Application of lactylated CPT1A in preparation of medicine or preparation for treating thyroid cancer

Abstract

The invention discloses application of lactylated CPT1A in preparation of drugs or preparations for treating thyroid cancer, and belongs to the technical field of biomolecular medicine and molecular biology. The molecular mechanism that lactic acid regulates and controls fatty acid oxidation reprogramming through CPT1A lactic acid modification and the important function of lactic acid in PTC generation and development are found, the modification target spot (K180 / K285) of CPT1A surface lactic acid modification is found, and the discovery of the target spot can provide a research basis for follow-up research of tumor specific targeting drugs. According to the invention, a lactic acid and fatty acid synergistically mediated PTC lipid metabolism reprogramming mechanism is analyzed from the perspective of non-histone lactic acid modification. The implementation of the invention not only contributes to clarification of PTC pathogenesis, but also can provide a new target for intervention of PTC metabolic reprogramming and realization of early diagnosis and treatment, and has important theoretical significance and potential application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomolecular medicine and molecular biology, and specifically relates to the application of lactated CPT1A in the preparation of medicines or preparations for treating thyroid cancer. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] The incidence of thyroid cancer has increased rapidly in recent years. Papillary thyroid carcinoma (PTC) is the most common subtype, accounting for about 80-90%. It is prone to lymph node metastasis in the early stage, and some cases are highly invasive. In the late stage, distant metastasis may occur, and the prognosis is poor. As a malignant tumor with a high incidence and a large patient population, in-depth research on its pathogenesis is of great significance.

[0004] Lipid metabolism reprogramming plays an important role in the process of cell carcinogenesis. Metabolites in PTC show a synergistic change trend: the levels of multiple saturated and unsaturated fatty acids are significantly reduced, accompanied by a significant increase in lactic acid levels, which strongly suggests that there may be a regulatory mechanism between fatty acid and lactic acid metabolism in PTC, but related research has not yet been reported.

[0005] Lactate, as an important metabolite of the tumor microenvironment, participates in various tumor processes. Its mechanism of action is complex. In addition to regulating metabolic pathways, lactate exerts its metabolic regulatory function through post-translational lactylation modification of proteins. The latest studies have shown that non-histone lactylation modification in liver cancer is involved in regulating fatty acid oxidation, but the role and regulatory mechanism of lactylation modification in PTC have not been reported so far. Summary of the invention

[0006] In order to solve the deficiencies of the prior art, the object of the present invention is to provide the use of lactated CPT1A in the preparation of a drug or preparation for treating thyroid cancer.

[0007] The present invention found that mitochondrial fatty acid β-oxidation was abnormally active in PTC tissues, and its key rate-limiting enzyme carnitine palmitoyltransferase-1A (CPT1A) was highly expressed and promoted PTC cell migration, strongly suggesting that CPT1A and its mediated fatty acid oxidation reprogramming play an important role in PTC. Combined with the synergistic change trend of metabolites in PTC: the levels of various saturated and unsaturated fatty acids were significantly reduced, accompanied by a significant increase in lactic acid levels, strongly suggesting that there may be a regulatory mechanism between fatty acid and lactic acid metabolism in PTC.

[0008] The present invention found that lactic acid in PTC can affect CPT1A expression, and CPT1A has lactic acid modification, and lactic acid can increase its modification abundance, which strongly suggests that lactic acid may participate in regulating fatty acid oxidation through CPT1A lactic acid modification and thus affect the occurrence and development of PTC. Based on this, a hypothesis is proposed that CPT1A lactic acid modification regulates fatty acid oxidation and may play an important role in the occurrence and development of PTC. Based on the previous research, the present invention uses lipidomics, proteomics, metabolomics, in vitro and in vivo experiments and clinical studies, and comprehensively uses a variety of means to clarify the role of CPT1A-mediated fatty acid oxidation reprogramming in PTC, and clarifies the molecular mechanism of lactic acid regulating fatty acid oxidation reprogramming through CPT1A lactic acid modification and its important role in the occurrence and development of PTC, and finds the modification target (K180 / K285) of CPT1A surface lactic acid modification. The discovery of this target can provide a research basis for subsequent research on tumor-specific targeted drugs. The present invention analyzes the mechanism of lactic acid and fatty acids synergistically mediating PTC lipid metabolism reprogramming from the perspective of non-histone lactic acid modification. The implementation of the present invention not only helps to clarify the pathogenesis of PTC, but also can provide new targets for intervening in the metabolic reprogramming of PTC and achieving early diagnosis and treatment, which has important theoretical significance and potential application value.

[0009] In order to achieve the above object, the technical solution of the present invention is:

[0010] The first aspect of the present invention provides the use of a substance that inhibits CPT1A and its expression products and / or reduces its activity in the preparation of a product for treating thyroid cancer.

[0011] In some embodiments of the present invention, the substances that inhibit CPT1A and its expression products and / or reduce its activity include RNA interference molecules or antisense oligonucleotides, small molecule inhibitors, siRNA, and gene knockout substances targeting CPT1A.

[0012] Preferably, the sequence of the siRNA is shown as SEQ ID NO.1-2.

[0013] The second aspect of the present invention provides the use of at least one of the following (a1) to (a5) in the preparation of a product for treating thyroid cancer:

[0014] (a1) mutant CPT1A protein;

[0015] (a2) a protein in which one or more amino acids are substituted, deleted or added in the amino acid sequence of the mutant CPT1A protein and which has the same or similar function as the mutant CPT1A protein;

[0016] (a3) a nucleic acid molecule encoding the protein described in (a1) or (a2);

[0017] (a4) a nucleic acid molecule in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence of the nucleic acid molecule of (a3) ​​and which can encode a protein with the same or similar function;

[0018] (a5) a substance capable of regulating the level or activity of at least one of (a1) to (a4);

[0019] The mutant CPT1A protein is a CPT1A protein in which the lysine at position 180 is mutated to arginine, or the lysine at position 285 is mutated to arginine.

[0020] In some embodiments of the present invention, the sequence of the nucleic acid molecule encoding the mutant CPT1A protein is shown in SEQ ID NO.4-5.

[0021] The third aspect of the present invention provides the use of a substance that promotes the improvement of mutant CPT1A and its expression product and / or activity in the preparation of a product for treating thyroid cancer;

[0022] The sequence of the mutant CPT1A is shown in SEQ ID NO.4-5.

[0023] A fourth aspect of the present invention provides a use of a recombinant vector in the preparation of a product for treating thyroid cancer, wherein the recombinant vector carries the nucleic acid sequence of the mutant CPT1A shown in SEQ ID NO.4-5.

