Dwarf banana promoter proMbU5 and application thereof

Abstract

The invention discloses a dwarf banana promoter proMbU5 and application of the dwarf banana promoter proMbU5. The nucleotide sequence of the promoter proMbU5 is as shown in SEQ ID NO: 1. According to the invention, a promoter of a Ubiquitin gene is obtained through PCR amplification, the promoter is named as proMbU5, and a plant expression vector containing a GUS reporter gene is constructed. The promoter proMbU5 is transferred into rice through an agrobacterium method, and a GUS dyeing experiment of a transformed seedling shows that the promoter proMbU5 has high starting efficiency and can efficiently start expression of a GUS gene in the rice. Rice is a model plant of C3 crops in monocotyledonous plants, and the promoter proMbU5 can provide selection of a new efficient promoter for transgenic research of the monocotyledonous plants and is applied to the technical field of transgenic of more monocotyledonous plants.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to a pink banana promoter proMbU5 and an application thereof. Background Art

[0002] The principle of transgenic technology is to introduce artificially isolated and modified high-quality genes into the genome of an organism, thereby achieving the purpose of transforming the organism. Due to the expression of the introduced gene, the characteristics of the organism are modified and heritable. Transgenic plants are plants with foreign genes in their genomes, which may change certain genetic characteristics of the plants and cultivate new crop varieties such as high-yield, high-quality, virus-resistant, insect-resistant, cold-resistant, drought-resistant, waterlogging-resistant, salt-alkali-tolerant and herbicide-tolerant crops. Since the first industrial application of transgenic crops in 1996, global transgenic technology research and industrial application have developed rapidly.

[0003] Bananas have a very long history of cultivation in China. As early as more than 2,000 years ago, my country began to grow bananas. With the continuous development of the banana planting industry, my country has now become the world's second largest banana planting country. Bananas are mainly distributed in subtropical and tropical regions such as Guangxi, Guangdong, Fujian, Yunnan, and Hainan. Bananas are important tropical fruits and occupy an important position in the world's economic trade.

[0004] Most cultivated bananas evolved from two wild species, M. acuminata and M. balbisiana, and their interspecific hybridization. Cultivated bananas can be divided into genomic types such as AA, AAA, AB, AAB, ABB, AAAA, AAAB, AABB, BB and BBB according to multiple trait classification values. Cavendish is a subgroup of the AAA genomic type, and Pisang awak is a subgroup of the ABB genomic type. They are hybrid bananas of the genus Musa. Compared with Musa acuminate L. AAA group cv. Cavendish, BX, they have significantly different flavors and tastes. They are rich in nutrition, sweet and sour, and their ripening process is faster than that of the Brazilian banana. They are widely welcomed in the international and domestic markets and have broad application prospects. Since cultivated bananas are triploid and have low fertility, it is difficult to create large-scale germplasm through hybrid breeding. Cultivating high-yield, high-quality banana varieties with high stress resistance and adaptability is the key to breaking through the bottleneck of my country's banana industry development, and it is also a problem and challenge faced by my country's banana breeders. The development of modern genetic engineering technology provides a fast and effective way to cultivate new banana varieties. Compared with other important food crops such as rice, corn and wheat, research on genetic transformation of bananas has been slow. Banana is one of the most difficult species to tissue culture and genetically transform among tropical crops, and it is difficult to obtain new varieties with strong adaptability and practicality. Agrobacterium-mediated genetic transformation is also greatly restricted by genotype, and there are not many banana varieties that have been successfully genetically transformed and the transformation efficiency is low.

[0005] In the study of transgenic plants, the promoter is one of the important factors affecting the efficiency of transgenic expression. Therefore, the selection of a highly efficient promoter is the key to the efficient expression of foreign genes. The promoter is a DNA sequence located in the 5' upstream region of the structural gene, which can activate RNA polymerase, accurately bind to the template DNA and have the specificity of transcription initiation. It controls the start time and expression level of gene expression (transcription) and is an important element for gene expression regulation. According to the transcription mode of the promoter, it can be divided into three categories: constitutive promoter, inducible promoter and tissue-specific promoter. The regulation of constitutive promoters is not affected by external conditions. There is no obvious difference in gene expression in different tissues, organs and developmental stages. The expression of the activated gene is continuous and does not show time and space specificity.

