A galactitol dehydrogenase mutant and its application in the preparation of D-tagatose

Abstract

The present invention discloses a galactitol dehydrogenase mutant and its application in the preparation of D-tagatose, relating to the field of biotechnology. The amino acid sequence of the galactitol dehydrogenase mutant is shown as SEQ ID NO.3. The present invention performs semi-rational modification on the galactitol dehydrogenase mutant derived from Rhizobium leguminosarum by means of a high-throughput screening method based on NTB-PMS detection, and obtains a galactitol dehydrogenase mutant with high catalytic activity and thermal stability. Among all the reported galactitol dehydrogenases at present, the mutant has the highest enzyme activity. Meanwhile, the half-life of the mutant reaches 128 h under the conditions of pH 8.0 and 35 °C, having important industrial application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a galactitol dehydrogenase mutant and its application in the preparation of D-tagatose. Background Art

[0002] D-tagatose is a natural low-calorie functional sweetener, with a sweetness of 92% that of sucrose, but only 38% of the calories of sucrose. Due to its hypoglycemic, antioxidant, intestinal flora-improving and other biological activities, it has a wide range of applications in the food and pharmaceutical fields. The synthesis of D-tagatose mainly includes chemical methods and biological methods. Chemical methods have the disadvantages of difficult synthesis process control, difficult product purification, high by-products, and high costs, which hinder the application of chemical methods for D-tagatose synthesis. Currently, commercial D-tagatose is usually produced by the isomerization of D-galactose by L-arabinose isomerase (L-AI, EC 5.3.1.4). However, due to the inherent thermodynamic equilibrium of L-AI and the similar properties between D-galactose and D-tagatose, there are still problems of limited conversion rate and high purification cost.

[0003] Galactitol dehydrogenase (EC 1.1.1.16) has been found to exist in various microorganisms such as Rhizobium leguminosarum, Aspergillus niger, Burkholderia cepacia, Rhodobacter sphaeroides, Pseudomonas sp., etc., and can use NAD + as a hydrogen acceptor to oxidize the hydroxyl group at the C2 position of the substrate galactitol into a keto group to produce D-tagatose. By combining with a cofactor NAD + regeneration system, galactitol can be completely converted into D-tagatose. Since the enzyme activities of galactose dehydrogenases discovered and identified so far are generally low, with the highest enzyme activity being only 15.2 U / mg, the key technical difficulties that need to be urgently solved for the above enzyme-catalyzed process to be industrialized are: 1. Developing galactitol dehydrogenase and its engineering bacteria with industrial application prospects; 2. Establishing a system for efficient in-situ regeneration of coenzymes suitable for industrial scale-up. Summary of the Invention

[0004] The purpose of the present invention is to provide a galactitol dehydrogenase mutant and its application in the preparation of D-tagatose to solve the problems existing in the above-mentioned prior art. The galactitol dehydrogenase mutant has the advantages of high catalytic activity and thermal stability, can be applied to catalyze the preparation of D-tagatose, and has important industrial application prospects.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] The present invention provides a galactitol dehydrogenase mutant, and its amino acid sequence is as shown in SEQ ID NO.3.

[0007] The present invention also provides a coding gene for the above-mentioned galactitol dehydrogenase mutant.

[0008] Furthermore, the nucleotide sequence of the coding gene is as shown in SEQ ID NO.4.

[0009] The present invention also provides a recombinant vector, which includes the above-mentioned coding gene.

[0010] The present invention also provides a recombinant host cell, which includes the above-mentioned recombinant vector.

[0011] The present invention also provides the application of the above-mentioned coding gene, recombinant vector or recombinant host cell in the preparation of the above-mentioned galactitol dehydrogenase mutant.

[0012] The present invention also provides the application of the above-mentioned galactitol dehydrogenase mutant in the preparation of D-tagatose.

[0013] The present invention also provides an enzyme combination for the preparation of D-tagatose, which includes NADH oxidase and the above-mentioned galactitol dehydrogenase mutant.

[0014] The present invention also provides the application of the above-mentioned enzyme combination in the preparation of D-tagatose.