[0024] In some embodiments of the present invention, the functions of the product for treating thyroid cancer are any one or more of the following:

[0025] b1) Inhibit the proliferation of thyroid cancer cells;

[0026] b2) inhibiting the migration of thyroid cancer cells;

[0027] b3) Eliminate the promoting effect of lactic acid on the proliferation of thyroid cancer cells;

[0028] b4) Eliminate the promoting effect of lactic acid on the migration of thyroid cancer cells;

[0029] b5) inhibit the growth of thyroid cancer;

[0030] b6) Inhibit thyroid cancer metastasis.

[0031] A fifth aspect of the present invention provides a product for treating thyroid cancer, wherein the active ingredient is one of a recombinant vector, a substance that inhibits CPT1A and its expression products and / or activity reduction, a mutant CPT1A protein, a nucleic acid molecule encoding a mutant CPT1A protein, and a substance that promotes mutant CPT1A and its expression products and / or activity improvement;

[0032] The mutant CPT1A protein is a CPT1A protein in which the lysine at position 180 is mutated to arginine, or the lysine at position 285 is mutated to arginine;

[0033] The sequence of the nucleic acid molecule encoding the mutant CPT1A protein is shown in SEQ ID NO.4-5;

[0034] The recombinant vector carries the nucleic acid sequence of mutant CPT1A shown in SEQ ID NO.4-5.

[0035] In some embodiments of the present invention, the substance that inhibits CPT1A and its expression products and / or activity reduction is siRNA, and the sequence of the siRNA is shown in SEQ ID NO.1-2.

[0036] In some embodiments of the present invention, the functions of the product are any one or more of the following:

[0037] b1) Inhibit the proliferation of thyroid cancer cells;

[0038] b2) inhibiting the migration of thyroid cancer cells;

[0039] b3) Eliminate the promoting effect of lactic acid on the proliferation of thyroid cancer cells;

[0040] b4) Eliminate the promoting effect of lactic acid on the migration of thyroid cancer cells;

[0041] b5) inhibit the growth of thyroid cancer;

[0042] b6) Inhibit thyroid cancer metastasis;

[0043] The product described is a drug.

[0044] In some embodiments of the present invention, the product is a drug, and the drug further comprises at least one pharmaceutically inactive ingredient.

[0045] In some embodiments of the present invention, the inactive ingredients of the drug include, but are not limited to, pharmaceutically acceptable carriers, excipients, and diluents. According to common methods, the drug can be made into oral preparations, external preparations, suppositories, and sterile injection solutions in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, sprays, etc.

[0046] The non-drug active ingredients such as the pharmaceutically acceptable carriers, excipients and diluents are well known in the art, and those skilled in the art can determine whether they meet clinical standards.

[0047] Preferably, the carrier, excipient and diluent include but are not limited to lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.

[0048] Preferably, the drug can be administered in vivo in a known manner. For example, it can be delivered to the tissue of interest by intravenous systemic delivery or local injection. Alternatively, it can be administered intravenously, percutaneously, intranasally, by mucosal or other delivery methods. Such administration can be carried out via a single dose or multiple doses. It will be appreciated by those skilled in the art that the actual dose to be administered in the present invention can vary depending on a variety of factors to a great extent, such as target cells, biological types or their tissues, the general condition of the subject to be treated, routes of administration, modes of administration, etc.

[0049] Preferably, the drug administration subjects can be humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, gorillas, etc.

[0050] The beneficial effects of the present invention are:

[0051] The present invention collects tumor samples from clinical thyroid cancer patients and finds that the lactic acid content in PTC cells is increased and lactic acid can promote tumor cell proliferation and migration, and CPT1A is obviously highly expressed in PTC tissues. A knockdown CPT1A PTC cell line was constructed, and it was found that lactic acid promotes the progression of thyroid cancer by enhancing CPT1A. A lactic acid site mutant CPT1A plasmid was constructed and a stable cell line was constructed for in vivo / in vitro experimental verification, and it was found that lactic acid promotes the progression of thyroid cancer by enhancing CPT1A lactic acid modification. Moreover, the lysine at the 180th site and the 285th site of CPT1A were mainly lactated. The present invention clarifies the role of CPT1A-mediated fatty acid oxidation reprogramming in PTC, clarifies the molecular mechanism of lactic acid regulating fatty acid oxidation reprogramming through CPT1A lactic acid modification and its important role in the occurrence and development of PTC, and finds the modification target (K180 / K285) of CPT1A surface lactic acid modification. The discovery of this target can provide a research basis for subsequent research on tumor-specific targeted drugs. The present invention analyzes the mechanism of PTC lipid metabolism reprogramming mediated by lactic acid and fatty acids in collaboration from the perspective of non-histone lactylation modification. The implementation of the present invention not only helps to clarify the pathogenesis of PTC, but also can provide new targets for intervening in PTC metabolic reprogramming and achieving early diagnosis and treatment, which has important theoretical significance and potential application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0053] Figure 1 is the lactic acid content of the PTC tissue and paracancerous tissue in Example 1 of the present invention;

[0054] Figure 2 The proliferation of PTC cells after lactic acid treatment in Example 1 of the present invention;

[0055] Figure 3 The migration of PTC cells after lactic acid treatment in Example 1 of the present invention, A is a crystal violet staining image, and B is a cell number statistical image;

[0056] Figure 4 Statistical graphs of the RNA expression levels of CPT1A in BHP10-3 cells (A) and TPC-1 cells (B) after lactic acid treatment in Example 1 of the present invention;

[0057] Figure 5 The protein expression level of CPT1A in BHP10-3 cells after lactic acid treatment in Example 1 of the present invention;

[0058] Figure 6 The cell proliferation of PTC cells after lactic acid treatment after CPT1A knockdown in Example 1 of the present invention;

[0059] Figure 7 The cell migration of PTC cells after lactic acid treatment after CPT1A knockdown in Example 1 of the present invention, A is a crystal violet staining image, and B is a cell number statistical image;

[0060] Figure 8 The lactic acid modification ability of 293T cells transfected with CPT1A wild-type plasmid and CPT1A lactic acid site mutated plasmid after lactic acid treatment in Example 1 of the present invention;

[0061] Fig. 9 The effect of the CPT1A lactylation site mutation on PTC cell proliferation in Example 1 of the present invention;

[0062] Fig.10 The effect of the CPT1A lactylation site mutation on PTC cell migration in Example 1 of the present invention, A is a crystal violet staining image, and B is a cell number statistical image;

[0063] Fig.11 The subcutaneous tumor formation (A), tumor volume change curve (B) and tumor mass (C) of different groups of mice in Example 1 of the present invention;

[0064] Fig.12These are HE staining images of the lungs of different groups of mice in Example 1 of the present invention. DETAILED DESCRIPTION

[0065] The present invention utilizes lactic acid to treat PTC cells, and analyzes the effect of lactic acid on the proliferation and migration of PTC cells through CCK8 and Transwell experiments.