[0006] Currently, the constitutive promoters widely used in plants include the tobacco mosaic virus CaMV35S promoter, the ubiquitin promoter, and the actin promoter. The CaMV35S promoter is often used in dicotyledons, while the ubiquitin promoter and the actin promoter are often used in monocotyledons. The ubiquitin promoter has become one of the most studied promoters due to its high promoter efficiency, relatively low methylation degree, and stable genetic traits. At present, the ubiquitin promoters of many plants such as corn, rice, and millet have been cloned. The corn ubiquitin Ubi-1 promoter has been widely used in monocotyledons such as corn, foxtail grass, wheat, and rice. The rice ubiquitin RUBQ2 promoter has also been widely used in rice and sugarcane.

[0007] In transgenic plants, the same promoter is often reused to drive the expression of multiple transgenes due to the need to co-express multiple transgenes regulating the same trait. However, the reuse of multiple promoters containing sequences that share a high level of sequence identity may lead to homology-based gene silencing. Therefore, each gene generally requires a separate promoter for gene expression, and multiple promoters are used in transgenic plants.

[0008] Therefore, it is very necessary to clone more promoters that can be efficiently expressed in plants, which can provide more promoter options for the development of biotechnology breeding of transgenic plants. In addition, in transgenic plant biotechnology, using the plant's own or close species' promoters may have a higher efficiency in initiating the expression of exogenous genes. Summary of the invention

[0009] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a banana promoter proMbU5 and its application.

[0010] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0011] The present invention provides a banana promoter proMbU5, and the nucleotide sequence of the promoter proMbU5 is shown as SEQ ID NO:1.

[0012] The method for preparing the above-mentioned promoter proMbU5 is to design PCR amplification primer pairs proMbU5F / R based on the nucleotide sequence of the promoter proMbU5; using banana genomic DNA as a template, amplification is performed using the designed PCR primer pairs to obtain the promoter proMbU5.

[0013] Furthermore, the primer pair proMbU5F / R is as follows:

[0014] Forward primer proMbU5F: GAGGAACTTAGATTTTAGTAAG,

[0015] Reverse primer proMbU5R: CTTCGCCTTTTCCCTTCCTTGCC.

[0016] The present invention also provides a recombinant vector, which is a vector containing the above-mentioned promoter proMbU5.

[0017] Furthermore, the vector is a plant expression vector pNC-121-pro.

[0018] The present invention also provides a host cell containing the above recombinant expression vector, characterized in that: the host cell is Agrobacterium AGL1.

[0019] The present invention also provides an application of the above promoter proMbU5 in regulating the efficient expression of plant genes.

[0020] The present invention also provides a method for regulating the efficient expression of plant genes, which comprises transforming the above promoter into plant callus tissue.

[0021] Use of any one of the following in breeding new varieties of monocotyledonous plants, wherein it comprises:

[0022] (1) the above-mentioned promoter proMbU5;

[0023] (2) the above-mentioned recombinant vector;

[0024] (3) The above-mentioned host cells.

[0025] Furthermore, the monocotyledonous plant is rice or banana (preferably banana).

[0026] Beneficial effects of the present invention:

[0027] The present invention searches for a Ubiquitin gene of banana from a database, designs primers according to the nucleotide sequence within 2000bp upstream thereof, amplifies a promoter of the Ubiquitin gene by PCR, names it as proMbU5, and constructs a plant expression vector containing a GUS reporter gene. Then, the promoter is transferred into rice by Agrobacterium method, and the GUS staining experiment of the transformed seedlings shows that the promoter proMbU5 has a strong promoter efficiency and can efficiently promote the expression of the GUS gene in rice. Rice is a model plant of C3 crops in monocotyledonous plants, and the promoter proMbU5 can provide a new and efficient promoter selection for the transgenic research of monocotyledonous plants, and can be applied to more transgenic technology fields of monocotyledonous plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the electropherogram of the PCR clone of the promoter proMbU5;

[0029] In the figure, lane 1 is the PCR amplification product of promoter proMbU5;

[0030] Lane 2 is DL2000 Marker, and the molecular weights from top to bottom are 2000 bp, 1000 bp, 750 bp, 250 bp, and 100 bp;

[0031] Figure 2 is a schematic diagram of the plant expression vector pNC121proMbU5-GUS;

[0032] Figure 3 Schematic diagram of GUS staining identification of transgenic rice plants containing the proMbU5-GUS exogenous gene;

[0033] In the figure, proMbU5OE1-OE6 are the GUS staining results of six different transgenic rice lines, and WT is the GUS staining control of Zhonghua 11 wild-type rice.

