Molecular marker related to intramuscular fat content and meat color character of pig and application of molecular marker

Abstract

The invention discloses a molecular marker related to pig intramuscular fat content and meat color character and application, and belongs to the technical field of molecular markers. A section of 2279bp insertion structure variation exists in a ninth exon region of the FMO3 gene, and polymorphism detection in a Beijing black pig population finds that three types of genotypes, namely homozygote insertion (AA), homozygote insertion-free (WW) and heterozygote (AW), exist on the locus. The three genotypes and Beijing black pig meat quality characters are subjected to correlation analysis, and the result shows that the intramuscular fat content of the WW genotype is remarkably higher than that of the AA genotype and the AW genotype; the meat color character of the AA genotype is obviously higher than that of the AW genotype. The invention provides a new thought for further researching the effect of the FMO3 gene on the pork quality character, and provides a theoretical reference for the breeding work related to the pork quality.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a molecular marker related to pig intramuscular fat content and meat color traits and an application thereof. Background Art

[0002] my country is not only a major pig-breeding country, but also one of the world's largest consumers of pork. People's requirements for pork quality continue to increase with the improvement of living conditions. Among the many factors that affect meat quality traits, genetics plays a large role. Therefore, breeding pig breeds that meet people's demands for meat quality (such as meat color, intramuscular fat, flavor, etc.) while improving lean meat percentage will become one of the important breeding indicators for future breeding work.

[0003] Flavin-containing monooxygenases (FMOs) are responsible for catalyzing the oxidation of substances containing nucleophilic nitrogen, sulfur, phosphorus or selenium heteroatoms. The six subtypes of FMOs share approximately 55% amino acid homology, of which the first five are functional and are involved in the metabolic activation or detoxification of chemicals including pesticides, drugs and dietary-derived compounds. FMO3 is considered the most important member of the FMO family in the metabolism of xenobiotics and is involved in the degradation of trimethylamine (TMA), which is associated with trimethylaminouria (TMAU) in humans and the characteristic fishy odor in other species. TMA is considered to be the main endogenous substrate of FMO3 and is the product of the reduction and oxidation of trimethylamine (TMAO), choline, phosphatidylcholine and betaine by intestinal bacteria. FMO3 has been reported to be downregulated in tissues with high fat deposits, so it can be speculated that fatty acid oxidation or increased lipogenesis in muscle adipocytes may be caused by decreased FMO3 expression. FMO3 and other FMO gene families play an important role in regulating the production of pork odor. In addition, this gene is also related to fishy smell, pork pH and fat deposition. However, whether the structural variation of this gene has an effect on the meat quality traits of pigs has not been reported yet.

[0004] Beijing Black Pig is a special breeding variety obtained by crossbreeding and breeding of scientific and technological workers in Beijing Shuangqiao Farm and Beijiao Farm. It is recognized as a maternal original breed by the National Lean Pig Production Project. In terms of meat quality, Beijing Black Pig has less bones, thick back fat, high redness and low yellowness, and the intramuscular fat content can reach more than 3%, with a strong flavor. Therefore, taking Beijing Black Pig as the research object and analyzing the structural variation of FMO3 gene can provide new ideas for further studying the role of FMO3 gene in pork quality traits and provide a reference for breeding work related to pork quality. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker related to pig intramuscular fat content and meat color traits and its application to solve the problems existing in the above-mentioned prior art. The present invention found that there is an insertion structural variation in the FMO3 gene, which is related to pig intramuscular fat content and meat quality traits, providing a new idea for further studying the effect of the FMO3 gene on pork quality traits and providing a theoretical reference for breeding work related to pork quality.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides a molecular marker related to intramuscular fat content and meat color traits of pigs. The molecular marker is an insertion fragment at the 85th base and the 86th base of the sequence shown in SEQ ID NO.5, and the nucleotide sequence of the insertion fragment is shown in SEQ ID NO.7; the genotype of the site where the insertion fragment is located includes a homozygous genotype WW without insertion, a heterozygous genotype AW containing the insertion fragment, and a homozygous genotype AA containing the insertion fragment.