[0066] The effect of lactate on cell β-oxidation was further detected, and then WB and RT-qPCR experiments were used to clarify the regulatory effect of lactate on CPT1A. A plasmid for knocking down CPT1A was constructed for cell transfection, and the cells after knocking down CPT1A were stimulated with lactate and then CCK8 and Transwell experiments were used to analyze the regulatory effect of lactate on CPT1A, thereby clarifying the effect on PTC cell proliferation and migration.

[0067] In terms of mechanism, the present invention uses IP experiments to detect whether CPT1A is lactic acid modified. Combined with previous research on modification omics, two sites (K180 / K285) on the surface of CPT1A that may be lactic acid modified were found, and the target effectiveness was verified by constructing site mutation plasmids and stable cell lines.

[0068] In addition, by constructing a stable cell line with a mutant CPT1A lactylation modification target and infecting mice, a nude mouse subcutaneous transplant tumor model and a lung metastasis tumor model were constructed to verify the effect of lactylation-modified CPT1A on the progression of PTC in vivo.

[0069] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0070] Example 1

[0071] Part 1: Tumor samples from clinical thyroid cancer patients were collected and it was found that the lactate content in PTC cells was increased and lactate could promote the proliferation and migration of tumor cells.

[0072] 1. Detect the lactic acid content of PTC tissue and adjacent tissue.

[0073] Specific experimental methods:

[0074] ① Use lactic acid kit (Solarbio, BC2230) for detection, which contains extract solution 1, extract solution 2, reagent 1, reagent 2, reagent 3, reagent 4, and reagent 5. Add extract solution 1 according to the ratio of PTC tissue mass (g): extract solution 1 volume (mL) of 1:5-10 (it is recommended to weigh about 0.1g and add 1mL extract solution 1), homogenize in ice bath, centrifuge at 4℃, 12000g for 10min, take 0.8mL supernatant, add 0.15mL extract solution 2, centrifuge at 4℃, 12000g for 10min, and take supernatant for detection.

[0075] ② Preheat the spectrophotometer for more than 30 minutes, adjust the wavelength to 570nm, and set the ethanol to zero.

[0076] ③ Use the standard solution prepared in the kit to draw a standard curve and obtain the standard equation y=kx+b. Substitute the ΔA measurement into the formula to obtain x (μmol / mL).

[0077] ④Reaction system configuration: The reaction system of each sample needs to be configured with a test tube and a blank control tube. Test tube configuration: sample 50μL + reagent 2 50μL + reagent 1 200μL + reagent 4 100μL. Control tube configuration: sample 50μL + distilled water 50μL + reagent 1 200μL + reagent 4 100μL. After the test tube and control tube are configured, react accurately in a 37℃ water bath for 40min. After the reaction, add reagent 5 30μL + reagent 3 300μL, react at 37℃ in the dark for 20min, then centrifuge at 25℃, 10000rpm for 10min, remove the supernatant, and keep the precipitate. Dissolve the precipitate with 1mL of ethanol. After fully dissolving the precipitate, measure the absorbance at 570nm, record them as A test tube and A control tube respectively, and calculate ΔA test = A test tube - A control tube.

[0078] ⑤ Calculation of lactic acid content: LA content (μmol / g mass) = x × (V supernatant + V extract solution 2) ÷ (W × V supernatant ÷ V extract solution 1) = 1.1875 × x ÷ W. W: sample mass, g; V supernatant: volume of supernatant during extraction, 0.8 mL; V extract solution 2: volume of extract solution 2 added, 0.15 mL; V extract solution 1: volume of extract solution 1 added, 1 mL.

[0079] The experimental results are as follows Figure 1 As shown in the figure, the lactic acid content in 20 pairs of PTC tissues and adjacent cancerous tissues was analyzed, and it can be seen that the lactic acid content in PTC tissues was significantly higher than that in adjacent cancerous tissues.

[0080] 2. Treat PTC cells with lactic acid to detect the proliferation ability of PTC cells.

[0081] Specific experimental methods:

[0082] ① Cell plating: Digest BHP10-3 (PTC cell line) from the culture dish, count, and take out 200 μL containing 3×10 3 Cells were seeded in a 96-well plate. 100 μL PBS solution was added to the outermost well of the 96-well plate. Five replicate wells were set up for each group. After 24 hours of culture, the control group was treated with distilled water, and the experimental group was treated with 4 mM lactic acid.

[0083] ② At 24h, 48h, and 72h after treatment, add 10μL of CCK-8 solution (Biyuntian, C0038) to each well at different times, avoiding blowing and producing bubbles. After adding, place the wells in a 37℃ incubator and incubate for 3h.

[0084] ③Measure OD value: Take the 96-well plate out of the incubator, set the wavelength to 450nm, detect the OD value of each well, use GraphPad Prism software to analyze and process the data, and draw a proliferation curve.

[0085] The experimental results are as follows Figure 2 As shown, the proliferation ability of PTC cells gradually increased with the increase of lactic acid treatment concentration.

[0086] 3. Treat PTC cells with lactic acid to detect the migration ability of PTC cells.

[0087] Specific experimental methods:

[0088] ① Cell plating: BHP10-3 cells and TPC-1 cells (PTC cell line) were digested and counted from the culture dish, resuspended in serum-free medium, and 200 μL containing 4×10 3 Cells were inoculated in the upper chamber. Culture medium containing 10% serum was added to the lower chamber. The cells were incubated in an incubator for 24 hours.

[0089] ② Fixation: After 24 hours, take out the chamber, put it into a clean 24-well plate, add 1 mL PBS to wash once, then add 800 μL formaldehyde and fix for 5 minutes.

[0090] ③ Staining: Add 800 μL of crystal violet solution to each well and incubate at room temperature for 5 minutes, then discard the fixative; take out the chamber and place it in clean water, and wipe the serum-free side of the bottom of the chamber with a cotton swab.

[0091] ④Photography and statistics: Take photos under a microscope, take at least 8 different photos for each well, and use ImageJ software to count the stained cells.

[0092] The experimental results are as follows Figure 3 As shown, the number of migrating PTC cells increased significantly after lactate treatment.

[0093] Part II: Constructing a CPT1A knockdown PTC cell line, we found that lactate promoted thyroid cancer progression by enhancing CPT1A.

[0094] 1. RT-qPCR experiments were used to detect changes in the RNA expression level of CPT1A in cells after lactate treatment.

[0095] Specific experimental methods:

[0096] ① Cell plating: BHP10-3 cells and TPC-1 cells were digested from the culture dish with trypsin, counted, and evenly seeded in a 12-well plate. When the cell fusion reached 70%-80%, different concentrations of lactic acid were added (2mM / 4mM / 8mM / 12mM) and the cell status was observed after 24 hours.