[0034] Figure 4 The PCR identification results of 1-6 transgenic rice lines are shown in Figure 1.

[0035] In the figure, 1-18 are the amplification results of leaf DNA of 1-6 different transgenic rice lines as templates, and each line was repeated three times. K- is the wild-type control, K1 is the DNA extraction blank control, and K2 is the ddH2O control;

[0036] A is the PCR amplification map of the promoter proMbU5;

[0037] B is the PCR amplification map of NPTⅡ gene;

[0038] C is the PCR amplification map of NOS terminator;

[0039] D is the PCR amplification map of NOS promoter;

[0040] E is the PCR amplification map of GUS gene. DETAILED DESCRIPTION

[0041] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0042] In the following examples, the relevant culture medium formula used is as follows:

[0043] 1.LB: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L;

[0044] 2. Callus induction medium: MS dry powder 4.4 g / L, sucrose (Sucrose) 30.0 g / L, acid hydrolyzed casein (Casaminoacid) 0.3 g / L, L-proline (L-Proline) 2.8 g / L, 2,4-D 0.002 g / L, plant gel Gelzan 3.0 g / L, pH 5.8;

[0045] 3. Rice infection solution AAM: MgSO4·7H2O 0.25g / L, CaCl2·2H2O0.15g / L, NaH2PO4·2H2O0.15g / L, KCl 3.0g / L, MnSO4·4H2O 0.01g / L, ZnSO4·7H2O 0.002g / L, CuSO4·5H2O0.000025g / L, CoCl2·6H2O0.000025g / L, KI 0.00075g / L, H3B3O 0.003g / L, Na2MoO4·2H2O0.00025g / L, Na2EDTA0.0373g / L, FeSO4·7H2O 0.0278g / L, L-Casaminoacid 0.5g / L, Glycine 0.0075g / L, L-Arginine 0.1767g / L, L-Glutamine 0.9g / L, L-Asparticacid 0.3g / L, myo-Inositol 0.1g / L, Nicotinicacid 0.001g / L, PyridoxineHCl 0.001g / L, ThiamineHCl0.01g / L, Sucrose 68.5g / L, Glucose 36.0g / L, Acetosyringone 0.04g / L, 0.1% Synperonic, pH5.2;

[0046] 4. Rice co-cultivation solution: N6 dry powder 4.0 g / L, Sucrose 30.0 g / L, Glucose 10.0 g / L, Casaminoacid 0.3 g / L, 2,4-D 0.002 g / L, Acetosyringone 0.04 g / L, pH 5.2.

[0047] 5. Rice screening medium: MS dry powder 4.4g / L, Sucrose 30.0g / L, Casaminoacid 0.3g / L, L-Proline 2.8g / L, 2,4-D 0.002g / L, Timentin 0.3g / L, Hygromycin 0.05g / L, Gelzan 3.0g / LpH5.8.

[0048] 6. Rice predifferentiation medium: MS dry powder 4.4 g / L, Sucrose 30.0 g / L, Casaminoacid 0.5 g / L, L-Proline 0.5 g / L, NAA 0.001 g / L, 6-BA 0.002 g / L, ABA 0.005 g / L, Timentin 0.3 g / L, Hygromycin 0.05 g / L, Gelzan 4.0 g / L, pH 5.8.

[0049] 7. Rice differentiation medium: MS dry powder 4.4 g / L, Sucrose 30.0 g / L, Casaminoacid 0.5 g / L, NAA 0.0006 g / L, 6-BA 0.0036 g / L, Timentin 0.3 g / L, Hygromycin 0.03 g / L, Gelzan 4.0 g / L, pH 5.8.

[0050] 8. Rice rooting medium: MS dry powder 2.2 g / L, Sucrose 20.0 g / L, Timentin 0.3 g / L, Hygromycin 0.03 g / L, Gelzan 4.0 g / L, pH 5.8.

[0051] 9. GUS staining solution:

[0052] 1) X-Gluc mother solution: X-Gluc was prepared into a 20 mM stock solution using NN-dimethylamide;

[0053] 2) X-Gluc base solution (pH7.0): NaH2PO4 50mM; Na2HPO4 50mM; Na2EDTA10mM, Triton-1000.1%, K3[Fe4(CN)6]0.5mM, K4[Fe(CN)6]0.5mM;

[0054] 3) X-Gluc mother solution and X-Gluc base solution are mixed in a ratio of 1:9 to obtain the GUS staining solution.

