Method for constructing strict anaerobic salmonella, constructed strict anaerobic salmonella and application of constructed strict anaerobic salmonella

Abstract

The invention relates to a method for constructing strict anaerobic salmonella, the strict anaerobic salmonella constructed by using the method and application of the strict anaerobic salmonella in tumor treatment.

Description

Technical Field

[0001] The present invention relates to the field of tumor targeted therapy, and in particular to a method for constructing strictly anaerobic Salmonella, strictly anaerobic Salmonella constructed by the method and application of the same in tumor therapy. Background Art

[0002] Cancer is the leading cause of death worldwide. Compared with normal cells, cancer cells have the characteristics of unlimited proliferation, transformation and easy metastasis. In addition to uncontrolled division (capable of multipolar division), cancer cells can also locally invade surrounding normal tissues and even metastasize to other organs through the body's circulatory system or lymphatic system. The history of cancer treatment development shows that traditional cancer treatment methods such as surgery, chemotherapy, radiotherapy, immunology, hormone therapy, bone marrow / stem cell transplantation and other treatment methods all have certain defects. For example, surgical treatment is prone to recurrence and some tumors are difficult to operate on. Chemotherapy can cause serious side effects to patients and lead to ineffective treatment. The difficulty in cancer treatment stems from the complexity and variability of its etiology. Not only are there changes in the body's genetic level, but changes in the external environment are also one of the important factors in the development of cancer. The disadvantages of traditional therapies such as long-term radiotherapy, chemotherapy and immunotherapy are that these treatment options not only have serious toxicity to normal tissues and organs, but also cause cancer cells to develop multidrug resistance and cannot completely eliminate cancer cells. In recent years, many studies have found that gene therapy, non-invasive radiofrequency cancer treatment, insulin enhancement therapy, diet therapy and bacterial therapy can not only prevent cancer cells from developing multi-drug resistance, but also enhance the efficacy of traditional therapies. Among them, bacterial therapy is a promising cancer treatment method that overcomes the shortcomings of traditional treatment methods.

[0003] The history of using live bacteria to treat cancer can be traced back more than 150 years. In 1868, German physician W.Bush first used bacteria to treat sarcomas that could not be treated surgically. Within a week of treatment, the patient's tumor volume shrank by half and the size of the cervical lymph nodes also decreased. Unfortunately, the patient died of sepsis caused by bacterial infection 9 days later. In 1883, German surgeon Friedrich Fehleisen identified erysipelas as caused by Streptococcus pyogenes infection. Subsequently, Friedrich Fehleisen and surgeon Willian B Coley from New York Hospital independently conducted experiments to prove that Streptococcus pyogenes could cause tumor regression in patients. However, the results were controversial because they were difficult to replicate and did not meet the clinical standards at the time. In 1935, Connell observed that filtrates from Clostridium enzymes could cause metastatic tumors to regress. In 1947, scientists first injected spores of Clostridium histolyticum into mice with transplanted sarcomas and observed the dissolution of cancer cells and regression of tumor tissue. However, due to the acute toxicity caused by bacteria, the survival rate of mice was very low. In 1959, BCG (attenuated bovine Mycobacterium tuberculosis) was successfully used for cancer immunotherapy. In 2002, attenuated Salmonella VNP20009 (msbB-, purI-) was tested in Phase I clinical trials, and the results showed that the strain could colonize tumor tissues, but the effect on tumor treatment was not obvious.

[0004] Although VNP20009 did not achieve good clinical results, given the tumor-aggregating growth and immune regulation function of Salmonella, researchers believe that Salmonella may be suitable for tumor treatment through various transformation methods. The reason why Salmonella needs to be transformed is that wild-type Salmonella is toxic and can cause symptoms such as fever, vomiting, diarrhea, and abdominal cramps. In severe cases, it can cause bacteremia and endanger life. With the rapid development of molecular biology technology, Salmonella can be transformed through different strategies to make it suitable for tumor treatment. Salmonella can be knocked out of virulence-related genes, and bacterial growth can be regulated by constructing nutritionally deficient strains and gene circuits, so that attenuated strains can be used for tumor treatment as soon as possible.

[0005] In 2012, Bin Yu et al. published a research paper entitled "Explicit hypoxia targeting with tumor suppression by creating an "obligate" anaerobic Salmonella Typhimurium strain" in the journal "SCIENTIFIC REPORTS". The paper described a scheme for constructing a strictly anaerobic Salmonella strain. The prior art constructs a strain of Salmonella Typhimurium SL7207 with a key gene asd knocked out: the asd gene deletion affects the bacterial cell wall production, and the addition of DAP (diaminopimelic acid), a downstream intermediate metabolite of the asd gene, to the LB medium can allow the bacteria to synthesize the cell wall normally. On this basis, an anaerobic strain YB1 was constructed: a gene circuit of Cm-pept-asd-sodA regulated by anaerobic was inserted into the genome of the SL7207 knockout asd strain (the gene circuit was inserted into the original asd gene position). FNR is a transcriptional regulatory factor regulated by oxygen. Under anaerobic conditions, FNR is in an activated state and can regulate the positive promoter Pept to transcribe the asd gene, so that the bacteria can produce a complete cell wall. The reverse promoter PsodA can block the leakage of asd gene products produced by the forward promoter under aerobic conditions. This design can make the YB1 strain grow only under anaerobic conditions, while DAP must be added to the culture medium for growth under aerobic conditions.