[0097] ② Extract RNA: If the cell state has not deteriorated significantly, scrape the cells with a scraper, collect the cells in a 1.5 mL EP tube, centrifuge at 1000 rpm for 3 min, collect the cell precipitate, and extract the cell RNA using an RNA extraction kit (Yishan Biotechnology, RN001).

[0098] ③ Reverse transcription to extract cDNA:

[0099] (1) In the first step, remove genomic DNA and prepare the following system in a 200uL RNA-Free EP tube and centrifuge to mix thoroughly.

[0100] Component name Addition amount <![CDATA[RNase-free ddH2O]]> Up to 16μL 4×g DNA wiper Mix 4μL Template RNA Total RNA: 1 μg

[0101] After centrifugation, put it into the machine. 42℃, 2min. The cDNA obtained by the reaction can be used for PCR / RT-qPCR, or it can be stored at -80℃.

[0102] (2) In the second step of reverse transcription, the system was mixed according to the following proportions and centrifuged to mix thoroughly.

[0103] 5×HiScript IIqRT Super MixⅡ 4μL The first step reaction solution 16μL

[0104] Reaction conditions: 50°C, 15 min; 85°C, 5 s. 4°C, -, the obtained cDNA was used for subsequent experiments or stored at -80°C.

[0105] ④RT-qPCR: (Primers include: β-actin / CPT1A)

[0106] (1) Reaction system preparation: Prepare PCR reaction mixture, including cDNA template, primers, nuclease, nuclease inhibitor, nuclease inhibitor, etc., as well as required fluorescent probe. The specific system is as follows:

[0107] Reagents volume 2×ChamQ Universal SYBR qPCR Master Mix 10μL Primer1 (10 μM) 0.4μL Primer2 (10 μM) 0.4μL Template DNA / cDNA XμL <![CDATA[ddH2O]]> Up to 20μL

[0108] (2) On the machine, the specific reaction temperature is as follows:

[0109]

[0110] The experimental results are as follows Figure 4 As shown, the RNA expression level of CPT1A in PTC cells was significantly increased after lactate treatment, and the increase was dependent on the lactate concentration.

[0111] 2. WB experiment was used to detect the changes in CPT1A protein expression levels in cells after lactate treatment.

[0112] Specific experimental methods:

[0113] ① Cell plating: BHP10-3 cells were digested from the culture dish with trypsin, counted, and evenly seeded in a 6-well plate. When the cell confluence reached 70%-80%, different concentrations of lactic acid were added (4mM / 8mM / 12mM) and the cell status was observed after 24 hours.

[0114] ② Collect samples and extract cell proteins for WB experiment: (primary antibodies include: β-actin / CPT1A)

[0115] (1) Preparation of protein samples: Digest the cells in the culture dish with trypsin, add NP40 protein lysis buffer containing 1% PMSF, place on ice for 30 min, centrifuge at 12000 rpm at 4°C for 10 min, and aspirate the supernatant into a new EP tube.

[0116] (2) Measure protein concentration: Prepare 0, 0.125, 0.25, 0.5, 0.75, 1, and 1.5 mg / mL protein standards, and add 2 μL of the standard protein and the protein to be tested to the bottom of a 96-well plate. Add 200 μL of G250 staining solution, move the 96-well plate left and right to mix, and then measure the OD value at a wavelength of 595 nm. Draw a standard curve based on the protein concentration and OD value of the standard, and then calculate the sample concentration of the protein to be tested based on the standard curve. After adding 5× SDS protein loading buffer, heat it in a 100°C metal bath for 10 minutes to completely denature the protein.

[0117] (3) Electrophoresis: Add the marker and the protein of the same mass from left to right in sequence. After the positive and negative electrodes are connected, turn on the electrophoresis switch and run at 80 V constant voltage for 30 min or 120 V constant voltage for 60 min.

[0118] (4) Transfer: Activate the PVDF membrane with methanol and place it on the sponge. Pry open the glass plate to retain the lower layer of glue. Place the lower layer of glue on the PVDF membrane. Then place the upper sponge on the glue. Use a glass rod to squeeze out the bubbles between the membrane and the glue. Transfer at a constant current of 400 mA for 1 h.

[0119] (5) Blocking: Dilute skim milk powder with 1× TBST membrane washing solution to a concentration of 1%, place the membrane in the blocking solution, and then place it on a low-speed shaker at room temperature for 2 h.

[0120] (6) Washing the membrane: After pouring out the milk, soak the membrane in 1×TBST membrane washing solution and wash the membrane three times on a shaker at room temperature for 5 minutes each time.

[0121] (7) Cutting the membrane: Take the membrane out of TBST, keep at least one upper and lower marker according to the molecular size of the target protein, and put it into the antibody application box.

[0122] (8) Incubation with primary antibody: Place each target band in the primary antibody dilution solution, place on a low-speed shaker, and incubate overnight at 4°C;

[0123] (9) Secondary antibody: Place the target band in TBST washing solution, wash the membrane three times on a shaker at room temperature, then place it in the secondary dilution solution, place it on a low-speed shaker, incubate at room temperature for 1 hour, and wash the membrane three times at room temperature for 5 minutes each time.

[0124] (10) Development and statistics: Mix the same volume of solution A and solution B and apply them evenly on the PDVF film. Try to use the same exposure time for molecules of the same size.

[0125] The experimental results are as follows Figure 5 As shown, the protein expression level of CPT1A in PTC cells was significantly increased after lactate treatment, and the increase was dependent on the lactate concentration.

[0126] 3. CCK-8 experiment detected the changes in the proliferation ability of PTC cells after lactic acid treatment after CPT1A knockdown.

[0127] Specific experimental methods:

[0128] ① Knockdown of CPT1A: Digest BHP10-3 from the culture dish, count, and evenly inoculate in a 12-well plate. When the cell confluence reaches 70%-80%, add 5μL+2μL of the constructed small interfering RNA to each well. Transfection reagent + 250 μL Buffer (Polyolus, 101000046) was added after 6 h and then replaced with normal culture medium and cultured for at least 24 h.

[0129] Wherein, the sequence of the small interfering RNA is as follows:

[0130] F:CCAUGAAGCUCUUAGACAATT(SEQ ID NO.1)

[0131] R:UUGUCUAAGAGCUUCAUGGTT(SEQ ID NO.2)

[0132] ②Cell plating: Digest BHP10-3 from a 12-well plate, count, and take out 200 μL containing 3×10 3 Cells were seeded in a 96-well plate. 100 μL PBS solution was added to the outermost well of the 96-well plate. Five replicate wells were set up for each group. After 24 hours of culture, the control group was treated with distilled water, and the experimental group was treated with 4 mM lactic acid.

[0133] ③ At 24h, 48h, and 72h after treatment, add 10μL of CCK-8 solution (Biyuntian, C0038) to each well at different times, avoiding blowing and producing bubbles. After adding, place in a 37℃ incubator and incubate for 3h.