[0008] The present invention also provides a primer combination for detecting the molecular marker, comprising an upstream primer LF with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer LR with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer SF with a nucleotide sequence as shown in SEQ ID NO.3, and an upstream primer SF with a nucleotide sequence as shown in SEQ ID NO.4.

[0009] The invention also provides a kit for identifying the intramuscular fat content and meat color traits of pigs, comprising the primer combination.

[0010] The present invention also provides the application of the primer combination or the kit in identifying the intramuscular fat content and meat color traits of pigs.

[0011] Optionally, the meat color trait is meat color b value.

[0012] Optionally, the pig is a Beijing black pig.

[0013] The present invention also provides a method for identifying the intramuscular fat content and meat color traits of pigs, comprising the following steps:

[0014] Using the pig sample DNA to be tested as a template, using the primer combination to perform PCR amplification on the template to obtain an amplified product;

[0015] The amplified product is subjected to gel electrophoresis. If the electrophoresis result shows that only a band of 134 bp is contained, the genotype of the pig sample to be tested is WW; if the electrophoresis result shows that only bands of 2413 bp and 755 bp are contained, the genotype of the pig sample to be tested is AA; if the electrophoresis result shows that bands of 2413 bp, 755 bp and 134 bp are contained at the same time, the genotype of the pig sample to be tested is AW;

[0016] The intramuscular fat content of WW genotype was significantly higher than that of AA and AW genotypes;

[0017] The meat color trait of AA genotype was significantly higher than that of AW genotype;

[0018] The meat color trait is the meat color b value.

[0019] Optionally, the reaction system for PCR amplification is: 12.5 μL of 2×Taq PCR Master Mix, 1 μL of each of 10 μmol / L upstream and downstream primers, 9.5 μL of ddH2O, and 1 μL of DNA template.

[0020] Optionally, the reaction procedure of the PCR amplification is: 94.0°C for 5 min; 94.0°C for 30 sec, 59°C for 30 sec, 72.0°C for 2 min and 30 sec, 31 cycles; 72.0°C for 5 min; and stored at 4°C.

[0021] Optionally, the pig is a Beijing black pig.

[0022] The present invention discloses the following technical effects:

[0023] The present invention discovered a structural variation in the 9th exon region of the FMO3 gene (Chr9: 63,757,964-63,777,279 bp) located on chromosome 9 of the Sus scrofa 11.1 version genome, and the structural variation is an insertion fragment of 2279 bp.

[0024] The present invention conducts polymorphism detection in Beijing black pig population and finds that there are three types of genotypes at the locus, homozygous insertion (AA), homozygous no insertion (WW) and heterozygous (AW). The above three genotypes are associated with Beijing black pig meat traits. The results show that the intramuscular fat content of the WW genotype is significantly higher than that of the AA genotype and the AW genotype; the meat color trait of the AA genotype is significantly higher than that of the AW genotype.

[0025] The present invention provides a new idea for further studying the effect of FMO3 gene on pork quality traits and provides a theoretical reference for breeding work related to pork quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 The insertion breakpoints in S. scrofa 11.1 and the insertion sequence in the Meishan pig DNA sequence; Note: The upper figure shows the structure of the FMO3 gene in S. scrofa 11.1, and the vertical black line is the insertion breakpoint; the middle figure shows the DNA sequence of the insertion fragment; the lower figure shows the structure of the corresponding gene in the Meishan pig genome annotation;

[0028] Figure 2 Schematic diagram of PCR primers within and across the inserted sequence;

[0029] Figure 3 The results of PCR amplification of the structural variation of the FMO3 gene insert using primers (SF; SR) for 19 varieties;