[0015] The present invention also provides a method for preparing D-tagatose, which includes using galactitol as a substrate, using the above-mentioned enzyme combination as a catalyst, and using NAD + as a hydrogen acceptor, and obtaining the D-tagatose through a catalytic reaction step.

[0016] The present invention discloses the following technical effects:

[0017] 1. The present invention performs semi-rational modification on galactitol dehydrogenase (GenBank ID: WP_011650422.1) derived from Rhizobium leguminosarum based on a high-throughput screening method using NTB-PMS detection, and obtains a galactitol dehydrogenase mutant with high catalytic activity and thermal stability. The enzyme activity of this galactitol dehydrogenase mutant is 50 U / mg at a substrate concentration of 100 mmol / L, which is 24 times that of the wild type. Among all reported galactitol dehydrogenases, the enzyme activity of this mutant is the highest. At the same time, the half-life of this mutant reaches 128 h under the conditions of pH 8.0 and 35 °C, showing important industrial application prospects.

[0018] 2. The present invention uses the galactitol dehydrogenase mutant and NADH oxidase as catalysts, and NAD +As a hydrogen acceptor, it catalyzes the preparation of D-tagatose from galactitol under weakly alkaline conditions, and can completely convert galactitol into D-tagatose within 12 hours, with the advantages of high substrate concentration, high conversion efficiency, low cost and no by-products. Brief Description of the Drawings

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0020] Figure 1 SDS-PAGE detection results of RlGDH and T193G / G98C mutant; among them, M is Marker; 1 is RlGDH; 2 and 3 are T193G / G98C mutant;

[0021] Figure 2 Optimal reaction temperature detection result graph of RlGDH(WT) and T193G / G98C mutant;

[0022] Figure 3 Optimal reaction pH detection result graph of RlGDH(WT) and T193G / G98C mutant;

[0023] Figure 4 Temperature stability detection result graph of RlGDH(WT) and T193G / G98C mutant;

[0024] Figure 5 pH stability detection result graph of RlGDH(WT) and T193G / G98C mutant;

[0025] Figure 6 Result graph of detecting RlGDH enzyme activity at different galactitol concentrations;

[0026] Figure 7 Result graph of detecting the enzyme activity of T193G / G98C mutant at different galactitol concentrations;

[0027] Figure 8 HPLC detection graph of D-tagatose standard sample;

[0028] Figure 9 HPLC detection graph of galactitol standard sample;

[0029] Figure 10 HPLC detection graph of preparing D-tagatose by combining T193G / G98C mutant with NADH oxidase SpNox. Detailed Implementation Modes

[0030] The various exemplary implementation modes of the present invention will now be described in detail. This detailed description should not be considered as a limitation on the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing specific implementation modes and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0033] Without departing from the scope or spirit of the present invention, various improvements and variations can be made to the specific implementation modes of the specification of the present invention, which are obvious to those skilled in the art. Other implementation modes obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0034] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0035] The materials used in the embodiments of the present invention include: Escherichia coli T7 and expression vector pET-30a were purchased from Novagen. Reagents such as restriction endonucleases and DNA polymerases were purchased from TaKaRa. Galactitol, D-tagatose, nitroblue tetrazolium (NBT), and phenazinemethosulphate (PMS) were purchased from Sigma-Aldrich. Other consumable reagents were purchased from Shanghai Bioengineering Technology Co., Ltd.

[0036] Example 1 Screening of Galactitol Dehydrogenase with High Catalytic Activity

[0037] 1. Homology Modeling and Molecular Docking of Galactitol Dehydrogenase

[0038] Galactitol dehydrogenase RlGDH from Rhizobium leguminosarum and its cofactor NAD + The three-dimensional structure was generated by AlphaFold3 Sever. Then, the galactitol molecule was docked into the active center of the substrate pocket of the three-dimensional structure using AutoDock Vina, and the docking results were analyzed using the PyMol 2.5.2 visualization tool.

[0039] The amino acid sequence of the RlGDH enzyme is shown in SEQ ID NO.1, and the nucleotide sequence of the RlGDH gene is shown in SEQ ID NO.2.