[0134] ④Measure OD value: Take the 96-well plate out of the incubator, set the wavelength to 45 nm, detect the OD value of each well, use GraphPad Prism software to analyze and process the data, and draw a proliferation curve.

[0135] The experimental results are as follows Figure 6 As shown, the cell proliferation ability of PTC cells was enhanced after lactate treatment, but the enhanced ability disappeared when CPT1A was knocked down.

[0136] 4. Transwell experiment was used to detect the changes in the migration ability of PTC cells after lactic acid treatment after CPT1A knockdown.

[0137] Specific experimental methods:

[0138] ① Knockdown of CPT1A: Digest BHP10-3 from the culture dish, count, and evenly inoculate in a 6-well plate. When the cell confluence reaches 70%-80%, add 5μL+2μL of the constructed small interfering RNA to each well. Transfection reagent + 250 μL Buffer (Polyolus, 101000046), after 6 hours, change to normal culture medium and culture for at least 12 hours, add 4mM lactic acid for 24 hours.

[0139] ②Cell plating: BHP10-3 cells were digested and counted from 6-well plates, resuspended in serum-free medium, and 200 μL containing 4×10 3 Cells were inoculated in the upper chamber. Culture medium containing 10% serum was added to the lower chamber. The cells were incubated in an incubator for 24 hours.

[0140] ③ Fixation: After 24 hours, take out the chamber, put it into a clean 24-well plate, add 1 mL PBS to wash once, then add 800 μL formaldehyde and fix for 5 minutes.

[0141] ④ Staining: Add 800 μL of crystal violet solution to each well and incubate at room temperature for 5 minutes, then discard the fixative; take out the chamber and place it in clean water, and wipe the serum-free side of the bottom of the chamber with a cotton swab.

[0142] ⑤Photography and statistics: Take photos under a microscope, take at least 8 different photos for each well, and use ImageJ software to count the stained cells.

[0143] The experimental results are as follows Figure 7 As shown, the cell migration ability of PTC cells was enhanced after lactate treatment, but the lactate-enhanced ability disappeared when CPT1A was knocked down.

[0144] Part III: Constructing a lactic acid site mutant CPT1A plasmid and constructing a stable transfected cell line for in vivo / in vitro experimental verification, it was found that lactic acid promotes thyroid cancer progression by enhancing CPT1A lactic acid modification. And it mainly lactates lysine 180 and lysine 285 of CPT1A.

[0145] 1. IP experiment detects the surface lactylation modification of CPT1A and its mutants.

[0146] ①Construction of lactic acid modified mutant plasmid: Check the CDS region sequence of CPT1A mRNA, find the bases encoding lysine at position 180 and amino acid at position 285, mutate lysine to arginine, construct primers, and use seamless cloning kit (Biyuntian, D7010M) to link the mutant fragments. Send sequencing to detect whether the construction is successful, and finally use WB and Q-PCR experiments to detect the validity of the site.

[0147] The CDS sequence of CPT1A mRNA before mutation is as follows:

[0148] atggcagaagctcaccaagctgtggcctttcagttcacggtcactccggacgggattgacctgcggctgagccatgaagctcttagacaaatctatctctctgg

[0149] acttcattcctggaaaaagaagttcatcagattcaagaacggcatcatcactggcgtgtacccggcaagcccctccagttggcttatcgtggtggtgggcgtga

[0150] tgacaacgatgtacgccaagatcgacccctcgttaggaataattgcaaaaatcaatcggactctggaaacggccaactgcatgtccagccagacgaagaac

[0151] gtggtcagcggcgtgctgtttggcaccggcctgtgggtggccctcatcgtcaccatgcgctactccctgaaagtgctgctctcctaccacgggtggatgttca

[0152] ctgagcacggcaagatgagtcgtgccaccaagatctggatgggtatggtcaagatcttttcaggccgaaaacccatgttgtacagcttccagacatcgctgcc

[0153] tcgcctgccggtcccggctgtcaaagacactgtgaacaggtatctacagtcggtgaggcctcttatgaaggaagaagacttcaaacggatgacagcacttgc

[0154] tcaagattttgctgtcggtcttggaccaagattacagtggtatttgaagttaaaatcctggtgggctacaaattacgtgagcgactggtgggaggagtacatctac

[0155] ctccgaggacgagggccgctcatggtgaacagcaactattatgccatggatctgctgtatatccttccaactcacattcaggcagcaagagccggcaacgcc

[0156] atccatgccatcctgctttacaggcgcaaactggaccgggaggaaatcaaaccaattcgtcttttgggatccacgattccactctgctccgctcagtgggagcg

[0157] gatgtttaatacttcccggatcccaggagaggagacagacaccatccagcacatgagagacagcaagcacatcgtcgtgtaccatcgaggacgctacttca

[0158] aggtctggctctaccatgatgggcggctgctgaagccccgggagatggagcagcagatgcagaggatcctggacaatacctcggagcctcagcccgggg

[0159] aggccaggctggcagccctcaccgcaggagacagagttccctgggccaggtgtcgtcaggcctattttggacgtgggaaaaataagcagtctcttgatgct

[0160] gtggagaaagcagcgttctttgtgacgttagatgaaactgaagaaggatacagaagtgaagacccggatacgtcaatggacagctacgccaaatctctacta

[0161] cacggccgatgttacgacaggtggtttgacaagtcgttcacgtttgttgtcttcaaaaacgggaagatgggcctcaacgctgaacactcctgggcagatgcgc

[0162] cgatcgtggcccacctttgggagtacgtcatgtccattgacagcctccagctgggctatgcggaggatgggcactgcaaaggcgacatcaatccgaacattc

[0163] cgtaccccaccaggctgcagtgggacatcccgggggaatgtcaagaggttatagagacctccctgaacaccgcaaatcttctggcaaacgacgtggatttc

[0164] cattccttcccattcgtagcctttggtaaaggaatcatcaagaaatgtcgcacgagcccagacgcctttgtgcagctggccctccagctggcgcactacaagg

[0165] acatgggcaagttttgcctcacatacgaggcctccatgacccggctcttccgagaggggaggacggagaccgtgcgctcctgcaccactgagtcatgcgac

[0166] ttcgtgcgggccatggtggacccggcccagacggtggaacagaggctgaagttgttcaagttggcgtctgagaagcatcagcatatgtatcgcctcgccatg

[0167] accggctctgggatcgatcgtcacctcttctgcctttacgtggtgtctaaatatctcgctgtggagtcccctttccttaaggaagttttatctgagccttggagattat

[0168] caacaagccagacccctcagcagcaagtggagctgtttgacttggagaataacccagagtacgtgtccagcggagggggctttggaccggttgctgatgac

[0169] ggctatggtgtgtcgtacatccttgtgggagagaacctcatcaatttccacatttcttccaagttctcttgccctgagacggggattataagtcaaggaccaagttc

[0170] agatacttga(SEQ ID NO.3).