[0030] Figure 4 This is the electrophoresis diagram of the Beijing Black Pig FMO3 insertion site typing; among them, 318 is homozygous insertion; 331 is heterozygous; 266 is homozygous without insertion;

[0031] Figure 5 It is the basis for genotyping;

[0032] Figure 6 The identification results of Sanger sequencing; A: 134bp alignment; B: 2413bp alignment;

[0033] Figure 7 are the gene frequency and genotype frequency of the inserted fragment in the Beijing black pig population. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] Example

[0040] 1. Experimental samples and groups

[0041] 336 Beijing Black Pig purebred pigs were from the Beijing Black Pig breeding core group of Beijing Heiliu Animal Husbandry Technology Co., Ltd., and their longissimus dorsi muscles were taken as samples, including 171 boars and 165 sows. Meat samples with a length of 3 cm and a width of 1 cm were cut along the direction of the muscle fibers with a scalpel and placed in a 2 mL cryotube and stored in liquid nitrogen for later use. European pig samples were ear tissue samples, and local pig samples were DNA samples stored at -36 ° C, all of which were stored by Liu Jianfeng's laboratory, College of Animal Science and Technology, China Agricultural University, National Engineering Laboratory for Animal Genetics and Breeding. Specific information is shown in Table 1.

[0042] Table 1 Sample information table

[0043]

[0044]

[0045] 2. Extraction, concentration determination and quality testing of porcine genomic DNA

[0046] Use the Blood / Cell / Tissue Genomic DNA Extraction Kit (DP304) to extract DNA from muscle tissue and ear tissue as follows:

[0047] (1) Add a certain amount of anhydrous ethanol to GD and PW according to the instructions.

[0048] (2) Material processing: Cut 30 mg of ear / muscle tissue into a 1.5 mL centrifuge tube and cut and grind as much as possible.

[0049] (3) Add 200 μL of buffer GA and vortex until thoroughly suspended.

[0050] (4) Add 20 μL of proteinase K and mix well, then place in a molecular hybridization oven at 56°C for overnight digestion.

[0051] (5) Add 200 μL of buffer GB to the digested tissue solution, mix thoroughly by inversion, and place in a water bath at 70°C for about 10 min. Wait for the tissue solution to clarify and then centrifuge for 10 s.

[0052] (6) Add 200 μL of anhydrous ethanol, shake for 15 seconds, and centrifuge for 10 seconds.

[0053] (7) Add the liquid and precipitate obtained in step (6) to the adsorption column a-collection tube A, centrifuge (12000 rpm, 30 s), and discard the waste liquid.

[0054] (8) Add 500 μL of buffer GD to the adsorption column a-collection tube A (12000 rpm, 30 s) and discard the waste liquid from the centrifugation.

[0055] (9) Add 600 μL PW to adsorption column a-collection tube A, centrifuge (12000 rpm, 30 s), and discard the waste liquid.

[0056] (10) Repeat the previous step to rinse again and centrifuge (12000 rpm, 30 s). After centrifugation, open the lid and let it stand to dry the alcohol-containing rinse solution.

[0057] (11) Assemble adsorption column a-collection tube B, elute the DNA on the adsorption column membrane with a certain amount of TE solution, let it stand for 5 minutes, and then centrifuge (12000 rpm, 30 seconds).

[0058] Use a nucleic acid quality detector to test, use elution buffer TE (the reagent for dissolving DNA at the end of genome extraction) as a blank control, and start testing the sample when the concentration is ±0.2ng / μL. Take 2μL of DNA sample each time for measurement. After each sample is measured, use TE buffer solution to wash and wipe the optical surface with lens paper. The software will automatically calculate the concentration, purity and spectral image of DNA for evaluation. According to the A given by the software 260 and A 280 The OD value at the place is used for judgment. If the measured A 260 / A 280 A value between 1.8 and 2.2 meets the DNA purity requirements.

