Method, nucleic acid composition and kit for detecting toxoplasma gondii

Abstract

The invention discloses a method, a nucleic acid composition and a kit for detecting toxoplasma gondii, and relates to the technical field of toxoplasma gondii detection. The primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer and the sequence of SEQ ID NO: 1 have at least 90% identity, and the nucleotide sequence of the downstream primer and the sequence of SEQ ID NO: 2 have at least 90% identity. The nucleic acid composition for detecting the toxoplasma gondii provided by the invention aims at an APICO gene sequence of the toxoplasma gondii, and the sequence is a specific target region of the toxoplasma gondii. A fluorescent quantitative PCR or common PCR detection method established by using the target region can meet the requirements on specificity, accuracy and the like in a method verification process, and the method has important significance on in vitro diagnosis of toxoplasma gondii and in the veterinary field.

Description

Technical Field

[0001] The present invention relates to the technical field of Toxoplasma gondii detection, and in particular to a method, a nucleic acid composition and a kit for detecting Toxoplasma gondii. Background Art

[0002] Toxoplasma gondii is an opportunistic pathogenic protozoan that can cause toxoplasmosis, a zoonotic parasitic disease that is distributed all over the world, with a wide range of host species and a high infection rate in both humans and animals. After infection with Toxoplasma gondii, most people have no symptoms or only mild symptoms, but in people with weakened immune function, it may cause serious complications, posing a threat to human health and public health. There is no ideal therapeutic drug to date, so accurate early detection is crucial for the effective prevention and control of animal Toxoplasma. At present, the diagnosis of Toxoplasma gondii mainly includes etiology, serology and molecular biology. Etiology diagnosis is the earliest established method for the diagnosis of Toxoplasma gondii. It is simple to operate and has reliable results, but it takes a long time and cannot meet the needs of rapid, efficient and batch testing. Therefore, its application in laboratory diagnosis has gradually decreased. Immunological detection methods are mainly ELISA and IHA methods. There are relatively mature commercial kits or diagnostic reagents, which have played a great role in large-scale detection and epidemiological surveys, but there are common limitations and are not suitable for large-scale detection. Compared with traditional pathogen detection methods, molecular biological methods have improved speed, throughput, specificity, and sensitivity. Compared with immunological diagnosis, they avoid false positive results caused by acquired immunity and are the main development trend of laboratory diagnosis of toxoplasmosis in the future. Currently, there are two main molecular biological methods used for the detection of Toxoplasma gondii:

[0003] Conventional PCR: Polymerase chain reaction is a technique for rapidly amplifying specific DNA fragments in vitro. The basic principle is to simulate the DNA replication process in cells and achieve exponential amplification of DNA through a series of temperature changes. The whole process can be divided into three main steps: denaturation, annealing and extension. These steps are automatically generated in a thermal cycler, usually for 25-35 cycles.

[0004] qPCR-Taqman probe method: Compared with PCR, there is one more probe. The probe is an oligonucleotide complementary to the target DNA sequence, and the 5' end is labeled with a reporter fluorescent group (such as FAM, VIC, etc.), and the 3' end is labeled with a quencher fluorescent group (such as BHQ1, TAMRA, etc.). When the probe is intact, the fluorescence emitted by the reporter fluorescent group is absorbed by the quencher group, and no fluorescent signal is generated. During the amplification and extension process, the DNA polymerase has 5'→3' exonuclease activity and will cut the probe bound to the template. After the probe is cut, the reporter fluorescent group is separated from the quencher group, and the fluorescence emitted by the reporter fluorescent group is no longer absorbed by the quencher group, and the fluorescent signal increases. The real-time fluorescence detection system measures the fluorescence signal at the end of the extension step of each cycle, and the fluorescence intensity is proportional to the copy number of the target DNA.

[0005] The results of PCR detection technology are mainly analyzed by agarose gel electrophoresis, and open-type result analysis is prone to contamination and time-consuming; qPCR detection technology has the technical advantages of high specificity and high detection sensitivity, and closed-tube detection can effectively prevent contamination. At present, most of the commercial test kits are for the B1 and 529 gene sequences of Toxoplasma gondii, and currently have problems with low sensitivity and false positives.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The purpose of the present invention is to provide a method, a nucleic acid composition and a kit for detecting Toxoplasma gondii, wherein the nucleic acid composition detects a new target area of ​​Toxoplasma gondii and has high detection sensitivity and specificity. The invention improves the reliability and accuracy of Toxoplasma gondii detection and reduces the occurrence of misjudgment.