[0006] Bin Yu et al. characterized the survival ability of their YB1 strain under different oxygen conditions: under aerobic conditions, YB1 could not grow in LB (DAP-) medium, but could grow in LB (DAP+) medium; under anaerobic conditions, YB1 could grow in both LB (DAP+) and LB (DAP-) medium. Characterization of the distribution of YB1 strain in tumor-bearing mice and the effect of treating tumors: 26 days after the YB1 strain was injected into the tail vein of tumor-bearing mice, the strain was cleared in normal tissues and organs, and bacteria still existed in tumor tissues (due to the very low oxygen concentration in tumor tissues and the immunosuppressive environment). Compared with the PBS group, the YB1 strain has the ability to inhibit tumor growth.

[0007] However, it takes up to 26 days for the YB1 strain of Bin Yu et al. to be completely eliminated from normal tissues and organs, which is time-consuming and has low safety. Compared with the PBS group, the weight of tumor-bearing mice significantly decreased (more than 5%) after YB1 was injected into the tail vein. As an important evaluation indicator of the health of mice, the significant decrease in weight indicates that the bacteria has a strong toxic effect on mice.

[0008] The art also needs a construction method that can produce strains that can be easily cleared by normal tissues and organs in a shorter time, reduce the toxic side effects on tumor-bearing mice caused by the long-term retention of bacteria in the body, make the modified strains safer and more reliable, and do not affect the effectiveness of bacteria in treating tumors. Summary of the invention

[0009] In order to solve the problems of the prior art, the purpose of the present invention is to provide a method for constructing strict anaerobic Salmonella, strict anaerobic Salmonella constructed by the method and application of the same in tumor treatment.

[0010] In one aspect of the present invention, a method for converting facultative anaerobic bacteria into strict anaerobic bacteria by inducing a circuit for expressing essential genes under hypoxia or strict anaerobic conditions is provided, and the strict anaerobic bacteria can inhibit tumor growth and reduce tumor volume when used for tumor treatment.

[0011] In one aspect of the present invention, in the above method, the facultative anaerobic bacterial genera include: Enterobacteriaceae (Escherichia coli, Klebsiella pneumoniae, Proteus, Enterobacter, Salmonella typhi, Salmonella, Shigella, etc.), Staphylococcus, Streptococcus, Pneumococcus, Bacillus anthracis and Corynebacterium diphtheriae.

[0012] In one aspect of the present invention, in the above method, the facultative anaerobic bacterium is Salmonella species.

[0013] In one aspect of the present invention, in the above method, the facultative anaerobic Salmonella strains include those derived from humans, chickens, dogs, cattle, etc.

[0014] In one aspect of the present invention, in the above method, the strict anaerobic bacteria need to be additionally added with 2,6-diaminopimelic acid (also known as 2,6-diaminopyramidal acid; 2,6-Diaminopimelicacid) and its analogs in the culture medium when cultured under aerobic conditions in vitro.

[0015] In one aspect of the present invention, in the above method, the essential gene is dapA or dapE but is not limited to this gene, and also includes one or more selected from dapB, dapD, argD, dapF, murE, murF or lysA.

[0016] In one aspect of the present invention, in the above method, the strict anaerobic regulated gene circuit consists of an anaerobically activated promoter and an essential gene.

[0017] In one aspect of the present invention, in the above method, the gene circuit of the essential gene induced expression regulation by hypoxia or strict anaerobic conditions exists in chromosomes or other plasmid vectors.

[0018] In one aspect of the present invention, in the above method, the anaerobically activated promoter is selected from the group consisting of Pept, Fnr-SP, Hip1, I141018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 and YsgAP.

[0019] In one aspect of the present invention, in the above method, the transcriptional regulatory factor regulating the promoter is Fnr or arcA, wherein the Fnr-SP promoter is regulated by the transcriptional regulatory factor Fnr, and the Ptet-arcA promoter is regulated by the transcriptional regulatory factor arcA.