[0059] 3. Amplification of target sequence

[0060] Primer design and synthesis: The preliminary study of the present invention found that there is a 2279 bp insertion sequence in the FMO3 gene, which is located 229 bp downstream of the FMO3 gene (Chr9: 63,757,964-63,777,279 bp) on chromosome 9 of the Sus scrofa11.1 version genome, and is the 9th exon region of the FMO3 gene, see Figure 1 Use Premier3 software to design a pair of primers inside and across the insertion sequence. The design principle is shown in Figure 2 , primer sequences are shown in Table 2.

[0061] Table 2 Common PCR primer sequences

[0062]

[0063] The extracted genomic DNA was amplified by PCR using the above two pairs of primers (LF and LR, SF and SR), respectively. The amplification system used for PCR was 25 μL, which was: 2×Taq PCR Master Mix 12.5 μL, 10 μmol / L upstream primer (LF / SF) and downstream primer (LR / FR) 1 μL each, ddH2O 9.5 μL, and genomic DNA 1 μL.

[0064] The reaction conditions used for PCR were as follows: ① pre-denaturation: 94.0℃5min; ② denaturation: 94.0℃30sec; ③ annealing: 59℃30sec; ④ extension: 72.0℃2min 30sec; ⑤ 31 cycles of steps ②-④; ⑥ 72.0℃5min; ⑦ storage at 4℃.

[0065] Target sequence without insert fragment (SEQ ID NO.5):

[0066] TGCCTCCATAGCTTTTCCCAATGTCAGGGAGTGCCTTAGATTTTCTGCATATCTGTGA CGTCTCAGACTCAACACAGAGCTGAAACAACAATCCCAAGATCCTGCAGGTCAGCTTCA TACCTAGTCAGCATAGC.

[0067] Target sequence containing the inserted fragment (SEQ ID NO.6):

[0068]

[0069] Insert fragment (SEQ ID NO.7):

[0070]

[0071] 4. PCR product agarose gel electrophoresis detection and genotype determination

[0072] (1) Take a clean conical flask, measure 100 mL of 1×TBE solution into the clean conical flask, add 1.3 g of agarose, shake gently to mix, and place in a microwave oven, heat on medium-high heat until the agarose is completely melted and slightly boiling. When the conical flask is "not hot to the touch", add 5 μL of GelStain dye and mix well.

[0073] (2) Pour the solution into the gel tray with the “comb” inserted.

[0074] (3) After the gel solution has cooled and completely solidified, gently pull out the "comb" and place the gel into the electrophoresis tank with the sample well facing the negative electrode. Remove the bubbles and then apply the sample. Apply 4 μL of sample to each well and apply Trans2K PlusⅡDNA Marker to a blank well as a control.

[0075] (4) Turn on the electrophoresis instrument, set the voltage to 111V and the current to 260mA, and turn off the switch after 50 minutes of electrophoresis. Observe whether there is a target band in the gel imaging system instrument. If the PCR product of the inserted fragment structural variation successfully matches the expected size and position, it is considered to have been successfully verified.

[0076] (5) Based on the fact that individuals with structural variation of the insert fragment amplified 2413 bp bands and 755 bp bands, and individuals without structural variation of the insert fragment only amplified 134 bp bands, the insert fragments of the FMO3 gene were typed. The homozygous insertion genotype only contained the 2413 bp band and the 755 bp band, the heterozygous insertion genotype contained the 2413 bp band, the 134 bp band and the 755 bp band, and the non-insertion genotype only contained the 134 bp band.

[0077] Gel excision, recovery and sequencing: Gel electrophoresis can only roughly determine the position of the band. In order to confirm that the amplified band is the target band, the amplified product is placed under a UV transmission gel excision table after gel electrophoresis, and the target bands to be detected (2413bp and 134bp) are cut with a clean scalpel and placed in a 1.5mL centrifuge tube. Beijing Shenggong Biotechnology Co., Ltd. will test and splice them, and the sequencing results will be viewed and analyzed by DNAMAN.