[0008] The present invention is achieved in that:

[0009] In the first aspect, the present invention provides a nucleic acid composition for detecting Toxoplasma gondii, comprising: an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer having at least 90% identity with the sequence of SEQ ID NO: 1, and the nucleotide sequence of the downstream primer having at least 90% identity with the sequence of SEQ ID NO: 2.

[0010] In a preferred embodiment of the present invention, the nucleic acid composition further comprises a probe, and the sequence of the probe has at least 90% identity with the sequence of SEQ ID NO:3.

[0011] In a preferred embodiment of the present invention, the 5' end of the probe carries a fluorescent reporter group, and the 3' end carries a fluorescent quencher group.

[0012] In a preferred embodiment of the present invention, the fluorescent reporter group is selected from any one of 5-FAM, 6-FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670;

[0013] The fluorescence quenching group is selected from any one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and QSY.

[0014] In a second aspect, the present invention further provides an amplification system for detecting Toxoplasma gondii, which comprises the above-mentioned nucleic acid composition for detecting Toxoplasma gondii and a PCR premix.

[0015] In a preferred embodiment of the present invention, the PCR premix includes: DNA polymerase, dNTPs, Mg 2+ and Buffer;

[0016] In a preferred embodiment of the present invention, the PCR premix is ​​qPCR Mix.

[0017] In a third aspect, the present invention also provides the use of a nucleic acid composition for detecting Toxoplasma gondii in preparing a Toxoplasma gondii detection product, wherein the detection product is a reagent, a kit and a chip.

[0018] In a fourth aspect, the present invention further provides a kit, which includes the above-mentioned nucleic acid composition for detecting Toxoplasma gondii or the above-mentioned amplification system for detecting Toxoplasma gondii;

[0019] In a preferred embodiment of the present invention, the kit further comprises a positive quality control product and a negative quality control product;

[0020] In a preferred embodiment of the present invention, the positive quality control product is a plasmid comprising the APICO gene of Toxoplasma gondii.

[0021] In a fifth aspect, the present invention also provides a method for detecting Toxoplasma gondii, which comprises the following steps: mixing the above-mentioned nucleic acid composition or the above-mentioned amplification system for detecting Toxoplasma gondii with the DNA of a sample to be tested, and performing PCR amplification, and the method is not intended for the diagnosis of a disease.

[0022] In a preferred embodiment of the present invention, in the PCR amplification reaction system, the final concentration of the upstream primer is 0.6-1 μM, the final concentration of the downstream primer is 0.6-1 μM, and the final concentration of the probe is 0.08-0.3 μM.

[0023] PCR amplification is qPCR amplification or common PCR amplification;

[0024] In a preferred embodiment of the present invention, when qPCR amplification is performed, the reaction conditions include: 94-98°C, 30s; 94-98°C for 5s, 60°C for 34s, during which fluorescence is collected, and the cycle is repeated 35-45 times;

[0025] The sample to be tested is a tissue, body fluid or environmental sample of a human or animal.

[0026] Human or animal tissues include but are not limited to: brain, eyes, central nervous system, lymph nodes, liver, heart and other parts; body fluids include but are not limited to: blood, serum, plasma, intracellular fluid, interstitial fluid, such as lymph fluid and cerebrospinal fluid.

[0027] Environmental samples include but are not limited to: soil samples, ward samples, water samples, water-soil mixed samples, etc.

[0028] The present invention has the following beneficial effects:

[0029] The present invention aims at the problems and shortcomings of the existing nucleic acid detection methods for Toxoplasma gondii, and provides a nucleic acid composition for detecting Toxoplasma gondii. The primers in the nucleic acid composition are based on the APICO gene sequence of Toxoplasma gondii, which is a specific target region of Toxoplasma gondii. The fluorescent quantitative PCR or common PCR detection method established by using the target region can meet the requirements of specificity, accuracy and other aspects in the method verification process. The method is of great significance for the in vitro diagnosis of Toxoplasma gondii and in the veterinary field.