[0020] In one aspect of the present invention, in the above method, the tumor cancer includes blood cancer (chronic leukemia, acute leukemia), bone cancer, lymphoma (non-Hodgkin's lymphoma, Hodgkin's lymphoma), intestinal cancer (colon cancer, rectal cancer), liver cancer, gastric cancer, pelvic cancer (cervical cancer, ovarian malignancy, endometrial cancer, ovarian cancer), lung cancer, breast cancer, pancreatic cancer, bladder cancer, prostate cancer, etc.

[0021] In one aspect of the present invention, methods of treating cancer using bacteria regulated by an anaerobic loop, wherein the bacteria comprise essential genes that are strictly regulated by hypoxia, are provided.

[0022] In one aspect of the present invention, the method of treatment further comprises: combined use with other cancer treatment therapies.

[0023] In one aspect of the present invention, in the method of treatment, the bacteria is Salmonella typhi.

[0024] In one aspect of the present invention, in the method of treatment, the facultative anaerobic bacterium is Salmonella typhimurium.

[0025] In one aspect of the present invention, in the method of treatment, the facultative anaerobic Salmonella strain includes those from humans, chickens, dogs, cattle, etc.

[0026] In one aspect of the present invention, in the treatment method, the facultative anaerobic bacteria include: Enterobacteriaceae (Escherichia coli, Klebsiella pneumoniae, Proteus, Enterobacter, Salmonella typhi, Salmonella, Shigella, etc.), Staphylococcus, Streptococcus, Pneumococcus, Bacillus anthracis and Corynebacterium diphtheriae, etc.

[0027] In one aspect of the present invention, in the treatment method, the other cancer treatment methods are used in combination: (a) anaerobic bacterial therapy combined with surgical therapy; (b) anaerobic bacterial therapy combined with radiotherapy; (c) anaerobic bacterial therapy combined with chemical drugs: chemotherapeutic drugs include alkylating agents (nimustine, carmustine, lomustine, cyclophosphamide, ifosfamide, glyphosate mustard, etc.), antimetabolites (doxifluridine, docefluridine, 6-mercaptopurine, cytarabine, fluguanidine, tegafur, gemcitabine, carmofur, hydroxyurea, methotrexate, eufodine, ancitabine, etc.), antitumor antibiotics (actinomycin, aclarubicin, (d) bacterial therapy combined with biological therapy for anaerobic strains; (e) bacterial therapy combined with traditional Chinese medicine for anaerobic strains.

[0028] In one aspect of the present invention, a vector is provided, which is a prokaryotic cell comprising the following elements: (a) a hypoxia or strict anaerobic activated promoter; and (b) an essential gene regulated by the promoter in (a); wherein the promoter in (a) has a binding site for an anaerobic activated transcriptional regulatory factor.

[0029] In one aspect of the present invention, in the vector, the anaerobic activated promoter is selected from the group consisting of Pept, Fnr-SP, Hip1, I141018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 and YsgAP.

[0030] In one aspect of the present invention, in the vector, the essential gene is dapA or dapE; and / or, the transcriptional regulatory factor is Fnr, arcA. The Fnr-SP promoter is regulated by the transcriptional regulatory factor Fnr; the Ptet-arcA promoter is regulated by the transcriptional regulatory factor arcA.

[0031] In one aspect of the present invention, in the carrier, culturing under aerobic conditions in vitro requires the addition of 2,6-diaminopimelate to the culture medium.

[0032] In one aspect of the present invention, a strictly anaerobic Salmonella is provided for expressing a drug or using the drug as a vector to carry the drug, wherein the drug is used for treating cancer.

[0033] In one aspect of the present invention, in the application, the drug includes: (a) expressing a protein substance or a polypeptide substance having a cancer treatment effect; (b) expressing an RNA having a cancer treatment effect; (c) serving as a carrier to carry a modified RNA drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the construction route diagram of the R1074 strain.

[0035] Figure 2A-2G It is the electrophoresis diagram of the construction of 9 strains (SL7207 (ΔdapA)-promoter-BBa_B0033-dapA).

[0036] Figure 3A , Figure 3B and Figure 3C It is an in vitro experiment of 9 strains. Figure 3A These are photos of 9 strains (as indicated by the abbreviations of the strains on the left side of the photo) cultured under aerobic conditions for 24-144 hours. Figure 3B These are photos of 9 strains (as indicated by the abbreviations of the strains on the left side of the photo) cultured under anaerobic conditions for 24 hours. Figure 3C Nine strains (as indicated by the abbreviations of the strains on the ordinate) were cultured under anaerobic conditions for 24 h, and the OD600 values ​​were detected.

[0037] Figure 4A-4E These are the in vivo experimental results of the 9 constructed strains.

[0038] Figure 5 (A)-(E) are electrophoresis diagrams of the construction of five strains (SL7207 (ΔdapE)-promoter (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE).