[0078] The results show Figure 3 and Figure 4 The PCR amplification product bands of 18 varieties except Duroc were 755 bp, which was consistent with the target fragment size of the designed primers and had no mixed bands, indicating that the insertion existed in all 18 varieties, but not in Duroc ( Figure 3), which is consistent with the results of structural variation detection of Chinese local pig breeds using pig whole genome sequencing data. There are three different gene types at this locus in the Beijing black pig population, homozygous insertion (AA), homozygous no insertion (WW) and heterozygous (AW) ( Figure 4 ), according to the designed primers, the theoretical target band sizes and numbers of the three genotypes should be as follows Figure 5 .

[0079] The target fragments of the primers (LF; LR) designed across the insertion sequence were compared and verified using DNAMAN software. The target band obtained by electrophoresis of Duroc 1115 (homozygous without insertion) was cut, sequenced, and spliced ​​to be compared with the target band (134 bp). The target band obtained by electrophoresis of Beijing Black Pig 416 (homozygous insertion) was cut, sequenced, and spliced ​​to be compared with the target band (2413 bp). The results are as follows Figure 6 The alignment results show that the alignment consistency of 134bp is 99.24%, and the alignment consistency of 2413bp is 97.22%. Excluding the influence of the sequencing technology itself, which may have a low alignment rate in the first dozen bp, it shows that the amplified fragment is the target fragment.

[0080] 5. Genotype and allele frequency of the inserted sequence

[0081] In order to study the polymorphism of the insertion fragment in the pig population, the gene frequency and genotype frequency of the new sequence insertion fragment in a Beijing black pig sample group of 336 individuals (171 boars and 165 sows) were detected using Excel 2010 and population typing method.

[0082] Among them, there were 8 pigs with WW genotype (4 boars and 4 sows), 156 pigs with AW genotype (83 boars and 73 sows), and 172 pigs with AA genotype (84 boars and 88 sows). In this group of 336 individuals, the ratio of AA genotype and AW genotype individuals was about 1:1 (156 and 172 individuals), and the WW genotype individuals accounted for a very small number (8 individuals). The results show that this insertion tends to be preserved during evolution and selection. On the contrary, individuals that completely lose the sequence are rare.

[0083] For boars, sows and the total population, 2 The results of the suitability test showed that none of the sites reached the Hardy-Weinberg equilibrium level (P<0.05), and the deviation from the Hardy-Weinberg equilibrium law is shown in Table 3. The results of the independence test showed that the genotype frequency distribution was not significantly different between pigs of different sexes (P=0.73>0.05). The genotype frequency and gene frequency after the insertion of the gene fragment are shown in Table 3. Figure 7 .

[0084] Table 3 Genotype frequency and gene frequency of inserted fragment genes

[0085]

[0086] 6. Association analysis of Beijing black pork meat traits corresponding to the three genotypes of the insertion sequence

[0087] The test results of Beijing Black Pork meat quality indicators are shown in Table 4. The meat is shiny, non-sticky, elastic, and red. The pH is between 5.7 and 6.3, which is good. According to the measurement of L*, a*, and b* values, the L value and a value are normal, the b value is excellent, and the overall meat color is excellent.

[0088] Table 4 Phenotypic statistics of meat quality traits

[0089]

[0090] The meat quality trait records of the three genotypes of Beijing Black Pork were sorted out. The quartile method was first used to remove abnormal data outside the range of LQ±1.5IQR, and then descriptive statistics were performed on the meat quality traits. The following fixed model was used to perform association analysis between gene effects and meat quality traits using GLM in SPSS statistical software:

[0091] Yi=μ+ai+eij

[0092] Among them, Y i is the observed value of meat quality traits, μ is the population mean of meat quality traits, a i is the genotype effect, e ij is the random residual effect. The results are shown in Table 5.