[0040] SEQ ID NO.1:

[0041] MSYQQKFRLDGERAVVTGGGRAIGLCCTEALAEAGAAVVVIERSEADAEQALALRNRGYDVEVRVGDVTDAARMDAIATELADGGRPATILVNNAGIGQSGIPAQDLTDADWLRMMDVNLNGVFWCSRAFGRSMISMKRGAIVNLGSMSGTICNRPQPQTAYNVSKAAVHHLTRSLAAEWAHHGIRVNAVAPTYIETPMVVAVEANRERIPLWLADTPMARMGTPEEVASAVLFLASGAASLMTGAIVNVDAGFTCW*.

[0042] SEQ ID NO.2:

[0043] atgtcttaccagcagaaattccgtctggatggtgaacgtgctgttgttaccggtggtggtcgtgcgatcggtctgtgttgcaccgaagcattagctgaagcgggtgctgccgtagtagtaattgaacgttctgaagctgatgctgaacaggctctggctctgcgtaaccgtggttatgatgttgaagttcgtgttggcgatgttaccgatgcggcgcgtatggatgcgatcgcgaccgaactggctgatggcggtcgtccggcgaccatcctggttaacaacgcgggcatcggccagagcggtatcccggcacaggatctgaccgatgcggattggctgcgtatgatggatgttaacctgaacggtgttttctggtgctctcgtgcgttcggtcgtagcatgatctctatgaaacgtggcgcgatcgttaacctgggcagcatgagcggcaccatctgcaaccgtccgcagccgcagaccgcgtacaacgttagcaaagcggcggttcatcacctgacccgtagcctggcggctgaatgggcgcaccacggtatccgtgttaacgcggttgcgccgacctacatcgaaaccccgatggttgttgcggttgaagcgaaccgtgaacgtatcccgctgtggctggcggataccccgatggcgcgtatgggcaccccggaagaagttgcgagcgcggttctgttcctggcgtctggcgcggcgagcctgatgaccggcgcgatcgttaacgttgatgcgggcttcacctgctggtaa。

[0044] 2. Construction of mutant library

[0045] The RlGDH substrate was selected in the present invention Amino acids within the range (I97, G98, Q99, S100, M148, S149, N154, Q157, Q159, N163, P192, T193, Y194, I195, T197, M199, V200, V203, N206, R209, W213) were used as mutation sites, and iterative saturation mutagenesis strategy was adopted for mutagenesis. First, galactitol substrate was selected through a molecular docking model All amino acids within the range were subjected to the first round of site-saturation mutagenesis. After the first round of saturation mutagenesis, the mutation sites of mutants with high activity were screened out. Then, the mutant with the highest enzyme activity in the first round was selected as the control for the next round of saturation mutagenesis. Iterative saturation mutagenesis was performed on all amino acids within the range of galactitol substrate in turn.

[0046] Using the pET-30a-RlGDH plasmid as a template, site-directed saturation mutagenesis was carried out by NNK primer-mediated whole plasmid PCR. After the PCR product was digested with Dpn I to remove the template, it was transformed into Escherichia coli T7 competent cells by heat shock method to obtain a mutant library.

[0047] Construction method of pET-30a-RlGDH plasmid: The amino acid sequence of galactitol dehydrogenase from Rhizobium leguminosarum (GenBank ID: WP_011650422.1) was optimized by codons to obtain a gene sequence, which was then synthesized by GenScript Biotech Corporation and inserted into the multiple cloning site of plasmid pET-30a(+) through restriction endonucleases Nde I and Xho I to obtain the recombinant plasmid pET-30a-RlGDH.

[0048] 3. High-throughput screening of mutants with high enzyme activity

[0049] Highly catalytically active galactose-2-dehydrogenase mutants were screened by a high-throughput screening method based on NBT-PMS color reaction. The specific principle is as follows: Galactitol will generate D-tagatose under the catalysis of galactitol dehydrogenase, and at the same time reduce the cofactor NAD + to NADH. NBT and NADH will react under the action of PMS to generate bright blue-violet formazan and NAD + , and formazan has a relatively high absorption rate at OD 580 . By comparing and observing the color change depth of wild enzyme and mutant enzyme or measuring the OD 580 absorbance value, mutants with high enzyme activity can be quickly screened out.