[0030] Compared with the primer compositions designed for the B1 and 529 target regions, the nucleic acid composition designed for the APICO target region of the present invention has more stable detection results, higher detection specificity and sensitivity, and the sensitivity can reach 1 copy / reaction.

[0031] The nucleic acid composition can be used to develop a detection kit for rapid and highly sensitive detection of Toxoplasma gondii.

[0032] In addition, the detection method provided by the present invention is simple and easy to implement, and can meet the needs of large-scale detection and epidemiological investigation. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0034] Figure 1 This is the test result diagram of Experimental Example 1;

[0035] Figure 2 This is the test result of the specificity test in Experimental Example 2;

[0036] Figure 3 The results of the specificity test of primers B1 and 529 in Experimental Example 2 are as follows;

[0037] Figure 4 The results of the sensitivity test of Experimental Example 3 are shown below;

[0038] Figure 5 The results of the B1 primer probe sensitivity test in Experimental Example 3 are as follows;

[0039] Figure 6 This is the test result of the 529 primer probe sensitivity test in Experimental Example 3. DETAILED DESCRIPTION

[0040] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0041] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc.); Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0042] In the first aspect, the present invention provides a nucleic acid composition for detecting Toxoplasma gondii, comprising: an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer having at least 90% identity with the sequence of SEQ ID NO: 1, and the nucleotide sequence of the downstream primer having at least 90% identity with the sequence of SEQ ID NO: 2.

[0043] For example, the nucleotide sequence of the upstream primer has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identity to the sequence of SEQ ID NO:1.

[0044] For example, the nucleotide sequence of the downstream primer has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identity to the sequence of SEQ ID NO:2.

[0045] SEQ ID NO: 1: 5'GTGGGCAAAAGCAGTGAGC3';

[0046] SEQ ID NO: 2: 5'GCAAATTGGTGCTTTAAAACCTC 3';

[0047] SEQ ID NO:3:

[0048] 5'GAATTGAATCGGATTTGAACCGATGAAG3'.

[0049] The present invention aims at the problems and shortcomings of the existing nucleic acid detection methods for Toxoplasma gondii, and provides a nucleic acid composition for detecting Toxoplasma gondii. The primers in the nucleic acid composition are based on the APICO gene sequence of Toxoplasma gondii, which is a specific target region of Toxoplasma gondii. The fluorescent quantitative PCR or common PCR detection method established by using the target region can meet the requirements of specificity, accuracy and other aspects in the method verification process. The method is of great significance for the in vitro diagnosis of Toxoplasma gondii and in the veterinary field.

[0050] Compared with the primer compositions designed for the B1 and 529 target regions, the nucleic acid composition designed for the APICO target region of the present invention has more stable detection results, higher detection specificity and sensitivity, and the sensitivity can reach 1 copy / reaction.

[0051] In a preferred embodiment of the present invention, the nucleic acid composition further comprises a probe, and the sequence of the probe has at least 90% identity with the sequence of SEQ ID NO: 3. For example, the nucleotide sequence of the probe has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identity with the sequence of SEQ ID NO: 3.

[0052] In a preferred embodiment of the present invention, the 5' end of the probe carries a fluorescent reporter group, and the 3' end carries a fluorescent quencher group.

[0053] In a preferred embodiment of the present invention, the fluorescent reporter group is selected from any one of 5-FAM, 6-FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670;

[0054] The fluorescence quenching group is selected from any one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and QSY. Any method is feasible as long as it can achieve fluorescence quenching.

[0055] In a second aspect, the present invention further provides an amplification system for detecting Toxoplasma gondii, which comprises the above-mentioned nucleic acid composition for detecting Toxoplasma gondii and a PCR premix.

[0056] In a preferred embodiment of the present invention, the PCR premix includes: DNA polymerase, dNTPs, Mg 2+ and Buffer;

[0057] In a preferred embodiment of the present invention, the PCR premix is ​​qPCR Mix. The qPCR Mix can be selected from commercially available qPCR Mix.

[0058] In a third aspect, the present invention also provides the use of a nucleic acid composition for detecting Toxoplasma gondii in preparing a Toxoplasma gondii detection product, wherein the detection product is a reagent, a kit and a chip.