[0039] Fig. 6A , Figure 6B and Figure 6C It is an in vitro experiment with 5 strains. Fig. 6A These are photos of 5 strains (as indicated by the abbreviations of the strains on the left side of the photo) cultured under aerobic conditions for 24-72 hours. Figure 6B These are pictures of 5 strains (as indicated by the abbreviations of the strains on the left side of the photo) after 24 hours of anaerobic culture. Figure 6C Five strains (as indicated by the abbreviations of the strains on the left side of the photo) were cultured under anaerobic conditions for 24 hours, and the OD600 values ​​were detected.

[0040] Figure 7 This is an in vivo experiment of the SL7207(ΔdapE)-R1074-BBa_B0033-dapE (abbreviated as: R1074-1) strain. DETAILED DESCRIPTION

[0041] Although various modifications can be made to the present invention and the present invention can have various forms, specific examples will be described in detail and explained below. However, it should be understood that these are not intended to limit the present invention to specific disclosures, and the present invention includes all modifications, equivalents or substitutes thereof without departing from the spirit and technical scope of the present invention.

[0042] Hereinafter, the method for constructing strict anaerobic Salmonella according to a specific embodiment of the present invention, the strict anaerobic Salmonella constructed by the method and the application thereof in tumor treatment will be explained in more detail.

[0043] In one or more embodiments of the present invention, the vector of the present invention is a prokaryotic cell comprising the following elements: (a) a hypoxia or strict anaerobic activated promoter; and (b) an essential gene regulated by the promoter in (a), wherein the promoter in (a) has a binding site for an anaerobic activated transcriptional regulatory factor.

[0044] In one or more embodiments of the present invention, (a) the hypoxia or strict anaerobic activated promoter may be, for example, Fnr-SP, Hip1, I14018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1, or YsgAP.

[0045] In one or more embodiments of the present invention, the transcriptional regulatory factor is Fnr or arcA.

[0046] In one or more embodiments of the present invention, the essential gene (b) regulated by the promoter in (a) may be, for example, dapA, dapB, dapD, argD, dapE, dapF, murE, murF, lysA, etc.; in particular, dapA or dapE.

[0047] The present invention provides a method for converting facultative anaerobic bacteria into strict anaerobic bacteria by inducing a circuit for expressing essential genes under hypoxia or strict anaerobiosis.

[0048] In one or more embodiments of the present invention, the strictly anaerobic regulated gene circuit consists of an anaerobically activated promoter and an essential gene.

[0049] In one or more embodiments of the present invention, the anaerobically activated promoter may be, for example, Pept, Fnr-SP, Hip1, I14018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1, or YsgAP.

[0050] In one or more embodiments of the present invention, the essential gene may be, for example, dapA, dapB, dapD, argD, dapE, dapF, murE, murF, lysA, etc.; in particular, dapA or dapE.

[0051] When the essential gene is dapA or dapE gene, the vector of the present invention needs to be additionally added with 2,6-diaminopimelic acid (also known as 2,6-diaminopyramidal acid) or its analogs in the culture medium when cultured under aerobic conditions.

[0052] When the strict anaerobic bacteria of the present invention are used for in vivo tumor treatment, they can inhibit tumor growth and reduce tumor volume.

[0053] The facultative anaerobic bacteria can be any species from any bacterial genus of the Enterobacteriaceae family (Escherichia coli, Klebsiella pneumoniae, Proteus, Enterobacter, Salmonella typhi, Salmonella, Shigella, etc.), Staphylococcus, Streptococcus, Pneumococcus, Bacillus anthracis and Corynebacterium diphtheriae.

[0054] The source of the facultative anaerobic Salmonella strain is not limited, as long as it is facultative anaerobic, for example, it includes facultative anaerobic Salmonella strains derived from humans, chickens, dogs, cattle, etc.

[0055] The facultative anaerobic bacterium is Salmonella typhimurium.

[0056] The present invention also provides a bacterial therapy for treating cancer using the bacterial strain that cannot grow under both aerobic and anaerobic conditions.

[0057] The cancers include blood cancer (chronic leukemia, acute leukemia), bone cancer, lymphoma (non-Hodgkin's lymphoma, Hodgkin's lymphoma), intestinal cancer (colon cancer, rectal cancer), liver cancer, gastric cancer, pelvic cancer (cervical cancer, ovarian malignancies, endometrial cancer, ovarian cancer), lung cancer, breast cancer, pancreatic cancer, bladder cancer, prostate cancer, etc.

[0058] In one or more embodiments of the present invention, the prokaryotic vector of the present invention, or the strict anaerobic bacteria obtained by the method of the present invention can be used as bacterial therapy for anti-tumor or cancer treatment.

[0059] In one or more embodiments of the present invention, the bacterial therapy of the present invention can be used in combination with other cancer treatment methods.