[0171] The CDS region sequence of the mutated CPT1A mRNA is as follows (lysine at position 180 is mutated to arginine):

[0172] atggcagaagctcaccaagctgtggcctttcagttcacggtcactccggacgggattgacctgcggctgagccatgaagctcttagacaaatctatctctctgg

[0173] acttcattcctggaaaaagaagttcatcagattcaagaacggcatcatcactggcgtgtacccggcaagcccctccagttggcttatcgtggtggtgggcgtga

[0174] tgacaacgatgtacgccaagatcgacccctcgttaggaataattgcaaaaatcaatcggactctggaaacggccaactgcatgtccagccagacgaagaac

[0175] gtggtcagcggcgtgctgtttggcaccggcctgtgggtggccctcatcgtcaccatgcgctactccctgaaagtgctgctctcctaccacgggtggatgttca

[0176] ctgagcacggcaagatgagtcgtgccaccaagatctggatgggtatggtcaagatcttttcaggccgaaaacccatgttgtacagcttccagacatcgctgcc

[0177] tcgcctgccggtcccggctgtcagagacactgtgaacaggtatctacagtcggtgaggcctcttatgaaggaagaagacttcaaacggatgacagcacttgc

[0178] tcaagattttgctgtcggtcttggaccaagattacagtggtatttgaagttaaaatcctggtgggctacaaattacgtgagcgactggtgggaggagtacatctac

[0179] ctccgaggacgagggccgctcatggtgaacagcaactattatgccatggatctgctgtatatccttccaactcacattcaggcagcaagagccggcaacgcc

[0180] atccatgccatcctgctttacaggcgcaaactggaccgggaggaaatcaaaccaattcgtcttttgggatccacgattccactctgctccgctcagtgggagcg

[0181] gatgtttaatacttcccggatcccaggagaggagacagacaccatccagcacatgagagacagcaagcacatcgtcgtgtaccatcgaggacgctacttca

[0182] aggtctggctctaccatgatgggcggctgctgaagccccgggagatggagcagcagatgcagaggatcctggacaatacctcggagcctcagcccgggg

[0183] aggccaggctggcagccctcaccgcaggagacagagttccctgggccaggtgtcgtcaggcctattttggacgtgggaaaaataagcagtctcttgatgct

[0184] gtggagaaagcagcgttctttgtgacgttagatgaaactgaagaaggatacagaagtgaagacccggatacgtcaatggacagctacgccaaatctctacta

[0185] cacggccgatgttacgacaggtggtttgacaagtcgttcacgtttgttgtcttcaaaaacgggaagatgggcctcaacgctgaacactcctgggcagatgcgc

[0186] cgatcgtggcccacctttgggagtacgtcatgtccattgacagcctccagctgggctatgcggaggatgggcactgcaaaggcgacatcaatccgaacattc

[0187] cgtaccccaccaggctgcagtgggacatcccgggggaatgtcaagaggttatagagacctccctgaacaccgcaaatcttctggcaaacgacgtggatttc

[0188] cattccttcccattcgtagcctttggtaaaggaatcatcaagaaatgtcgcacgagcccagacgcctttgtgcagctggccctccagctggcgcactacaagg

[0189] acatgggcaagttttgcctcacatacgaggcctccatgacccggctcttccgagaggggaggacggagaccgtgcgctcctgcaccactgagtcatgcgac

[0190] ttcgtgcgggccatggtggacccggcccagacggtggaacagaggctgaagttgttcaagttggcgtctgagaagcatcagcatatgtatcgcctcgccatg

[0191] accggctctgggatcgatcgtcacctcttctgcctttacgtggtgtctaaatatctcgctgtggagtcccctttccttaaggaagttttatctgagccttggagattat

[0192] caacaagccagacccctcagcagcaagtggagctgtttgacttggagaataacccagagtacgtgtccagcggagggggctttggaccggttgctgatgac

[0193] ggctatggtgtgtcgtacatccttgtgggagagaacctcatcaatttccacatttcttccaagttctcttgccctgagacggggattataagtcaaggaccaagttcagatacttga(SEQ ID NO.4)。

[0194] The CDS region sequence of the mutated CPT1A mRNA is as follows (lysine at position 285 is mutated to arginine):

[0195] atggcagaagctcaccaagctgtggcctttcagttcacggtcactccggacgggattgacctgcggctgagccatgaagctcttagacaaatctatctctctgg

[0196] acttcattcctggaaaaagaagttcatcagattcaagaacggcatcatcactggcgtgtacccggcaagcccctccagttggcttatcgtggtggtgggcgtga

[0197] tgacaacgatgtacgccaagatcgacccctcgttaggaataattgcaaaaatcaatcggactctggaaacggccaactgcatgtccagccagacgaagaac

[0198] gtggtcagcggcgtgctgtttggcaccggcctgtgggtggccctcatcgtcaccatgcgctactccctgaaagtgctgctctcctaccacgggtggatgttca

[0199] ctgagcacggcaagatgagtcgtgccaccaagatctggatgggtatggtcaagatcttttcaggccgaaaacccatgttgtacagcttccagacatcgctgcc

[0200] tcgcctgccggtcccggctgtcaaagacactgtgaacaggtatctacagtcggtgaggcctcttatgaaggaagaagacttcaaacggatgacagcacttgc

[0201] tcaagattttgctgtcggtcttggaccaagattacagtggtatttgaagttaaaatcctggtgggctacaaattacgtgagcgactggtgggaggagtacatctac

[0202] ctccgaggacgagggccgctcatggtgaacagcaactattatgccatggatctgctgtatatccttccaactcacattcaggcagcaagagccggcaacgcc

[0203] atccatgccatcctgctttacaggcgcagactggaccgggaggaaatcaaaccaattcgtcttttgggatccacgattccactctgctccgctcagtgggagc

[0204] ggatgtttaatacttcccggatcccaggagaggagacagacaccatccagcacatgagagacagcaagcacatcgtcgtgtaccatcgaggacgctacttc

[0205] aaggtctggctctaccatgatgggcggctgctgaagccccgggagatggagcagcagatgcagaggatcctggacaatacctcggagcctcagcccggg

[0206] gaggccaggctggcagccctcaccgcaggagacagagttccctgggccaggtgtcgtcaggcctattttggacgtgggaaaaataagcagtctcttgatgc

[0207] tgtggagaaagcagcgttctttgtgacgttagatgaaactgaagaaggatacagaagtgaagacccggatacgtcaatggacagctacgccaaatctctacta