[0050] First, 188 mutants (coverage rate ≥ 99%) and 4 wild-type controls were selected from the amino acid mutant library at each mutation site using a sterilized toothpick and placed in 96-well deep-well plates (2 plates) containing 200 μL of TB (50 μg / L kanamycin). The microplate shaker was set at 37°C and shaken at 1000 rpm for 12 h. Then, 100 μL of the culture was transferred from the two deep-well plates to another two 96-well microplates (storage plates) using a multi-channel pipette. After adding 100 μL of 40% glycerol, the strains were stored at -80°C. Subsequently, 900 μL of fresh TB (50 μg / L kanamycin, 0.1 mM IPTG) was added to the master plates of the two deep-well plates using a multi-channel pipette, and the microplate shaker was set at 20°C and shaken at 1000 rpm for 20 h for induction. Finally, the medium was removed by centrifugation at 4000 rpm, 100 μL of cell lysis buffer was added, and the cells were completely lysed by shaking on the microplate shaker at room temperature for 20 min. The supernatant was collected by centrifugation at 4000 rpm. After diluting the supernatant with the buffer in an appropriate ratio, 50 μL of the diluted solution was aspirated using a multi-channel pipette and mixed with an equal volume of chromogenic solution (5 mM galactitol, 1 mM NAD + 、100 mM Tris-HCl 8.0, 0.3 g / L NBT, 0.01 g / L PMS) and reacted in the dark. After 20 minutes of reaction, the color intensity after the reaction was observed and recorded, and the OD 580 absorbance was measured using an enzyme-linked immunosorbent assay reader. For each screening plate, the top three mutants with a darker color than the control and an OD 580 absorbance higher than the control were cultured overnight, and the plasmids were extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After the first round of saturation mutagenesis was completed for all selected mutation sites, the mutant with the highest enzyme activity after mutation was used as the control, and then the second round of site-directed saturation mutagenesis and screening were carried out.

[0051] Galactitol dehydrogenase mutants with high catalytic activity were obtained through screening. After plasmid extraction and sequencing identification, the mutant was found to be T193G / G98C. Its amino acid sequence is shown in SEQ ID NO.3, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.4.

[0052] SEQ ID NO.3:

[0053] MSYQQKFRLDGERAVVTGGGRAIGLCCTEALAEAGAAVVVIERSEADAEQALALRNRGYDVEVRVGDVTDAARMDAIATELADGGRPATILVNNAGICQSGIPAQDLTDADWLRMMDVNLNGVFWCSRAFGRSMISMKRGAIVNLGSMSGTICNRPQPQTAYNVSKAAVHHLTRSLAAEWAHHGIRVNAVAPGYIETPMVVAVEANRERIPLWLADTPMARMGTPEEVASAVLFLASGAASLMTGAIVNVDAGFTCW*。

[0054] SEQ ID NO.4:

[0055] atgtcttaccagcagaaattccgtctggatggtgaacgtgctgttgttaccggtggtggtcgtgcgatcggtctgtgttgcaccgaagcattagctgaagcgggtgctgccgtagtagtaattgaacgttctgaagctgatgctgaacaggctctggctctgcgtaaccgtggttatgatgttgaagttcgtgttggcgatgttaccgatgcggcgcgtatggatgcgatcgcgaccgaactggctgatggcggtcgtccggcgaccatcctggttaacaacgcgggcatctgtcagagcggtatcccggcacaggatctgaccgatgcggattggctgcgtatgatggatgttaacctgaacggtgttttctggtgctctcgtgcgttcggtcgtagcatgatctctatgaaacgtggcgcgatcgttaacctgggcagcatgagcggcaccatctgcaaccgtccgcagccgcagaccgcgtacaacgttagcaaagcggcggttcatcacctgacccgtagcctggcggctgaatgggcgcaccacggtatccgtgttaacgcggttgcgccggggtacatcgaaaccccgatggttgttgcggttgaagcgaaccgtgaacgtatcccgctgtggctggcggataccccgatggcgcgtatgggcaccccggaagaagttgcgagcgcggttctgttcctggcgtctggcgcggcgagcctgatgaccggcgcgatcgttaacgttgatgcgggcttcacctgctggtaa。