[0059] In a fourth aspect, the present invention further provides a kit, which includes the above-mentioned nucleic acid composition for detecting Toxoplasma gondii or the above-mentioned amplification system for detecting Toxoplasma gondii;

[0060] In a preferred embodiment of the present invention, the kit further comprises a positive quality control product and a negative quality control product;

[0061] In a preferred embodiment of the present invention, the positive quality control product is a plasmid comprising the APICO gene of Toxoplasma gondii.

[0062] In a fifth aspect, the present invention also provides a method for detecting Toxoplasma gondii, which comprises the following steps: mixing the above-mentioned nucleic acid composition or the above-mentioned amplification system for detecting Toxoplasma gondii with the DNA of a sample to be tested, and performing PCR amplification, and the method is not intended for the diagnosis of a disease.

[0063] In a preferred embodiment of the present invention, in the reaction system of PCR amplification, the final concentration of the upstream primer is 0.6-1 μM, for example, 0.6, 0.7, 0.8, 0.9 or 1 μM. The final concentration of the downstream primer is 0.6-1 μM, for example, 0.6, 0.7, 0.8, 0.9 or 1 μM. The final concentration of the probe is 0.08-0.3 μM, for example, 0.08, 0.1, 0.15, 0.2 or 0.3 μM.

[0064] PCR amplification is qPCR amplification or common PCR amplification;

[0065] In a preferred embodiment of the present invention, when qPCR amplification is performed, the reaction conditions include: 94-98°C, 30s; 94-98°C for 5s, 60°C for 34s, during which fluorescence is collected, and the cycle is repeated 35-45 times;

[0066] The sample to be tested is a tissue, body fluid or environmental sample of a human or animal.

[0067] Human or animal tissues include but are not limited to: brain, eyes, central nervous system, lymph nodes, liver, heart and other parts; body fluids include but are not limited to: blood, serum, plasma, intracellular fluid, interstitial fluid, such as lymph fluid and cerebrospinal fluid.

[0068] Environmental samples include but are not limited to: soil samples, ward samples, water samples, water-soil mixed samples, etc.

[0069] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0070] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0071] Materials and reagents

[0072] Materials: Toxoplasma gondii gene plasmid reference (provided by Sangon Biotech (Shanghai) Co., Ltd.), true positive serum samples (provided by Mengxing Pet Clinic).

[0073] Reagents: qPCR amplification reagent (provided by Sangon Biotech (Shanghai) Co., Ltd.), primer probe (synthesized by Sangon Biotech (Shanghai) Co., Ltd.), ultrapure water (provided by Sangon Biotech (Shanghai) Co., Ltd.), DNA diluent (provided by Sangon Biotech (Shanghai) Co., Ltd.), Ezup column-based free DNA extraction kit (provided by Sangon Biotech (Shanghai) Co., Ltd.).

[0074] Example 1

[0075] This embodiment provides a nucleic acid composition for detecting Toxoplasma gondii, comprising a forward primer, a reverse primer and a probe;

[0076] The Toxoplasma gondii APICO genome sequence was downloaded from the Genbank database, and primers were designed for the gene. The primer probe sequences designed in this example are as follows.

[0077] Toxo-AF: 5'GTGGGCAAAAGCAGTGAGC3' (SEQ ID NO: 1);

[0078] Toxo-AR: 5'GCAAATTGGTGCTTTAAACCTC3' (SEQ ID NO: 2);

[0079] Toxo-AP: 5'GAATTGAATCGGATTTGAACCGATGAAG3' (SEQ ID NO: 3).

[0080] The 5' end of the probe of the APICO gene of Toxoplasma gondii is labeled with a reporter fluorescent dye Fluorophore of FAM, and the 3' end is labeled with a fluorescent quencher group Quencher of BHQ1. The primers can sensitively and specifically detect Toxoplasma gondii infection.

[0081] Example 2

[0082] This embodiment provides a kit, which includes the nucleic acid composition of Example 1, a qPCR reaction amplification reagent, a positive control, and a negative control.