[0055] Example 1 Cloning of promoter proMbU5

[0056] The nucleotide sequence within 2000bp upstream of the start codon ATG was found from the banana genome database, and the promoter prediction analysis was performed using TSSP in the online prediction software Softberry. Bchr05 2808875 -28108754 was selected for promoter cloning, and its promoter was named proMbU5. Primers proMbU5F / R were designed. The sequences of primers proMbU5F / R are as follows:

[0057] Forward primer proMbU5F: GAGGAACTTAGATTTTAGTAAG,

[0058] Reverse primer proMbU5R: CTTCGCCTTTTCCCTTCCTTGCC.

[0059] The genomic DNA of Hiro-1 leaves was extracted using a plant genomic DNA extraction kit and used as a template for PCR amplification using high-fidelity Primestar enzyme.

[0060] The PCR system is: 9.5 μL of sterile water, 1 μL of each primer (10 μM),

[0061] PrimestarMix 12.5 μL, DNA template 1 μL.

[0062] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s, annealing at 56°C for 15 s, and extension at 72°C for 15 s for 33 cycles; and finally extension at 72°C for 7 min.

[0063] The PCR amplification products were separated by 2% agarose gel electrophoresis to obtain a band of approximately 2000 bp ( Figure 1 ), and purified and recovered using an agarose gel recovery kit. The recovered product was sent to a sequencing company for full sequence sequencing; thus, the promoter proMbU5 was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0064] Example 2 Construction of vector and Agrobacterium

[0065] 1. Construction of recombinant plant expression vector

[0066] a. Select the plant expression vector pNC-121-pro ( Figure 2 ) as the backbone vector for vector transformation, wherein the bacterial screening resistance gene of the vector is the kanamycin resistance gene (kanR), and the resistance screening gene in plants is the gene of neomycin phosphotransferase (NPTⅡ). pNC-121-pro vectors all have NC cloning frames for cloning reactions, which contain the ccdB lethal gene and require the use of E. coli DB3.1 strain.

[0067] b. Insert the target promoter into the vector NC frame by Nimble cloning (after Nimble Cloning reaction, the target gene replaces the NC cloning frame, and the recombinant plasmid can grow in ordinary strains (DH5α and Top10 are recommended)), and verify the activity of the proMbU5 promoter by the activated GUS reporter gene. Add the proMbU5 PCR recovery product and the pNC-121-pro empty vector according to the instructions of the Nimble Cloning kit, and then add Nimble Cloning Mix, and translate at 50℃ for one hour. Transform the ligation product into Escherichia coli DH5α and culture it overnight at 37℃ in LB medium containing kanamycin. Pick a single clone and culture it at 37℃ with shaking overnight;

[0068] c. Use primer pair proMbU5-NC-F / R to perform bacterial liquid PCR detection and screen positive clones, wherein the primer pair proMbU5-NC-F / R is as follows:

[0069] Forward primer proMbU5-NC-F:

[0070] agtggtctctgtccagtcctGAGGAACTTAGATTTTAGTAAG,

[0071] Reverse primer proMbU5-NC-R:

[0072] ggtctcagcagaccacaagtCTTCGCCTTTTCCCCTTCCTTGCC;

[0073] The enzyme used in PCR detection is ordinary TaqMix, and the reaction system is:

[0074] 9.5 μL of sterile water, 1 μL of each primer (10 μM), 12.5 μL of TaqMix, and 1 μL of bacterial liquid template.

[0075] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s, annealing at 56°C for 15 s, and extension at 72°C for 15 s for 33 cycles; and finally extension at 72°C for 7 min.

[0076] The PCR amplification products were separated by 2% agarose gel electrophoresis to obtain a band of about 2000 bp. According to the results of the bacterial solution PCR test, several positive clones were selected and sent to a sequencing company for sequence determination. The sequencing results showed that the size of the proMbU5 promoter was 2021 bp, which was consistent with the sequence shown in SEQ ID NO.1 in the sequence table, proving that the recombinant plasmid was successfully constructed. The constructed recombinant plant expression vectors were named pNC-121-pro-MbU5-GUS.