[0208] cacggccgatgttacgacaggtggtttgacaagtcgttcacgtttgttgtcttcaaaaacgggaagatgggcctcaacgctgaacactcctgggcagatgcgc

[0209] cgatcgtggcccacctttgggagtacgtcatgtccattgacagcctccagctgggctatgcggaggatgggcactgcaaaggcgacatcaatccgaacattc

[0210] cgtaccccaccaggctgcagtgggacatcccgggggaatgtcaagaggttatagagacctccctgaacaccgcaaatcttctggcaaacgacgtggatttc

[0211] cattccttcccattcgtagcctttggtaaaggaatcatcaagaaatgtcgcacgagcccagacgcctttgtgcagctggccctccagctggcgcactacaagg

[0212] acatgggcaagttttgcctcacatacgaggcctccatgacccggctcttccgagaggggaggacggagaccgtgcgctcctgcaccactgagtcatgcgac

[0213] ttcgtgcgggccatggtggacccggcccagacggtggaacagaggctgaagttgttcaagttggcgtctgagaagcatcagcatatgtatcgcctcgccatg

[0214] accggctctggggatcgatcgtcacctcttctgcctttacgtggtgtctaaatatctcgctgtggagtcccctttccttaaggaagttttatctgagccttggagattat

[0215] caacaagccagacccctcagcagcaagtggagctgtttgacttggagaataacccagagtacgtgtccagcggagggggctttggaccggttgctgatgac

[0216] ggctatggtgtgtcgtacatccttgtgggagagaacctcatcaatttccacatttcttccaagttctcttgccctgagacggggattataagtcaaggaccaagttcagatacttga (SEQ ID NO. 5).

[0217] ② Transfection of mutant plasmids: CPT1A wild-type plasmid and CPT1A site mutant plasmid were transfected into two 6 cm dishes of 293T cells respectively, and the culture medium was changed to normal medium after 6 hours. After 12 hours, 8 mM lactic acid was added to one 6 cm dish of each group for 24 hours.

[0218] ③ Collect cells: remove the culture medium from the culture dish, wash once with 1 mL of PBS, add 1 mL of BC100 lysis buffer, scrape the cells on ice with a cell scraper, and collect them in an EP tube.

[0219] ④ Lyse cells and collect proteins: Place the EP tube on ice for 30 minutes, blow and shake every 10 minutes to promote complete cell lysis. Centrifuge at 4°C and 12,000 rpm for 10 minutes, collect the supernatant, and measure the protein concentration.

[0220] ⑤Beads incubation: Take 1 mg protein from each group into a new EP tube, add BC100 lysis buffer, and fill each tube to 1 mL. The remaining sample is used as input. Add 25 μL of magnetic beads for every 1 mg of protein. The amount of protein determines the amount of beads used, with a minimum of 15 μL and a maximum of 50 μL. After turning upside down several times, place on a roller shaker and incubate at 4°C for 24 hours.

[0221] ⑥ Wash beads: Take out the EP tube, place it on the magnetic stand, keep the magnetic beads, and discard the supernatant. Add 1mL BC100 lysis buffer to the beads, mix gently, place on a roller shaker, and wash 3 times at 4℃, 10 minutes each time.

[0222] ⑦ Antigen elution denaturation elution method: discard the supernatant, retain the magnetic beads, add 100μL 2×Laemmlibuffer (add mercaptoethanol before use, 2%) to the magnetic beads, place in a 100℃ metal bath for 10min, place on a magnetic rack, separate the magnetic beads, and collect the supernatant.

[0223] ⑧WB detection: Input and IP samples were subjected to WB detection. The primary antibody used was Flag / Kla-lactated pan-antibody / β-actin.

[0224] The experimental results are as follows Figure 8 As shown, the lactic acid modification ability of 293T cells transfected with CPT1A wild-type plasmid was enhanced after lactate treatment, but the lactic acid modification disappeared when the CPT1A lactylation site was mutated.

[0225] 2. CCK-8 experiment was used to detect the changes in the proliferation ability of PTC cells after mutation of the CPT1A lactylation site.

[0226] Specific experimental methods:

[0227] ① Transfection of mutant plasmids: CPT1A wild-type plasmid and CPT1A site mutant plasmid were transfected into 12-well plates containing BHP10-3 cells, and the culture medium was replaced with normal medium after 6 hours. The transfection was performed for at least 24 hours.

[0228] ②Cell plating: Digest BHP10-3 from a 12-well plate, count, and take out 200 μL containing 3×10 3 Cells were seeded in a 96-well plate. 100 μL of PBS solution was added to the outermost wells of the 96-well plate. Five replicate wells were set up for each group.

[0229] ③ At 24h, 48h, and 72h after treatment, add 10μL of CCK-8 solution (Biyuntian, C0038) to each well at different times, avoiding blowing and producing bubbles. After adding, place in a 37℃ incubator and incubate for 3h.

[0230] ④Measure OD value: Take the 96-well plate out of the incubator, set the wavelength to 450nm, detect the OD value of each well, use GraphPad Prism software to analyze and process the data, and draw a proliferation curve.

[0231] The experimental results are as follows Fig. 9 As shown, wild-type CPT1A enhances the cell proliferation ability of PTC cells, but this enhancement ability disappears when the CPT1A lactylation site is mutated.

[0232] 3. Transwell experiment was used to detect the changes in PTC cell migration ability after CPT1A lactylation site mutation.

[0233] Specific experimental methods:

[0234] ① Transfection of mutant plasmids: CPT1A wild-type plasmid and CPT1A site mutant plasmid were transfected into 6-well plates containing BHP10-3 cells, and the culture medium was replaced with normal medium after 6 hours. The transfection was performed for at least 24 hours.

[0235] ②Cell plating: BHP10-3 cells were digested and counted from 6-well plates, resuspended in serum-free medium, and 200 μL containing 4×10 3 Cells were inoculated in the upper chamber. Culture medium containing 10% serum was added to the lower chamber. The cells were incubated in an incubator for 24 hours.

[0236] ③ Fixation: After 24 hours, take out the chamber, put it into a clean 24-well plate, add 1 mL PBS to wash once, then add 800 μL formaldehyde and fix for 5 minutes.

[0237] ④ Staining: Add 800 μL of crystal violet solution to each well and incubate at room temperature for 5 minutes, then discard the fixative; take out the chamber and place it in clean water, and wipe the serum-free side of the bottom of the chamber with a cotton swab.

[0238] ⑤Photography and statistics: Take photos under a microscope, take at least 8 different photos for each well, and use ImageJ software to count the stained cells.

[0239] The experimental results are as follows Fig.10 As shown, wild-type CPT1A enhanced the cell migration ability of PTC cells, but the enhancement ability disappeared when the CPT1A lactylation site was mutated.

[0240] 4. Mouse subcutaneous tumor model.