[0056] Example 2 Induction, Expression and Purification of RlGDH and T193G / G98C Mutants

[0057] The recombinant Escherichia coli expressing RlGDH or T193G / G98C mutant constructed in Example 1 was cultured, induced, expressed and purified. The specific methods are as follows:

[0058] The recombinant Escherichia coli was inoculated into 100 mL of TB medium containing kanamycin (50 μg / mL) and cultured with shaking at 37°C until OD600 When it was 0.4, IPTG was added to make its final concentration 0.1 mmol / L, and induced at 20 °C for 18 h. The induced bacterial solution was centrifuged at 8000 rpm for 10 min, the supernatant was discarded, the thalli were collected, resuspended with lysis buffer (pH 8.0, 10 mmol / L imidazole, 300 mmol / L NaCl, 50 mmol / L Tris-HCl), and then 1 mL of lysozyme (10 mg / mL) was added and left standing on ice for 15 min. Then ultrasonic cell disruption was carried out (power 250 w, working time 5 s, interval time 10 s, total time 30 min, ice bath). After cell disruption, the disrupted solution was centrifuged at 12000 rpm at 4 °C for 25 min, and the supernatant was the crude enzyme solution. The crude enzyme solution and the nickel-containing filler in the treated chromatography column were all transferred to a clean finger-shaped bottle, sealed with a sealing film and buried in ice, and shaken on a shaker for 1 h to make the nickel in the filler and the enzyme fully bind to the enzyme protein with a histidine tag. The filler and enzyme mixture was poured onto the column for purification. The miscellaneous proteins were eluted 4 times with wash buffer (pH 8.0, 20 mmol / L imidazole, 300 mmol / L NaCl, 50 mmol / L Tris-HCl). 1 mL of Elution buffer (pH 8.0, 250 mmol / L imidazole, 300 mmol / L NaCl, 50 mmol / L Tris-HCl) was added to elute the protein. The eluted protein solution was collected and verified by denaturing polyacrylamide gel electrophoresis (SDS-PAGE).

[0059] The results are as Figure 1 shown. There is a single band at 28 KDa, that is, the purified RlGDH and T193G / G98C mutant enzymes are obtained.

[0060] Example 3 Study on the Enzymatic Properties of RlGDH and T193G / G98C Mutant Enzymes

[0061] Definition of galactitol dehydrogenase activity unit: Under the conditions of the optimal temperature and optimal pH, the amount of enzyme required to generate 1 μmol of NADH per minute is one enzyme activity unit (1 U).

[0062] Determination method: Add 990 μL of galactitol prepared with Tris-HCl buffer as the substrate to a 1.5 mL EP tube, then add 10 μL of appropriately diluted enzyme solution. Add 10 μL of the enzyme solution that has been boiled and inactivated to the blank control tube. After reacting for 3 min under the optimal conditions, immediately take it out and pour it into a cuvette for detecting the OD 340 absorbance value. Calculate the amount of NADH generated in the reaction according to the standard curve, and then calculate the enzyme activity of galactitol dehydrogenase.

[0063] (1) Detection of the Optimal Temperature of RlGDH and T193G / G98C Mutant

[0064] Using 100 mM galactitol prepared with pH 8.0 Tris-HCl buffer as the substrate, the enzyme activities of RlGDH and T193G / G98C mutant were measured at temperatures ranging from 25 °C to 55 °C respectively. Taking the temperature measurement with the highest enzyme activity as 100%, the relative enzyme activities at other temperatures were then calculated. The results are as Figure 2 shown. The optimal temperature of the wild enzyme RlGDH is 35 °C, and that of the T193G / G98C mutant is 40 °C. However, the enzyme activity of the T193G / G98C mutant still remains above 60% of the highest enzyme activity at 50 °C.