[0083] The positive control standard was a recombinant plasmid containing the nucleotide fragment of the APICO gene of Toxoplasma gondii; the negative control was nuclease-free water; the qPCR reaction amplification reagent contained a chemically modified hot-start DNA polymerase, Mg 2+ Etc. qPCR amplification reagents in this example (provided by Sangon Biotech (Shanghai) Co., Ltd.).

[0084] The concentrations of the upstream primer, downstream primer and probe in the kit are 10 μM, 10 μM and 5 μM, respectively.

[0085] The positive control was Toxoplasma gondii plasmid, and the negative control was ultrapure water.

[0086] Example 3

[0087] A test method for detecting Toxoplasma gondii is provided.

[0088] 1. Dilution of reference material:

[0089] (1) Centrifuge the plasmid powder (Toxoplasma gondii gene plasmid reference) at 5000 r / min for 120 seconds, add 200 μL DNA diluent to dissolve, vortex mix for 1 min, centrifuge at 3000 r / min for 30 seconds, repeat the mixing and centrifugation operation three times, and mark the tube as Toxo_APICO_1;

[0090] (2) 2 μL Toxo_APICO_1 + 198 μL DNA diluent, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as Toxo_APICO_2;

[0091] (3) 2 μL Toxo_APICO_2 + 198 μL DNA diluent, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA1;

[0092] (4) 10 μL TA1 + 90 μL DNA dilution buffer, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA2;

[0093] (5) 5 μL TA1 + 95 μL DNA diluent, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA3;

[0094] (6) 2 μL TA1 + 98 μL DNA dilution buffer, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA4;

[0095] (7) 2 μL TA1 + 198 μL DNA dilution buffer, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA5;

[0096] (8) 50 μL TA5 + 50 μL DNA dilution solution, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA6;

[0097] (9) 30 μL TA5 + 60 μL DNA dilution solution, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA7;

[0098] (10) 20 μL TA5 + 80 μL DNA dilution solution, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA8;

[0099] (11) 10 μL TA6 + 90 μL DNA diluent, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA9;

[0100] (12) 10 μL TA7 + 90 μL DNA diluent, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as TA10.

[0101] The reference product was quantified by digital PCR, and the results are shown in the following table:

[0102] Serial number template Actual copy number (copies / μL) 1 NTC 0 2 TA1 41000 3 TA2 4286 4 TA3 2705 5 TA4 824 6 TA5 485 7 TA6 241 8 TA7 149 9 TA8 90 10 TA9 10 11 TA10 1

[0103] 2. Nucleic acid extraction (serum): Extract nucleic acid from the sample according to the operating procedures of the Ezup column-based free DNA extraction kit.

[0104] (1) Take 200 μl of serum sample into a centrifuge tube, add 200 μl of Buffer FL and 20 μl of Proteinase K solution, vortex to mix, incubate at 56°C for 10 min, shake the sample occasionally, and centrifuge briefly to concentrate the liquid at the bottom of the tube;

[0105] (2) Add 200 μl of anhydrous ethanol, gently invert and mix the sample, let it stand at room temperature for 5 min, and briefly centrifuge to concentrate the liquid at the bottom of the tube;

[0106] (3) Transfer the solution obtained in the previous step to the adsorption column (the adsorption column is placed in the collection tube), centrifuge at 10,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column back into the collection tube;

[0107] (4) Add 500 μl of CW1 Solution to the adsorption column, centrifuge at 10,000 rpm for 30 s, and discard the waste liquid;

[0108] (5) Place the adsorption column back into the collection tube, add 500 μl of CW2Solution to the adsorption column, centrifuge at 10,000 rpm for 30 seconds and discard the waste liquid;

[0109] (6) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min at room temperature to remove the remaining CW2Solution;

[0110] (7) Remove the adsorption column and place it in a new 1.5 ml centrifuge tube. Add 40 μl TE Buffer and let stand for 5 min. Centrifuge at 12,000 rpm for 2 min at room temperature to collect the DNA solution. The extracted DNA can be used for the next experiment immediately or stored at -20°C.

[0111] 3. Preparation of amplification reagents: The qPCR reaction system of the kit is 2×qPCR SuperMix for qPCR 10μl, 2μL of 10μM upstream and downstream primers, 1.2μL of 5μM probe, and the volume of the template is 1μl. Add 5.8μl of sterile water to make the PCR system 20μl.