[0060] In one or more embodiments of the present invention, the combined use of bacterial therapy with other cancer treatment methods includes, for example: (a) bacterial therapy of anaerobic strains combined with surgical therapy; (b) bacterial therapy of anaerobic strains combined with radiotherapy; (c) bacterial therapy of anaerobic strains combined with chemotherapy: chemotherapeutic drugs include alkylating agents (nimustine, carmustine, lomustine, cyclophosphamide, ifosfamide, glyphosate mustard, etc.), antimetabolites (doxifluridine, docefluridine, 6-mercaptopurine, cytarabine, fluguanidine, tegafur, gemcitabine, carmofur, hydroxyurea, methotrexate, eufodine, ancitabine, etc.), antitumor antibiotics (actinomycin, aloxin, etc.), (d) bacterial therapy combined with biological therapy for anaerobic strains; (e) bacterial therapy combined with traditional Chinese medicine for anaerobic strains.

[0061] The prokaryotic cell vector of the present invention or the strict anaerobic bacteria obtained by the method of the present invention can also be used to induce the expression of drugs in vitro or as a vector to carry drugs for cancer treatment.

[0062] In an embodiment of the present invention, the drugs that can be carried in the carrier include: (a) expressing protein substances or polypeptide substances with cancer treatment effects; (b) expressing RNA with cancer treatment effects; (c) carrying modified RNA drugs as a carrier.

[0063] Advantages of the present invention:

[0064] (1) The anaerobic regulation module of the modified strain is simpler, the regulation system is more rigorous, and there is no background leakage problem under aerobic conditions;

[0065] (2) The modified strains can be completely eliminated from normal tissues and organs in a very short time;

[0066] (3) During the treatment of tumor-bearing mice, the modified strain had almost no effect on the weight of the mice, had relatively small toxic side effects, and had improved safety.

[0067] The strain construction scheme is as follows Figure 1 and Figure 5As shown: Based on the SL7207 (ΔdapA) and SL7207 (ΔdapE) that have been constructed in our laboratory, the Fnr-SP, Hip1, I14018, Pept, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1, YsgAP-BBa_B0033-dapA anaerobic gene circuit was integrated into the SL7207 (ΔdapA) genome (original dapA position); the Fnr-SP, Hip1, Pept, R1074, YsgAP-BBa_B0033-dapE anaerobic gene circuit was integrated into the SL7207 (ΔdapE) genome (original dapA position). The dapA and dapE genes are key genes in the lysine metabolic pathway. Knocking out any of these two genes will cause bacteria to fail to form normal cell walls, resulting in an imbalance in the internal and external osmotic pressure of the bacteria, and the bacteria will rupture and fail to survive. The above promoter is an anaerobic activated promoter. Under anaerobic or hypoxic conditions, the above promoter can initiate transcription of dapA or dapE genes, thereby generating DAP from the downstream DAP protein. Bacteria can form a complete cell wall. Under aerobic conditions, the 9 promoters-BBa_B0033-dapA or 5 promoters-BBa_B0033-dapE gene circuits are inactive, and bacteria cannot generate a complete cell wall. When SL7207 (ΔdapA)-Promoters (9 promoters, as shown in Table 1)-BBa_B0033-dapA strain or SL7207 (ΔdapE)-Promoters (5 promoters)-BBa_B0033-dapE strain is cultured under aerobic conditions, DAP (diaminopimelic acid) needs to be added to make up for the gene deletion of dapA or dapE, which causes the bacteria to be unable to form a complete cell wall.

[0068] Table 1 Promoter used in the present invention

[0069] Promoter name sequence Fnr-SP 5'GATCCGCCGCAAAGTTTGAGCGAAGTCAATAAACTCTCTACCCATTCAGGGCAATATCTCTCTTGCAGGTGAATGCAACGTCAAGCGAT 3' Hip1 5'GATCGGATAAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTAATAATGTTGTCA 3' I14018 5'GATCTGTAAGTTTATACATAGGCGAGTACTCTGTTATGG 3' Pept 5'GATCGCAGGGGTAAAAGTGACCTGACGCAATATTTGTCTTTTTCTTGCTTCTTAATAATGTTGTCACAAAAAGTGAGGGTGACTACATGG 3' Ptet-arcA 5'GATCGTTAATAAAATGTTATTGACAGTTAATAAAATGTTATACTGAGC 3' Ptet-Fnr 5'GATCAAAATTGATCTGAATCAATATTTTGACAAAAATTGATCTGAATCAATATTTACTGAGC 3' R1074 5'GATCTTAAATTTCCTCTCGTCAGGCCGGAATAACTCCCTATAATGCGCCACCACACTGATAGTGCTAGTGTAGATCAC 3' Ssbp1 5'GATCAACCGAGGTCACAACATAGTAAAAGCGCTATTGGTAATGGTACAATCGCGCGTTTACACTTATTCAGAACGATTTTTTTCAGGAG 3' Yj Y 5'GATCTCAGAAGAAGCAAAAAGACACTTTACCGAAGGGTTTAACATTTTTTCGTGATACTCATCACCATGACGCAAATGCGTTGCATAAA 3'