[0077] 2. Transformation of Agrobacterium with the recombinant expression vector pNC-121-pro-MbU5-GUS

[0078] The positive pNC-121-pro-MbU5-GUS bacterial solution was cultured at 37°C overnight with shaking, and 2 mL of bacterial solution was collected. The plasmid pNC-121-pro-MbU5-GUS was extracted using a plasmid extraction kit. The plasmid pNC-121-pro-MbU5-GUS was transferred into Agrobacterium AGL1 using liquid nitrogen freeze-thaw method to obtain AGL1 bacteria containing the plasmid (i.e., pNC-121-pro-MbU5-GUS / AGL1), and the bacterial solution was stored at -80°C with glycerol for later use.

[0079] Example 3 Functional verification of promoter proMbU5 in rice

[0080] The mature seeds of rice Zhonghua 11 were used as explants to induce callus, and Agrobacterium transformation was performed. The function and efficiency of the promoter proMbU5 in promoting gene expression were verified by GUS staining of the regenerated plants. The specific steps include:

[0081] 1) Induction of rice callus

[0082] Mature seeds of Zhonghua 11 were shelled, soaked in 75% ethanol for 30 seconds, washed with sterile water for 3 times, disinfected with 2% sodium hypochlorite solution for 20 minutes, shaken at 100 rpm on a shaker, and washed with sterile water for more than 5 times. The seeds were dried on filter paper and placed on rice callus induction medium. After incubation at 29°C in the dark for 30-45 days, naturally dispersed, bright yellow callus tissue was picked and inoculated on new rice callus induction medium, and pre-cultured at 29°C for 3-5 days.

[0083] 2) Preparation of Agrobacterium culture solution

[0084] Streak the bacterial solution of pNC-121-pro-MbU5-GUS / AGL1 stored at -80℃ on LB plates containing carbenicillin and kanamycin, culture at 28℃ for 2-4 days, and isolate single colonies. Pick 3-5 single colonies and culture them in LB culture medium containing carbenicillin and kanamycin at 28℃ with shaking until the OD600 of the bacterial solution is between 0.5-1.0.

[0085] 3) Infection and co-cultivation

[0086] a. Centrifuge the cultured pNC-121-pro-MbU5-GUS / AGL1 bacterial suspension at 5000 rpm for 10 min, pour off the culture solution, collect the bacteria, add infection solution containing 0.04 g / L acetosyringone (Acetosyringone, Ace) and 0.1% poloxamer (Synperonic, Syn), shake well, and adjust OD600 to 0.5.

[0087] b. Activate and culture the above bacterial infection solution at 20°C and 100 rpm for 2-3 hours. Collect the pre-cultured rice callus into a 50 mL sterile centrifuge tube, pour the activated bacterial solution into it, and infect at 20°C and 100 rpm for 1 hour.

[0088] c. After infection, pour out the bacterial solution, pour the callus into a sterile culture dish containing multiple layers of filter paper, spread the callus to dry the bacterial solution. At the same time, place 6 layers of filter paper in a new sterile culture dish, add 5-6mL of co-culture solution containing 0.04g / LAce, transfer the dried callus into it, spread it on the filter paper, seal it with a sealing film, and culture it in the dark at 20℃ for 5-7 days.

[0089] 4) Washing and screening

[0090] After the co-cultivation, the callus particles were collected into a 50 mL sterile centrifuge tube, washed with sterile water for more than 5 times until the distilled water was clear, and finally sterile water containing 0.3 g / L Timentin (Tim) was added, and the callus was soaked at room temperature for 30 min at 100 rpm. After soaking, the water was poured out, and the callus was poured into a sterile culture dish containing multiple layers of filter paper, and the callus was spread out to dry. The dried callus was inoculated on the MSD screening medium containing 0.3 g / L Tin and kanamycin, with about 20-30 callus per dish, cultured in the dark at 29 ° C, and subcultured every 2 weeks until fresh yellow resistant callus grew.

[0091] 5) Differentiation and rooting

[0092] Transfer the resistant callus from the screening medium to the pre-differentiation medium and culture it in the dark at 29°C for one week. Select the resistant callus without browning and death from the pre-differentiation medium and transfer it to the differentiation medium and culture it at 29°C, 14h light / 10h dark for 30-35 days. Usually the callus starts to turn green after one week, and young shoots start to grow after three weeks. Pick out the seedlings from the differentiation medium and inoculate them into the rooting medium at 29°C, 14h light / 10h dark for 10-20 days (the growth time is determined by the size of the seedlings). After rooting is completed, open the lid of the culture bottle, add a small amount of tap water, continue to culture at room temperature for 2-3 days, then take out the regenerated plants, wash off the culture medium with water, trim the roots and leaves, and transplant them to the greenhouse.

