds at final concentrations of 50 and 100μM for 1h. The control group was treated with the same volume of DMSO.

[0223] 2. Digest the cells with trypsin, transfer them to a 15ml centrifuge tube, centrifuge, wash the cells three times with PBS, and then resuspend the cells in 1ml of PBS containing protease inhibitors.

[0224] 3. Add 100 μL of cell suspension to a 0.2 mL PCR tube, place the sample on a PC (Eppendorf), set different temperatures and incubate for 3 min, then incubate the cells at room temperature for 3 min, and then freeze and thaw 3 times in liquid nitrogen at 37 °C.

[0225] 4. Centrifuge at 4℃, take the supernatant for Western Blot test analysis.

[0226] Collect MKN45 cells with PBS containing protease inhibitors, and average them into different 0.2ml PCR tubes (about 1 million cells per tube). Place the samples on the PCR instrument (Eppendorf), set different temperatures and incubate for 3min, then freeze-thaw repeatedly 3 times at -37℃ under liquid nitrogen, centrifuge, and take the supernatant for Western Blot test analysis.

[0227] The experimental results are shown in the following table: Figure 5 As shown in the table, the stability of the MYOF protein is destroyed when the temperature is gradually heated to 51.9℃, and the protein gradually degrades. However, after adding the compound HJ001 prepared in Example 1 of the present application (50 and 100 micromoles per liter), the stability of the MYOF protein is improved under the same experimental conditions, and the tolerance to temperature is significantly improved, indicating that the compound HJ001 prepared in Example 1 of the present application and MYOF have effectively combined. In addition, similar experiments also show that other compounds of the present application also have similar effects of combining with MYOF.

[0228] Example Seven: MYOF Knockdown Experiment of Gastric Cancer Cells

[0229] 1. Virus packaging: 293T cells were seeded in a 10cm dish, and when the cell density reached 60-70%, shMYOF-1#, shMYOF-2#, shNC and packaging plasmids psPAX2, pMD2.G were transfected into 293T cells at a ratio of 2:2:1 using PEI, and the medium was changed 6h later. Add 12mL of culture medium and continue to culture.

[0230] 2. After 72h of transfection, the supernatant was collected and centrifuged at 1200rpm for 5min, then the supernatant was filtered using a 0.45μm filter.

[0231] 3. The MKN45 cells to be knocked out were seeded in a 6-well plate, and the target cells were infected with the harvested lentivirus. After 24h, fresh culture medium was replaced and the culture was continued for another 24h.

[0232] 4. Add puromycin to screen for stable MYOF knockout cells. Western blot was used to detect the gene knockout efficiency.

[0233] 5. The results of shRNA are as follows shMYOF-1#: 5' AGCTGATATTGATGGACAGTA 3' (SEQ ID NO. 1)

[0234] shMYOF-2#:5'AATGGTTGCCTTGCTCAACAA 3'(SEQ ID NO.2)

[0235] The results are attached. Figure 6 As shown in Figure A, knocking down the MYOF gene significantly reduced the expression level of the MYOF protein, as shown in the attached figure. Figure 6 As shown in Figure B, MYOF knockdown significantly inhibited cancer cell growth. Furthermore, as shown in the attached figure… Figure 6 As shown in Figure C, compound HJ001 significantly reduced the sensitivity of MYOF-knocked cancer cells, indicating that MYOF is the main target for the anti-proliferation and anti-migration effects of compound HJ001 prepared in Example 1 of this invention.

[0236] Example 8: The compound of the present invention inhibits the growth of gastric cancer in vivo without significant toxic side effects.

[0237] Experimental Methods: Subcutaneous Gastric Cancer Tumor Growth Model (Experimental Procedure)

[0238] 1. Expand the culture of gastric cancer cells to a sufficient number of subcutaneous tumor-bearing cells;

[0239] 2. After the cells have grown to a suitable state, digest and centrifuge them, wash twice with PBS, and then resuspend them in pre-cooled PBS;

[0240] 3. Count and adjust the cell density to 3–5 x 10⁻⁵ cells. 6 / 100μL, dispensed into EP tubes and placed on an ice box;

[0241] 4. Inject 100 μL of gastric cancer cells subcutaneously into the back of 6-8 week old male BALB / c-nude mice;

[0242] 5. After several days of observation, the length (L) and width (W) of the mouse tumors were initially measured according to the formula V = L x W. 2 The tumor volume is calculated by multiplying the result by 0.52 until the tumor volume reaches approximately 100 mm². 3 The mice were divided into groups;

[0243] 6. Mice were randomly divided into 5 groups: Control group, 5-Fu uracil group (15 mg / kg / d), 6y group (30 mg / kg / d), low-dose group of compound HJ001 prepared in Example 1 of the present invention (15 mg / kg / d), and high-dose group of compound HJ001 prepared in Example 1 of the present invention (30 mg / kg / d), with 7 mice in each group;