[0070] Table 2 Primers used for cloning in the present invention

[0071]

[0072] Example

[0073] Example 1: Construction of 9 strictly anaerobic strains (SL7207 (ΔdapA)-Promoters-BBa_B0033-dapA) (The primers used in the following experiments are shown in Table 2)

[0074] 1. Construction of pSC101-BBa_B0033-dapA plasmid

[0075] a. Using pSC101-FbFp-KnaR-loxp+promoter plasmid as template, vector forward primer and vector reverse primer as primers, PCR was performed to obtain linearized vector fragment 1;

[0076] b. Using the genome of Salmonella SL7207 as a template, dapA gene forward primer and dapA gene reverse primer as primers, PCR was performed to obtain target fragment 1;

[0077] c. One-step cloning method was used to obtain the pSC101-BBa_B0033-dapA plasmid.

[0078] 2. Construction of pSC101-R1074-BBa_B0033-dapA plasmid

[0079] a. pSC101-BBa_B0033-dapA plasmid was digested with BsaI to obtain linearized vector fragment 2;

[0080] b. Primer annealing method to obtain R1074 promoter fragment;

[0081] c. Ligase ligation to obtain pSC101-R1074-BBa_B0033-dapA plasmid.

[0082] 3. Construction of SL7207(ΔdapA)-R1074-BBa_B0033-dapA strain

[0083] a. Using pSC101-R1074-BBa_B0033-dapA plasmid as template, dapA homologous recombination forward primer and dapA homologous recombination reverse primer as primers, PCR was performed to obtain homologous recombination fragment 2;

[0084] b. The homologous recombination fragment 2 was integrated into the original dapA gene position of SL7207 (ΔdapA) by the λ-red homologous recombination method to obtain the SL7207 (ΔdapA)-R1074-BBa_B0033-dapA target strain.

[0085] The construction methods of the other 8 target strains (as follows) are basically the same as those of the SL7207 (ΔdapA)-R1074-BBa_B0033-dapA strain, and the primer b annealing fragment in step 2 needs to be replaced with the promoter fragments of Hip1, I14018, Ptet-Fnr, PepT, Ptet-arcA, Ssbp1, Fnr-SP, and YsgAP, respectively.

[0086] 1.SL7207(ΔdapA)-Fnr-SP-BBa_B0033-dapA;

[0087] 2.SL7207(ΔdapA)-Hip1-BBa_B0033-dapA;

[0088] 3.SL7207(ΔdapA)-I14018-BBa_B0033-dapA;

[0089] 4.SL7207(ΔdapA)-Pept-BBa_B0033-dapA;

[0090] 5.SL7207(ΔdapA)-Ptet-arcA-BBa_B0033-dapA;

[0091] 6.SL7207(ΔdapA)-Ptet-Fnr-BBa_B0033-dapA;

[0092] 7.SL7207(ΔdapA)-Ssbp1-BBa_B0033-dapA;

[0093] 8.SL7207(ΔdapA)-YsgAP-BBa_B0033-dapA.

[0094] The nine strains were abbreviated as (Fnr-SP; Hip1; I14018; Pept; Ptet-arcA; Ptet-Fnr; R1074; Ssbp1; YsgAP), and the electrophoresis results were shown in Figure 2A-2G shown.

[0095] Example 2: In vitro characterization of 9 strains

[0096] Characterization under aerobic conditions: Pick one single clone and add it to LB (DAP+) medium containing kanamycin; pick three clones and add them to LB (DAP-) medium containing kanamycin, respectively. Culture in an air shaker (37°C, 220 rpm) for a period of time.

[0097] Characterization under anaerobic conditions: Pick 3 single clones and add them to LB (DAP+) medium containing kanamycin. Culture overnight in an air shaker (37°C, 220rpm). Place the overnight cultured bacterial solution in an anaerobic incubator and transfer at a ratio of 1:100. Take 20μl of the bacterial solution and add it to 2ml of LB (DAP+) medium containing kanamycin; take 20μl of the bacterial solution and add it to 2ml of LB (DAP-) medium containing kanamycin, and repeat 3 times. Measure the initial OD600 value of the sample after transfer. In an anaerobic chamber, 37°C, culture for 24h. Measure the OD600 value of the sample after 24h of culture.

[0098] Experimental results (such as Figure 3A-3C ):

[0099] (1) Under aerobic conditions: 9 strains were cultured in LB (DAP+) medium for 144 h, and these strains could grow normally. 9 strains were cultured in LB (DAP-) medium for 144 h, and these strains could not grow.