[0093] Table 5 Association analysis between gene effects and meat quality traits

[0094]

[0095] After testing, the data conformed to normal distribution and had homogeneous variance. The results in Table 5 showed that genotype had significant effects on intramuscular fat and meat color b value of pigs (P<0.05), but had no significant effects on other meat quality indicators.

[0096] The intramuscular fat content of homozygous non-insertion (WW) was 3.94%, that of homozygous insertion (AA) was 2.99%, and that of heterozygous (AW) was 2.75%. From the Bonferroni multiple comparison analysis of the litter size of pigs with different genotypes, the intramuscular fat content between WW and AA was significantly different (P<0.01), the intramuscular fat content between WW and AW was significantly different (P<0.05), and the intramuscular fat content between AA and AW was not significantly different (P>0.05). The intramuscular fat content of WW genotype individuals was significantly higher than that of AA and AW genotype individuals, deviating from the ideal intramuscular fat range of 2-3%.

[0097] The meat color b value of homozygous no insertion (WW) was missing, the meat color b value of homozygous insertion (AA) was 6.19, and the meat color b value of heterozygous (AW) was 5.56, with significant difference (P<0.05). The meat color b value of AA genotype individuals was significantly higher than that of AW genotype individuals.

[0098] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker associated with intramuscular fat content and meat color traits of pigs, characterized in that: The molecular marker is an insertion fragment at the 85th and 86th bases of the sequence shown in SEQ ID NO.5, and the nucleotide sequence of the insertion fragment is shown in SEQ ID NO.7; the genotypes at the site where the insertion fragment is located include a homozygous genotype WW without insertion, a heterozygous genotype AW containing an insertion fragment, and a homozygous genotype AA containing an insertion fragment.

2. A primer combination for detecting the molecular marker according to claim 1, characterized in that: It includes an upstream primer LF whose nucleotide sequence is shown in SEQ ID NO.1, a downstream primer LR whose nucleotide sequence is shown in SEQ ID NO.2, an upstream primer SF whose nucleotide sequence is shown in SEQ ID NO.3 and an upstream primer SF whose nucleotide sequence is shown in SEQ ID NO.

4.

3. A kit for identifying pig intramuscular fat content and meat color traits, characterized in that: Comprising the primer combination described in claim 2.

4. Use of the primer combination described in claim 2 or the kit described in claim 3 in identifying the intramuscular fat content and meat color traits of pigs.

5. The use according to claim 4, characterized in that: The meat color trait is the meat color b value.

6. The use according to claim 4, characterized in that: The pig is Beijing black pig.

7. A method for identifying pig intramuscular fat content and meat color traits, characterized in that: The following steps are involved: Using the pig sample DNA to be tested as a template, and using the primer combination of claim 2 to perform PCR amplification on the template to obtain an amplified product; The amplified product is subjected to gel electrophoresis. If the electrophoresis result shows that it contains only a 134 bp band, the genotype of the pig sample to be tested is WW; If the electrophoresis result shows that only bands of 2413 bp and 755 bp are contained, the genotype of the pig sample to be tested is AA; If the electrophoresis result shows that the bands of 2413 bp, 755 bp and 134 bp are contained at the same time, the genotype of the pig sample to be tested is AW; The intramuscular fat content of WW genotype was significantly higher than that of AA and AW genotypes; The meat color trait of AA genotype was significantly higher than that of AW genotype; The meat color trait is the meat color b value.

8. The method according to claim 7, characterized in that The reaction system of the PCR amplification is: 12.5 μL of 2×Taq PCR Master Mix, 1 μL of each of the upstream and downstream primers of 10 μmol / L, 9.5 μL of ddH2O, and 1 μL of DNA template.

9. The method according to claim 7, characterized in that: The reaction procedure of the PCR amplification is: 94.0°C for 5 min; 94.0°C for 30 sec, 59°C for 30 sec, 72.0°C for 2 min 30 sec, 31 cycles; 72.0°C for 5 min; and storage at 4°C.

10. The method according to claim 7, characterized in that The pig is Beijing black pig.

Images