[0244] 7. Each mouse in the low-dose group of the compound HJ001 prepared in Example 1 of the present application was given 100 μL intraperitoneally, and each mouse in the high-dose group of the compound HJ001 prepared in Example 1 of the present application and the positive control group (5-Fu) and the positive control group (6y) was given 50 μL intraperitoneally, and the body weight and the length and width of the tumor of each mouse in each group were measured at regular time intervals according to the experimental scheme, and the volume was calculated;

[0245] 8. After the experiment was completed, the mice were sacrificed by cervical dislocation, and then the tumors of the mice in each group were stripped, photographed, recorded, and weighed using sterilized surgical scissors;

[0246] 9. The stripped tumor mass and internal organs were preserved in a suitable manner, such as frozen in liquid nitrogen or fixed in 4% paraformaldehyde, for use in subsequent experiments. The experimental results are shown in Figure 7 , and the Figure 7 A is a tumor entity graph of all experimental mice after being sacrificed, and the tumor tissue was stripped and photographed. As shown in Figure 7 B, according to the tumor growth volume curve of the mice, compared with the control group, the first-line treatment drug 5-Fu for gastric cancer was given at a dose of 15 mg / kg / day, and after 21 days, the tumor inhibition rate was 39.2%, and the reported MYOF inhibitor 6y (30 mg / kg / day) group had a tumor inhibition rate of 52.2%. When the compound HJ001 prepared in Example 1 of the present application was given at a dose of 15 mg / kg / day and 30 mg / kg / day, the tumor inhibition rates were 52.2% and 68.5%, respectively, showing a better in vivo gastric cancer inhibition effect. As shown in Figure 7 C, after all the experimental mice were sacrificed, the tumor tissue was stripped and weighed, and the results showed that, compared with the control group, the first-line treatment drug 5-Fu for gastric cancer and the reported MYOF inhibitor 6y group, the compound HJ001 prepared in Example 1 of the present application had a significant reduction in tumor weight when given at a dose of 15 mg / kg / day and 30 mg / kg / day, showing a better in vivo gastric cancer inhibition effect. As shown in Figure 7 D, the compound HJ001 prepared in Example 1 of the present application had no significant effect on the body weight of the mice when given at a dose of 15 mg / kg / day and 30 mg / kg / day. In addition, similar mouse animal experiments also showed that other compounds of the present application also had similar effects on inhibiting tumor growth, and the body weight had no significant difference compared with the normal control group.

[0247] The protection scope of the present application is not limited to the above examples. Changes and advantages that can be thought of by those skilled in the art without departing from the spirit and scope of the present application are included in the present application, and are protected by the appended claims.

Claims

1. A class of 1,5-diaryl 1,2,4-triazole compounds or pharmaceutically acceptable salts thereof, characterized in that, It is shown by the following structural formula II: n is 0-6; A, B, D, E are each independently selected from C or N atom, and A, B, E are not simultaneously C atom; A, B, D, E are not simultaneously N atom; Ar1 is a benzene ring or one of the following heterocyclic rings: pyridine ring, pyrimidine ring; R1 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluorinated C1-C3 alkoxy, fluorinated C1-C3 alkyl, carbonyl, cyano, nitro; R2 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde group.

2. The 1,5-diaryl 1,2,4-triazole compound or pharmaceutically acceptable salt thereof according to claim 1, wherein The pharmaceutically acceptable salt is an acid addition salt of 1,5-diaryl 1,2,4-triazole compound and acid; wherein the acid includes hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, acetic acid, tartaric acid, salicylic acid, citric acid, methanesulfonic acid, p-toluenesulfonic acid, lactic acid, pyruvic acid, maleic acid, succinic acid.