[0093] 6) GUS staining of transgenic plants

[0094] Prepare the base solution and mother solution of GUS staining solution according to the conventional method, and mix them in proportion before use. Take the pNC-121-pro-MbU5-GUS transgenic plants and put them into a 50mL centrifuge tube, add GUS staining solution, and stain for 24 hours in a dark room at 37℃. Use the wild seedlings of Zhonghua 11 as negative control. After staining, pour out the GUS staining solution, decolorize with 75% ethanol 3-5 times, then decolorize with 95% ethanol 1-2 times, and observe the staining of the regenerated plants.

[0095] The staining results showed that the roots, stems and leaves of the pNC-121-pro-MbU5-GUS transgenic plants were all dark blue, while the wild-type Zhonghua 11 seedlings had no blue at all ( Figure 3 ); This indicates that the pro-MbU5 promoter has the function of initiating the expression of the GUS gene in rice.

[0096] 7) PCR identification of transgenic plants

[0097] The leaves of pro-MbU5 transgenic plants were collected and their genomic DNA was extracted using a plant genomic DNA extraction kit. Using the above DNA as a template, PCR detection of pro-MbU5 promoter, NPTⅡ, NOS promoter, NOS terminator and GUS gene was performed on pro-MbU5 transgenic plants, with wild-type Zhonghua 11 genomic DNA as a negative control, pNC-121-pro-MbU5-GUS plasmid as a positive control, and sterile water as a blank control. The detection primers are shown in Table 1.

[0098] The enzyme used in PCR detection is ordinary TaqMix, and the reaction system is:

[0099] 9.5 μL of sterile water, 1 μL of each primer (10 μM), 12.5 μL of TaqMix, and 1 μL of DNA template.

[0100] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s for 35 cycles; and finally extension at 72°C for 7 min.

[0101] The PCR amplification products were separated and detected by 2% agarose gel electrophoresis. The results showed that the pro-MbU5 promoter, NPTⅡ, NOS promoter, NOS terminator and GUS gene could be amplified in the pro-MbU5 transgenic plants. Figure 4 ).

[0102] In summary, the GUS staining experiment of transformed seedlings showed that the promoter proMbU5 has a strong promoter efficiency and can efficiently promote the expression of the GUS gene in rice. Rice is a model plant for C3 crops in monocotyledons. The promoter proMbU5 can provide a new and efficient promoter option for transgenic research in monocotyledons and be applied to more monocotyledonous transgenic technology fields.

[0103] Table 1 Primers for pro-MbU5 transgenic plant detection

[0104]

[0105] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A banana promoter proMbU5, characterized in that: The nucleotide sequence of the promoter proMbU5 is shown in SEQ ID NO:

1.

2. A method for preparing the promoter proMbU5 according to claim 1, characterized in that: The method comprises the following steps: designing a PCR amplification primer pair proMbU5F / R based on the nucleotide sequence of the promoter proMbU5; taking banana genome DNA as a template, using the designed PCR primer pair for amplification to obtain the promoter proMbU5.

3. The method according to claim 2, characterized in that: The primer pair proMbU5F / R is as follows: Forward primer proMbU5F: GAGGAACTTAGATTTTAGTAAG, Reverse primer proMbU5R: CTTCGCCTTTTCCCTTCCTTGCC.

4. A recombinant vector, characterized in that: The recombinant vector is a vector containing the promoter proMbU5 described in claim 1.

5. The recombinant vector according to claim 4, characterized in that: The vector is a plant expression vector pNC-121-pro.

6. A host cell containing the recombinant expression vector according to claim 4, characterized in that: The host cell is Agrobacterium AGL1.

7. Use of the promoter proMbU5 according to claim 1 in regulating the efficient expression of plant genes.

8. A method for regulating efficient expression of plant genes, characterized in that: The method comprises transforming the promoter of claim 1 into plant callus.

9. Use of any of the following in breeding new varieties of monocotyledonous plants, characterized in that: It includes: (1) The promoter proMbU5 according to claim 1; (2) The recombinant vector according to claim 4; (3) The host cell according to claim 6.

10. The use according to claim 9, characterized in that: The monocotyledonous plant is rice or banana.

Images