[0065] (2) Detection of the Optimal pH of RlGDH and T193G / G98C Mutant

[0066] Buffers with different pH ranges were used, namely 50 mM Tris-HCl buffer (pH 7.0 - 8.9) and 50 mM Tris-glycine-NaOH buffer (pH 9 - 11.5). 100 mM galactitol was prepared as the substrate, and the enzyme activities of RlGDH and T193G / G98C mutant were measured at 30 °C. Taking the pH measurement with the highest enzyme activity as 100%, the relative enzyme activities under other pH conditions were then calculated. The results are as Figure 3 shown. The optimal pH of the wild enzyme RlGDH is 9.5, and that of the T193G / G98C mutant is 10.5. However, the enzyme activity of the T193G / G98C mutant still remains above 60% of the highest enzyme activity in the pH range of 9.0 - 11.5.

[0067] (3) Detection of the Temperature Stability of RlGDH and T193G / G98C Mutant

[0068] The purified RlGDH and T193G / G98C mutant were respectively dissolved in 50 mM Tris-HCl (pH 8.0), and then incubated in a 35 °C water bath. Samples were taken at different time intervals to measure the residual enzyme activity. Taking the activity of the untreated enzyme as 100%, the temperature stability curves of RlGDH and the mutant were plotted. The half-life (t 1 / 2 ) is defined as the time when the activity drops to 50% of the initial activity and is calculated by non-linear regression. The results are as Figure 4 shown. The temperature stability of the wild enzyme RlGDH is poor, with a half-life of only 7.5 hours, while the half-life of the T193G / G98C mutant reaches 128 hours at 35 °C, showing extremely strong thermal stability.

[0069] (4) Detection of the pH Stability of RlGDH and T193G / G98C Mutant

[0070] The purified RlGDH and T193G / G98C mutant were respectively dissolved in a buffer solution with a pH of 7.0 - 11.5 and incubated at 4 °C for 12 h, and then the residual enzyme activity was measured under the optimal conditions. Taking the activity of the untreated enzyme as 100%, the pH stability curves of RlGDH and the mutant were plotted. The results are as Figure 5 shown. The wild-type enzyme RlGDH remained stable between pH 7.0 - 9.5. The T193G / G98C mutant showed stronger pH stability, and the enzyme activity still remained above 70% of the highest enzyme activity under the broad pH value conditions of 7.0 - 11.0.

[0071] (5) Determination of V max and K m values of RlGDH and T193G / G98C mutant

[0072] Taking the optimal reaction temperature and optimal reaction pH of the wild-type enzyme RlGDH as the conditions, the V max and K m values of RlGDH and T193G / G98C mutant were measured, and the reaction time was 3 minutes. Enzyme activity was measured by reacting the enzyme solution with the same concentration with galactitol substrates of 2.5 mmol / L, 5 mmol / L, 10 mmol / L, 25 mmol / L, 50 mmol / L, 75 mmol / L, 100 mmol / L, 150 mmol / L, 200 mmol / L, and 300 mmol / L respectively. Nonlinear fitting was performed using GraphPad Prism 9, and the K m value and V max value were calculated using the Michaelis - Menten equation.

[0073] The results are as Figure 6 shown. The K m value of the wild-type enzyme RlGDH was 23.14 ± 0.82 mM, and the V max value was 5.43 ± 0.4 U / mg. The results are as Figure 7 shown. The K m value of the T193G / G98C mutant was 181.5 ± 13.39 mM, and the V max value was 134.2 ± 5.21 U / mg. The enzyme activity of the T193G / G98C mutant reached 50 U / mg at a substrate concentration of 100 mmol / L, which was 24 times that of the wild type. At the same time, the enzyme activity of the T193G / G98C mutant was the highest among all reported galactitol dehydrogenases.