[0241] Specific experimental methods:

[0242] ①Construction of stable cell lines: The CPT1A wild-type plasmid and the CPT1A site mutant plasmid were separately coated with viruses to construct stable viruses, and the viruses were added to cells according to the cell MOI value and virus titer to construct stable cells, and the stable cells were selected using antibiotics, and finally the cell fluorescence was observed under a microscope.

[0243] ② Animal grouping: 20 BALB / c male mice were placed in the SP environment and adapted for one week. The mice were randomly divided into four groups: (1) Vector group; (2) CPT1A-WT group; (3) CPT1A-K180R group; (4) PCPT1A-K285R group, with 5 mice in each group.

[0244] ③Disinfect the mouse groin and back skin, flick the cells and mix them together. 7 BHP10-3 cells stably overexpressing wild-type and mutant CPT1A or control BHP10-3 cells were injected subcutaneously into the back of mice and sterilized again after each injection.

[0245] ④ The longest diameter (L) and shortest diameter (W) of the tumor were measured with a vernier caliper every 7 days, and the tumor volume was calculated according to the elliptical volume formula (V = L × W2 / 2), and the growth curve was drawn.

[0246] ⑤ After 28 days, the mice were killed, and the subcutaneous transplanted tumors were removed and weighed, and part of them was used to prepare immunohistochemical sections.

[0247] The experimental results are as follows Fig.11 As shown, wild-type CPT1A promotes the proliferation of subcutaneous tumors in mice, but the ability to enhance tumor proliferation is lost when the CPT1A lactylation site is mutated.

[0248] 5. Mouse lung metastasis tumor model.

[0249] Specific experimental methods:

[0250] ①Construction of stable cell lines: The CPT1A wild-type plasmid and the CPT1A site mutant plasmid were separately coated with viruses to construct stable viruses, and the viruses were added to cells according to the cell MOI value and virus titer to construct stable cells, and the stable cells were selected using antibiotics, and finally the cell fluorescence was observed under a microscope.

[0251] ② Animal grouping: 32 BALB / c male mice were placed in the SP environment and adapted for one week. The mice were randomly divided into four groups: (1) Vector group; (2) CPT1A-WT group; (3) CPT1A-K180R group; (4) PCPT1A-K285R group. Each group had 8 mice.

[0252] ③ Disinfect the terminal vein of the mouse tail, flick the cells to mix well, and then add 100 μL of 2×106 The cells were injected into the mice via the tail vein, and the skin was disinfected again after each injection.

[0253] ④ One week later, the tail vein was injected again with the same number of cells.

[0254] ⑤After 2 months, the mice were killed, their lungs were removed and fixed in formaldehyde solution.

[0255] ⑥ The mouse lungs were sliced ​​and stained with HE.

[0256] ⑦After taking photos under a microscope, the tumor area was measured using ImagJ. Statistical formula: metastasis rate = lung metastasis area / total lung area × 100%.

[0257] The experimental results are as follows Fig.12 As shown, wild-type CPT1A promotes lung metastasis of mouse tumors, but the ability to enhance tumor metastasis is weakened when the CPT1A lactylation site is mutated.

[0258] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of substances that inhibit CPT1A and its expression products and / or reduce its activity in the preparation of products for treating thyroid cancer.

2. The use according to claim 1, characterized in that The substances that inhibit CPT1A and its expression products and / or activity reduction include RNA interference molecules or antisense oligonucleotides, small molecule inhibitors, siRNA, and gene knockout substances targeting CPT1A; Preferably, the sequence of the siRNA is shown as SEQ ID NO.1-2.

3. Use of at least one of the following (a1) to (a5) in the preparation of a product for treating thyroid cancer: (a1) mutant CPT1A protein; (a2) a protein in which one or more amino acids are substituted, deleted or added in the amino acid sequence of the mutant CPT1A protein and which has the same or similar function as the mutant CPT1A protein; (a3) a nucleic acid molecule encoding the protein described in (a1) or (a2); (a4) a nucleic acid molecule in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence of the nucleic acid molecule of (a3) ​​and which can encode a protein with the same or similar function; (a5) a substance capable of regulating the level or activity of at least one of (a1) to (a4); The mutant CPT1A protein is a CPT1A protein in which the lysine at position 180 is mutated to arginine, or the lysine at position 285 is mutated to arginine.

4. The use according to claim 3, characterized in that The sequence of the nucleic acid molecule encoding the mutant CPT1A protein is shown in SEQ ID NO.4-5.

5. Use of substances that promote mutant CPT1A and its expression products and / or activity enhancement in the preparation of products for the treatment of thyroid cancer; The sequence of the mutant CPT1A is shown in SEQ ID NO.4-5.

6. Use of a recombinant vector in the preparation of a product for treating thyroid cancer, characterized in that: The recombinant vector carries the nucleic acid sequence of mutant CPT1A shown in SEQ ID NO.4-5.

7. The use according to any one of claims 1 to 6, characterized in that: The functions of the product for treating thyroid cancer are any one or more of the following: b1) Inhibit the proliferation of thyroid cancer cells; b2) inhibiting the migration of thyroid cancer cells; b3) Eliminate the promoting effect of lactic acid on the proliferation of thyroid cancer cells; b4) Eliminate the promoting effect of lactic acid on the migration of thyroid cancer cells; b5) inhibit the growth of thyroid cancer; b6) Inhibit thyroid cancer metastasis.

8. A product for treating thyroid cancer, characterized in that: The active ingredient is one of a recombinant vector, a substance that inhibits CPT1A and its expression products and / or reduces its activity, a mutant CPT1A protein, a nucleic acid molecule encoding a mutant CPT1A protein, and a substance that promotes the improvement of mutant CPT1A and its expression products and / or its activity; The mutant CPT1A protein is a CPT1A protein in which the lysine at position 180 is mutated to arginine, or the lysine at position 285 is mutated to arginine; The sequence of the nucleic acid molecule encoding the mutant CPT1A protein is shown in SEQ ID NO.4-5; The recombinant vector carries the nucleic acid sequence of mutant CPT1A shown in SEQ ID NO.4-5.

9. The product according to claim 8, characterized in that The substance that inhibits CPT1A and its expression product and / or activity reduction is siRNA, and the sequence of the siRNA is shown in SEQ ID NO.1-2.

10. The product according to claim 8 or 9, characterized in that The functions of the product are any one or more of the following: b1) Inhibit the proliferation of thyroid cancer cells; b2) inhibiting the migration of thyroid cancer cells; b3) Eliminate the promoting effect of lactic acid on the proliferation of thyroid cancer cells; b4) Eliminate the promoting effect of lactic acid on the migration of thyroid cancer cells; b5) inhibit the growth of thyroid cancer; b6) Inhibit thyroid cancer metastasis; The product described is a drug.

Images