[0112] In each PCR reaction, in addition to the sample to be tested, positive and negative quality control samples should be added.

[0113] 4. The PCR reaction conditions of the kit are: 94℃ pre-denaturation for 30s, 94℃ for 5s, 60℃ for 34s. In this step, fluorescence is collected, and the fluorescence value of the FAM channel is collected. A total of 40 cycles are performed. After completion, the results are analyzed using a real-time fluorescence quantitative PCR instrument.

[0114] 5. Result analysis: For validity determination, the positive control should show a specific amplification curve and the Ct value should be <30, and the negative control should have no Ct value; otherwise the test results are invalid; for samples with a Ct value ≤40 in the FAM channel determination, the positive control should show a specific amplification curve and the negative control should have no peak phenomenon, which is judged as Toxoplasma gondii positive.

[0115] Comparative Example 1

[0116] The genome sequence of Toxoplasma gondii 529 was downloaded from the genbank database, and primers were designed for the gene. The primer probe sequences designed in this example are as follows.

[0117] Toxo-529-F:5'GCCATCACCACGAGGAAAG3'(SEQ ID NO:4)

[0118] Toxo-529-R:5'TTGGAGCCACAGAAGGGAC3'(SEQ ID NO:5)

[0119] Toxo-529-P:5'CTCGTCTAGATCGCATTCCGGTGTC3'(SEQ ID NO:6)

[0120] The 5' end of the probe for the Toxoplasma gondii 529 gene is labeled with a reporter fluorescent dye Fluorophore FAM, and the 3' end is labeled with a fluorescent quencher Quencher BHQ1.

[0121] Comparative Example 2

[0122] The genome sequence of Toxoplasma gondii B1 was downloaded from the genbank database, and primers were designed for the gene. The primer probe sequences designed in this example are as follows.

[0123] Toxo-529-F:5'ATCTTTCAGCCAACCCAGC3'(SEQ ID NO:7)

[0124] Toxo-529-R:5'AGCGACCAACCTTGTCCTG3'(SEQ ID NO:8)

[0125] Toxo-529-P: 5'

[0126] CTGTAGAGTAACAAAGAGAAGGCAAAACGC3'(SEQ ID NO:9)

[0127] The 5' end of the probe for the B1 gene of Toxoplasma gondii is labeled with a reporter fluorescent dye Fluorophore FAM, and the 3' end is labeled with a fluorescent quencher Quencher BHQ1.

[0128] Experimental Example 1

[0129] Using reference substance TL3 (i.e., reference substance diluent TA8 in Example 3) as material and the kit of Example 2, the nucleic acid of Toxoplasma gondii was detected according to the detection method steps of Example 3 above.

[0130] The results are as follows Figure 1 As shown. The fluorescence curve of the reaction tube containing the Toxoplasma genome rises (yellow line), the reaction tube of the positive control shows a specific amplification curve with a Ct value of <30 (red line), and the reaction tube of the negative control shows a smooth and slightly rising straight line (blue line).

[0131] Experimental Example 2

[0132] Specificity validation of real-time fluorescence PCR detection reagents for detecting Toxoplasma gondii nucleic acid.

[0133] The nucleic acid extracted from the serum containing Cryptosporidium, Giardia, Coccidia, and Salmonella obtained from Mengxing Pet Clinic was used as a template for specific verification. At the same time, the Toxoplasma gondii plasmid was used as a positive control, and nuclease-free water was used as a negative control. The kit of Example 2 of the present invention was used for amplification, and the amplification method was referred to Example 3.

[0134] The results are as follows Figure 2 As shown, only the positive control containing the Toxoplasma gene can be amplified well (red line), and the others did not produce an amplification curve, indicating that this method has a certain degree of conservatism and strong specificity for detecting Toxoplasma.

[0135] In addition, these nucleic acids were also tested using the B1 designed in Comparative Example 1 and the 529 target region primer probe designed in Comparative Example 2, and it was found that false positives would occur, such as Figure 3 As shown (the two red curves are B1 target primer probes, the two green curves are 529 target primer probes, the ones with high relative fluorescence intensity are the respective positive control results, and the ones with low relative fluorescence intensity are false positives).