[0100] (2) Under anaerobic conditions: 9 strains were cultured in LB (DAP+) medium and LB (DAP-) medium for 24 h. These strains can grow in both LB (DAP+) medium and LB (DAP-) medium.

[0101] Experimental conclusion: Testing of the strain under aerobic and anaerobic conditions showed that the facultative anaerobic strain SL7207 was successfully transformed into a strict anaerobic strain.

[0102] Example 3: In vivo characterization of 9 strains

[0103] C57BL / 6 mice were subcutaneously inoculated with 1×106 mouse bladder cancer cells (MB49) / mouse to establish a mouse bladder cancer subcutaneous tumor model. The experiment was divided into PBS group, SL7207 strain group, Fnr-SP group, Hip1 group, I14018 group, Pept group, Ptet-arcA group, Ptet-Fnr group, R1074 group, Ssbp1 group, and YsgAP group. 1×107 various bacteria of the present invention / mouse were inoculated through the tail vein. The distribution of bacteria in normal tissues and organs and tumors of tumor-bearing mice, changes in tumor volume, changes in mouse weight, and mouse survival rate were detected within 6 days. Experimental results (such as Figure 4A-4E ):

[0104] (1) Distribution of bacteria in tumor-bearing mice Figure 4A-4E , left column): In the Fnr-SP group, the strain was cleared relatively slowly in the body, and normal tissues and tumor tissues had a large number of bacteria; the strains in the Hip1 group, I14018 group, R1074 group, and Ssbp1 group were cleared relatively quickly in the body. There were relatively few bacteria in the heart, liver, lungs, kidneys, and blood, and 104 (CFU / g) of bacteria were present in the spleen and tumor tissues. In the Pept group and the YsgAP group, there were only a small amount of bacteria remaining in the liver and spleen, and no bacteria were found in other tissues, organs, and tumors. In the Ptet-arcA group, there were only a small amount of bacteria in the heart, liver, and lungs, and no bacteria were found in the spleen, kidneys, blood, and tumor tissues. In the Ptet-Fnr group, bacteria were only found in the liver and tumor tissues, and no bacteria were found in other organs.

[0105] (2) Changes in tumor volume Figure 4A-4E , middle column): Compared with the PBS group, all 9 strain groups had an inhibitory effect on tumor growth within 6 days.

[0106] (3) Changes in mouse body weight Figure 4A-4E, right column): Compared with the SL7207 group, the weight loss of mice in the 9 strain groups was relatively small, slightly lower than that in the PBS group.

[0107] (4) Survival rate of mice: All mice in the SL7207 group died within 6 days. No mice in the 9 strain groups and the PBS group died during the experimental period.

[0108] Experimental conclusion: Within 6 days, the distribution of the 9 modified strains in normal tissues and organs in the body is not exactly the same as that in the tumor. Compared with the SL7207 group, the 9 bacteria of the present invention were largely cleared in the body. The tumor volume of the 9 strain groups of the present invention was reduced. The weight of mice with the 9 strains was slightly lower than that of the PBS group during the experimental period, and there was no death. This shows that compared with the prior art, the safety of the 9 strains of the present invention has been improved, and at the same time, it has a tumor-suppressing effect.

[0109] Example 4: Construction of 5 strictly anaerobic strains (SL7207(ΔdapE)-Promoters-BBa_B0033-dapE)

[0110] 1. Construction of pSC101-Promoters-BBa_B0033-dapE plasmid

[0111] a. Using pSC101-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapA plasmid as template, vector forward primer 3 and vector reverse primer 4 as primers, PCR was performed to obtain 5 linearized vector fragments (results as shown in Figure 5 Middle (A));

[0112] b. Using the Salmonella SL7207 genome as a template, dapE gene forward primer and dapE gene reverse primer as primers, PCR was performed to obtain target fragment 2 (the result is shown in Figure 5 Middle (A));

[0113] c. One-step cloning method to obtain pSC101-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE plasmid (results as shown in Figure 5 (B)).

[0114] 2. Construction of SL7207(ΔdapE)-Promoters(R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE strain

[0115] a. Using pSC101-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE plasmid as template, dapE homologous recombination forward primer and dapE homologous recombination reverse primer as primers, PCR was performed to obtain 5 homologous recombination fragments (the results are shown in Figure 5 Middle (C));

[0116] b. The five homologous recombination fragments were integrated into the original dapE gene position of SL7207 (ΔdapE) by the λ-red homologous recombination method to obtain the SL7207 (ΔdapE)-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE target strain (the results are as shown in 5 (D), (E)).

[0117] The five strains are abbreviated as (R1074-1, YsgAP-1, Fnr-SP-1, Pept-1, Hip1-1).