[0074] Example 4 Preparation of D - tagatose by combining the T193G / G98C mutant with NADH oxidase

[0075] The T193G / G98C mutant and NADH oxidase - SpNOX enzyme (amino acid sequence shown in SEQ ID NO.5) are used in combination to prepare D-tagatose, and the method is as follows:

[0076] A crude enzyme reaction on a 100 mL scale is carried out in a 500 mL baffled Erlenmeyer flask.

[0077] Reaction system: 1 g of crude enzyme of T193G / G98C mutant, 1 g of SpNOX crude enzyme, 0.067 g of NAD + , 360 g / L galactitol substrate, pH 8.0 Tris-HCl buffer. After reacting in an oxygen environment with shaking at 220 rpm for 12 h, the production amount of D-tagatose is detected by HPLC.

[0078] The HPLC conditions are as follows: Instrument: waters1525 chromatograph; Chromatographic column: MARS MCa HPX-87C; Mobile phase: ultrapure water; Flow rate: 0.6 mL / min; Detector: waters 2414 refractive index detector.

[0079] Figure 8 and Figure 9 are the HPLC diagrams of the standard samples of D-tagatose and galactitol respectively; Figure 10 is the HPLC diagram of the preparation of D-tagatose by coupling the T193G / G98C mutant and NADH oxidase. The results of HPLC detection show that 360 g / L of galactitol is completely converted into D-tagatose. This is the highest yield among all reports on the production of D-tagatose using galactitol dehydrogenase as a catalyst.

[0080] In summary, the galactitol mutant T193G / G98C of the present invention has high catalytic activity and good thermal stability towards galactitol, and can completely convert the high-concentration substrate galactitol into D-tagatose by coupling with NADH oxidase.

[0081] SEQ ID NO.5:

[0082] MGSKIVVVGANHAGTACIKTMLTNYGDANEIVVFDQNSNISFLGCGMALWIGEQIAGPEGLFYSDKEELESLGAKVYMESPVQSIDYDAKTVTALVDGKNHVETYDKLIFATGSQPILPPIKGAEIKEGSLEFEATLENLQFVKLYQNSADVIAKLENKDIKRVAVVGAGYIGVELAEAFQRKGKEVVLIDVVDTCLAGYYDRDLTDLMAKNMEEHGIQLAFGETVKEVAGNGKVEKIITDKNEYDVDMVILAVGFRPNTTLGNGKIDLFRNGAFLVNKRQETSIPGVYAIGDCATIYDNATRDTNYIALASNAVRTGIVAAHNACGTDLEGIGVQGSNGISIYGLHMVSTGLTLEKAKRLGFDAAVTEYTDNQKPEFIEHGNFPVTIKIVYDKDSRRILGAQMAAREDMSMGIHMFSLAIQEGVTIEKLALTDIFFLPHFNKPYNYITMAALGAKD*。

[0083] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the spirit of the present invention design, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A galactitol dehydrogenase mutant, characterized in that, The amino acid sequence is as shown in SEQ ID NO.

3.

2. A coding gene for the galactitol dehydrogenase mutant according to claim 1.

3. The coding gene according to claim 2, wherein The nucleotide sequence of the coding gene is as shown in SEQ ID NO.

4.

4. A recombinant vector, characterized in that, Comprising the coding gene according to claim 2 or 3.

5. A recombinant host cell, characterized in that, Comprising the recombinant vector according to claim 4.

6. Use of the coding gene according to claim 2 or 3, the recombinant vector according to claim 4, or the recombinant host cell according to claim 5 in the preparation of the galactitol dehydrogenase mutant according to claim 1.

7. Use of the galactitol dehydrogenase mutant according to claim 1 in the preparation of D-tagatose.

8. An enzyme combination for preparing D-tagatose, characterized in that, Comprising NADH oxidase and the galactitol dehydrogenase mutant according to claim 1.

9. Use of the enzyme combination according to claim 8 in the preparation of D-tagatose.

10. A method for preparing D-tagatose, characterized in that, Comprising a step of using galactitol as a substrate, using the enzyme combination according to claim 8 as a catalyst, and using NAD + as a hydrogen acceptor, and preparing the D-tagatose through a catalytic reaction.

Images