[0136] Experimental Example 3

[0137] Toxoplasma gondii nucleic acid real-time fluorescence PCR detection reagent, sensitivity verification. According to the confirmed positive reference, set 5 concentration detection limit references: TA6: 241 copies / μL; TA7: 149 copies / μL; TA8: 90 copies / μL; TA9: 10 copies / μL; TA10: 1 copy / μL; use them as templates for amplification reactions. Repeat each concentration five times and amplify according to the above detection method steps.

[0138] The results are as follows Figure 4 As shown, there is still an amplification curve when the concentration is 1 copy / reaction, and the positive detection rate is 100%. From the results, it can be seen that the detection limit of the kit of the present invention for Toxoplasma gondii nucleic acid is 1 copy / reaction.

[0139] When the template concentration is 5 copies / reaction, the sensitivity test results of the primer probes for target region B1 designed in comparative example 1 and 529 designed in comparative example 2 are as follows: Figure 5 and Figure 6 As shown, the positive detection rate of two detection targets of Toxoplasma gondii was 80%, and 1 copy / reaction was not amplified, indicating that the nucleic acid composition provided by the present invention has higher detection sensitivity.

[0140] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A nucleic acid composition for detecting Toxoplasma gondii, characterized in that: It includes: An upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer has at least 90% identity with the sequence of SEQ ID NO: 1, and the nucleotide sequence of the downstream primer has at least 90% identity with the sequence of SEQ ID NO:

2.

2. The nucleic acid composition for detecting Toxoplasma gondii according to claim 1, characterized in that: The nucleic acid composition also includes a probe having a sequence that is at least 90% identical to the sequence of SEQ ID NO:

3.

3. The nucleic acid composition for detecting Toxoplasma gondii according to claim 2, characterized in that: The 5' end of the probe carries a fluorescent reporter group, and the 3' end carries a fluorescent quencher group.

4. The nucleic acid composition for detecting Toxoplasma gondii according to claim 3, characterized in that: The fluorescent reporter group is selected from any one of 5-FAM, 6-FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, Texas Red, Cy5, Cy5.5 and Quasar670; The fluorescence quenching group is selected from any one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and QSY.

5. An amplification system for detecting Toxoplasma gondii, characterized in that: The invention comprises the nucleic acid composition for detecting Toxoplasma gondii according to any one of claims 1 to 4 and a PCR premix.

6. The amplification system for detecting Toxoplasma gondii according to claim 5, characterized in that: The PCR premix includes: DNA polymerase, dNTPs, Mg 2+ and Buffer; Preferably, the PCR premix is ​​qPCR Mix.

7. Use of the nucleic acid composition for detecting Toxoplasma gondii according to any one of claims 1 to 4 in preparing a Toxoplasma gondii detection product, characterized in that: The detection products are reagents, test kits and chips.

8. A kit, characterized in that: It comprises the nucleic acid composition for detecting Toxoplasma gondii according to any one of claims 1 to 4 or the amplification system for detecting Toxoplasma gondii according to any one of claims 5 to 6; Preferably, the kit further comprises a positive quality control product and a negative quality control product; Preferably, the positive quality control product is a plasmid comprising the Toxoplasma gondii APICO gene.

9. A method for detecting Toxoplasma gondii, characterized in that: The method comprises the following steps: mixing the nucleic acid composition described in any one of claims 1 to 4 or the amplification system for detecting Toxoplasma gondii described in any one of claims 5 to 6 with the DNA of a sample to be tested, and performing PCR amplification, and the method is not intended for the diagnosis of a disease.

10. The method for detecting Toxoplasma gondii according to claim 9, characterized in that: In the PCR amplification reaction system, the final concentration of the upstream primer is 0.6-1 μM, the final concentration of the downstream primer is 0.6-1 μM, and the final concentration of the probe is 0.08-0.3 μM; The PCR amplification is qPCR amplification or common PCR amplification; Preferably, when performing qPCR amplification, the reaction conditions include: 94-98°C, 30s; 94-98°C for 5s, 60°C for 34s, collecting fluorescence in this step, and cycling 35-45 times; Preferably, the sample to be tested is a tissue, body fluid or environmental sample of a human or animal.

Images