[0118] Example 5: In vitro characterization of five strictly anaerobic strains (SL7207 (ΔdapE)-Promoters (R1074, YsgAP, Fnr-SP, Pept, Hip1)-BBa_B0033-dapE)

[0119] Characterization under aerobic conditions: Pick 3 clones and add them to LB (DAP+) medium containing spectinomycin, and culture them overnight in an air shaker (37°C, 220rpm). Transfer the overnight culture at a ratio of 1:100. Take 20μl of the culture and add it to 2ml of LB (DAP+) medium containing spectinomycin; take 20μl of the culture and add it to 2ml of LB (DAP-) medium containing spectinomycin, and repeat 3 times. Culture in an air shaker (37°C, 220rpm) for 72h and observe the growth of the strain.

[0120] Characterization under anaerobic conditions: Pick 3 monoclones and add them to LB (DAP+) medium containing spectinomycin, and culture them overnight in an air shaker (37°C, 220rpm). Place the overnight cultured bacterial solution in an anaerobic incubator and transfer it at a ratio of 1:100. Take 20μl of the bacterial solution and add it to 2ml of LB (DAP+) medium containing spectinomycin; take 20μl of the bacterial solution and add it to 2ml of LB (DAP-) medium containing spectinomycin, and repeat 3 times. Incubate in an anaerobic incubator (37°C) for 24h. Measure the OD600 value of the sample after 24h of culture.

[0121] Experimental results (such as Fig. 6A , Figure 6B , Figure 6C ):

[0122] (1) Under aerobic conditions: 5 strains were cultured in LB (DAP+) medium for 72 h, and these strains grew normally. 5 strains were cultured in LB (DAP-) medium for 72 h, and these strains could not grow.

[0123] (2) Under anaerobic conditions: The five strains were cultured in LB (DAP+) medium and LB (DAP-) medium for 24 h. These strains can grow in both LB (DAP+) medium and LB (DAP-) medium.

[0124] Experimental conclusion: The test of 5 strains under aerobic and anaerobic conditions showed that the facultative anaerobic strain SL7207 was successfully transformed into a strict anaerobic strain.

[0125] Example 6: In vivo characterization of R1074-1 strain

[0126] C57BL / 6 mice were subcutaneously inoculated with 1×106 mouse bladder cancer cells (MB49) / mouse to establish a mouse bladder cancer subcutaneous tumor model. The experiment was divided into PBS group and R1074-1 group. 1×107 bacteria of the present invention / mouse were inoculated through the tail vein.

[0127] The changes in tumor volume, mouse weight, and mouse survival rate were detected within 14 days. Figure 7 ):

[0128] (1) Changes in tumor volume Figure 7 Middle A): Compared with the PBS group, the R1074-1 strain group had an inhibitory effect on tumor growth during the experimental period.

[0129] (2) Changes in mouse body weight Figure 7 Middle B): Compared with the PBS group, there was no significant difference in the body weight of mice in the R1074-1 strain group during the experimental period

[0130] (3) Mouse survival rate: During the experimental period, all mice in the PBS group and the R1074-1 strain group survived.

[0131] Experimental conclusion: During the experimental period, the R1074-1 strain can inhibit the growth of mouse tumors; at the same time, compared with the PBS group, there was no significant difference in mouse body weight and all mice survived, indicating that this strain is relatively safe.

Claims

1. A strict anaerobic bacterium comprising a strict anaerobic regulatory gene circuit, wherein the strict anaerobic regulatory gene circuit consists of: (a) a strictly anaerobic-activated promoter and (b) an essential gene regulated by the promoter in (a); wherein the promoter in (a) has a binding site for an anaerobic-activated transcriptional regulatory factor, and the essential gene is dapE.

2. The strict anaerobic bacteria according to claim 1, wherein The strict anaerobic bacteria include: Enterobacteriaceae (Escherichia coli, Klebsiella pneumoniae, Proteus, Enterobacter, Salmonella typhi, Salmonella, Shigella, etc.), Staphylococcus, Streptococcus, Pneumococcus, Bacillus anthracis and Corynebacterium diphtheriae. Preferably, the strict anaerobic bacteria are Salmonella species.

3. The strict anaerobic bacterium of claim 1, wherein the strict anaerobic bacterium requires additional addition of 2,6-diaminopimelic acid to the culture medium when cultured under aerobic conditions in vitro.

4. The strict anaerobic bacterium according to any one of the preceding claims, wherein the anaerobic activated promoter is selected from the group consisting of Pept, Fnr-SP, Hip1, I141018, Ptet-arcA, Ptet-Fnr, R1074, Ssbp1 and YsgAP.

5. The strict anaerobic bacterium according to any one of the preceding claims, wherein the strict anaerobic bacterium is a strict anaerobic Salmonella.

6. Use of the strict anaerobic bacteria according to any one of claims 1 to 5 in the preparation of a medicament for treating tumors or cancer.

7. The use of claim 6, wherein the tumor or cancer is a solid tumor.

Images