3. A class of 1,5-diaryl 1,2,4-triazole compounds or pharmaceutically acceptable salts thereof, characterized in that, It is: N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methyl-2-pyridinyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-pyrazolyl)butyl)-3-(5-(4-chloro-2-pyridinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; 3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1-1H-pyrazolyl)butyl)benzamide; 3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)-N-(4-(4-fluoro-1-1H-pyrazolyl)butyl)benzamide; N-(4-(4-bromo-1-1H-pyrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H- 1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(methoxy-d3)phenyl)-1-1H- 1,2,4-triazolyl)benzamide; N-(4-(4-bromo-2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H- 1,2,4-triazolyl)benzamide; N-(4-(4,5-dibromo-2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1- 1H-1,2,4-triazolyl)benzamide; N-(4-(1-1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4- triazolyl)benzamide; N-(4-(1-1H-1,2,3-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4- triazolyl)benzamide; N-(4-(4-bromo-1-1H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H- 1,2,4-triazolyl)benzamide; N-(4-(1-1H-1,2,4-triazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4- triazolyl)benzamide; N-(4-(1-1H-1,2,4-triazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4- triazolyl)benzamide; N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4- triazolyl)benzamide; N-(4-(2-2H-tetrazolyl)butyl)-3-(5-(5-bromo-2-pyrimidinyl)-3-ethyl-1-1H-1,2,4- triazolyl)benzamide; N-(4-(2-2H-tetrazolyl)butyl)-3-(3-ethyl-5-(5-methoxy-2-pyrimidinyl)-1-1H-1,2,4- triazolyl)benzamide; N-(4-(1-1H-tetrazolyl)butyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4- triazolyl)benzamide; N-(6-(2-2H-1,2,3-triazolyl)hexyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4- triazolyl)benzamide; N-(5-(2-2H-1,2,3-triazolyl)pentyl)-3-(3-ethyl-5-(4-methoxyphenyl)-1-1H-1,2,4- triazolyl)benzamide; N-(3-(2-2H-l,2,3-triazolyl)propyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(2-(2-2H-l,2,3-triazolyl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(2-(l-lH-pyrazolyl)ethyl)-3-(3-ethyl-5-(4-methoxyphenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(2-(l-lH-pyrazolyl)ethyl)-3-(5-(5-bromo-2-imidazolyl)-3-ethyl-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(2-methoxyphenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(3-methoxyphenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-hydroxyphenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-nitrophenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethoxy)phenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(5-(4-aminophenyl)-3-ethyl-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-fluorophenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(5-(4-chlorophenyl)-3-ethyl-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(5-(4-bromophenyl)-3-ethyl-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-(trifluoromethyl)phenyl)-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-l,2,3-triazolyl)butyl)-3-(3-ethyl-5-phenyl-l- lH-l,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-ethylphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-ethylphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-ethylphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-ethylphenyl)-1-1H-1,2,4-triazolyl)benzamide; N-(4-(2-2H-1,2,3-triazolyl)butyl)-3-(3-ethyl-5-(4-ethylphenyl)-1-1H-1,2,4-triazolyl)benzamide.

4. A pharmaceutical composition, characterized by, pharmaceutically acceptable carrier.

5. An inhibitor of MYOF, characterized in that, pharmaceutically acceptable carrier.

6. Use of the 1,5-diaryl-1,2,4-triazole compound or its pharmaceutically acceptable salt according to any one of claims 1-3, the pharmaceutical composition according to claim 4, the MYOF inhibitor according to claim 5 in the manufacture of a medicament for inhibiting or binding to myoferlin protein, in the manufacture of a medicament for treating tumor cell proliferation, growth, migration and infiltration, in the manufacture of a medicament for treating malignant tumors.

7. Use according to claim 6, wherein The tumor cells are selected from liver cancer cells, pancreatic cancer cells, ovarian cancer cells, gastric cancer cells.

8. The use according to claim 6, wherein The 1,5-diaryl-1,2,4-triazole compound or its pharmaceutically acceptable salt according to any one of claims 1-3, the pharmaceutical composition according to claim 4, the MYOF inhibitor according to claim 5 are formulated into injectable fluids, aerosols, creams, gels, pills, capsules, syrups, transdermal patches.

9. A method for synthesizing 1,5-diaryl-1,2,4-triazoles of the formula II, characterized in that, n is 0-6; A, B, D, E are each independently selected from C or N atom, and A, B, E are not simultaneously C atom, A, B, D, E are not simultaneously N atom; Ar1 is one of the following aromatic or heteroaromatic rings: benzene ring, pyridine ring, pyrimidine ring; Ar3 is benzene ring; R1 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, fluoro C1-C3 alkoxy, fluoro C1-C3 alkyl, carbonyl, cyano, nitro; R2 is independently selected from one or more of the following groups: hydrogen, hydroxyl, C1-C3 alkoxy, halogen, C1-C3 alkyl, nitro, aldehyde; and the synthetic method is: Reagents and reaction conditions: (a) N,N-dimethylformamide, N,N-diisopropylethylamine, 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate, room temperature; (b) dichlorosulfoxide, methanol, 80 °C; (c) acetic acid, 80 °C; (d) methanol / water, lithium aluminum hydride, room temperature; (e) potassium carbonate, dimethyl sulfoxide, 60 °C; (f) hydrazine monohydrate, ethanol, 40 °C.

10. A method of synthesizing compound HJ035, characterized by, The synthetic process is: Reagents and reaction conditions: methanol, palladium on carbon, hydrogen gas, room temperature.

Images