Preparation of obligate parthenogenetic rotifer based on gene editing

Abstract

The application belongs to the technical field of biotechnology, and particularly relates to a cultivation method of obligate parthenogenetic rotifer based on a gene editing technology and application of the obligate parthenogenetic rotifer in preparation of novel water product breeding opening bait. The obligate parthenogenetic rotifer is obtained by combining new rotifer microinjection with screening of rotifer mutant through gene knockout, and the novel obligate parthenogenetic rotifer variety prepared by the application can be used as a novel living bait for water product breeding.

Description

Technical Field

[0001] This application belongs to the field of biotechnology, specifically relating to a method for cultivating obligate parthenogenetic rotifers based on gene editing technology and its application in the preparation of novel aquatic seedling starter feed. Technical Background

[0002] Rotifers are small zooplankton rich in nutrients, serving as a primary live food source for the larvae of aquatic animals such as fish, shrimp, and crabs in aquaculture. Rotifers reproduce in two ways: parthenogenesis and sexual reproduction. Parthenogenetic female rotifers have a high reproductive rate, producing 25-30 offspring within a week. When the population density increases (e.g., 1 rotifer / mL), some female rotifers will reproduce sexually, producing 12-15 offspring, which then sink to the bottom as dormant eggs, developing into female rotifers when environmental conditions are suitable. From the perspective of cultivating live food, sexual reproduction slows down the population growth rate and reduces energy utilization, and should be avoided.

[0003] Meiosis is a crucial process in gamete formation during sexual reproduction, and homologous recombination is a core event in meiosis. The DNA mismatch repair protein MLH3 (MutL homolog 3) plays a key role in the dismantling of double Holliday junctions during prophase I of meiosis. Knocking out the mlh3 gene significantly reduces the frequency of bivalents, disrupting gamete formation and thus inhibiting sexual reproduction, which is beneficial for breeding new obligate parthenogenetic rotifer varieties.

[0004] In rotifers, artificially manipulated gene silencing techniques are still in the exploratory stage. Using transfection reagents, liposomes, or electroporation, exogenous dsRNA or plasmid DNA can be delivered into the rotifer pseudocoelom to achieve a certain degree of gene expression knockdown. However, these techniques cannot penetrate germ cells, and the resulting gene knockdown effect cannot be passed down through generations. If CRISPR reagents could be directly injected into the ovaries of rotifer larvae using microinjection technology, targeted gene editing could be achieved in germ cells, creating stably heritable transgenic lines. However, rotifer larvae are very small, only 1 / 2 to 2 / 3 the size of adults, and their cuticle (i.e., armor) has a certain degree of rigidity. These characteristics make ovarian injection in rotifer larvae extremely difficult, and there is no precedent for this technique in current technology.

[0005] In view of the above, this application is hereby submitted. Summary of the Invention

[0006] To address the aforementioned technical challenges, this application utilizes precise and efficient CRISPR gene editing, combined with specific rotifer microinjection equipment and techniques, to successfully cultivate a new rotifer variety exhibiting obligate parthenogenesis. Specifically, this involves using a specialized rotifer microinjection device (including a rotifer larva-holding pipette, a petri dish with a lateral cut, and an injection needle with an opening of approximately 2–3 μm) to inject Cas9 and mlh3-specific gRNAs into the immature ovaries of larvae. Gene knockout occurs during maternal oogenesis. Individual F1 individuals are selected and cultured to form a clonal population. Subsequently, F2 individuals are selected for high-resolution melting curve analysis and sequencing to identify the genotype of this clonal population. The resulting mlh3 gene loss-of-function mutant is the new obligate parthenogenetic rotifer variety, which can be used as a novel live feed for aquaculture seedlings.

[0007] Specifically, this application proposes the following technical solution:

[0008] This application first provides a method for cultivating obligate parthenogenetic rotifers, comprising the following steps:

[0009] 1) Rotifer culture: Take Brachiopoda folds and place them in a culture medium for several days;

[0010] 2) Obtaining rotifer larvae: Aspirate rotifer culture medium into a cell culture plate, and repeatedly blow and aspirate to detach the eggs attached to the posterior side of the rotifer body from the parent body. The eggs are cultured until the next day to obtain rotifer larvae.

[0011] 3) Microinjection: The larvae are placed in a zooplankton quiescent solution diluted with seawater (such as ProtosloQuieting solution) to slow their movement; then the larvae are transferred to a microinjection device for microinjection.

[0012] 4) Genotyping of offspring: Transfer the injected rotifers to cell culture plates containing culture medium to produce F1 generation. Select individual F1 individuals for culture to form multiple clones. Select individual F2 individuals from the multiple clones, extract genomic DNA for PCR (e.g., high-resolution melting curve analysis) to evaluate the gene knockout population. Then sequence the PCR products to identify the genotype of the clone population.

[0013] 5) Select clones with the genotype of mlh3 gene loss-of-function homozygous mutant (mlh3). - / - High-density culture was conducted to obtain a clonal population that only reproduced parthenogenetically and no male rotifers were observed.

[0014] Furthermore, in step 1), the culture medium is made by adding f / 2 culture medium to seawater that has been filtered through a 0.22 μm filter membrane and has a salinity of 15–17 ppt, and then adding tetrapanax algae to bring the final concentration to 2 x 10⁻⁶. 5 ~6x105 Cells / mL.

[0015] Furthermore, step 1) specifically includes: taking a small amount of Brachiopoda foldis and placing it in the culture medium, and culturing it continuously for several days at 21-23°C with a photoperiod of 12 / 12h until the rotifer density reaches 30-50 rotifers / mL.

[0016] Furthermore, step 2) specifically includes: aspirating 3-5 mL of rotifer culture medium into a multi-well cell culture plate, repeatedly blowing and aspirating with a pipette to detach the eggs adhering to the posterior side of the rotifer body from the parent body; then removing the adult rotifers and culturing the eggs until the next day to obtain rotifer larvae.

[0017] Furthermore, in step 3), the microinjection includes: connecting the microinjection device to a pneumatic microinjector; loading the injection needle with CRISPR reagent; placing the rotifer larva in a petri dish filled with seawater; applying a negative pressure of -3 to -5 hPa to the rotifer larva's gripping tube to adsorb the rotifer's ciliary crown; the injection needle is at a 20 to 30 degree angle to the horizontal plane, penetrating the cornea and piercing the ovary; the injection pressure is 400 to 900 hPa, and the duration is 1 to 2 seconds.

[0018] Furthermore, the microinjection device includes a rotifer larvae-holding pipette, a petri dish with a side cut, and an injection needle with an opening of approximately 2–3 μm. The rotifer larvae-holding pipette is made of glass capillary tube with an outer diameter of no more than 1 mm, and the end opening is flame-polished. It has an outer diameter of 200–250 μm, an inner diameter of 100–150 μm, and is bent at an angle of 13–18 degrees 5–10 mm from the opening. The petri dish has a diameter of 50–60 mm and a side edge cut depth of 2–3 mm to accommodate the pipette. The injection needle is made of quartz capillary tube with an outer diameter of no more than 1 mm, and the needle tip opening diameter is 2–3 μm. The needle tip polishing angle is 20–30°.

[0019] Furthermore, the CRISPR reagent comprises: Cas9 nuclease, mlh3-specific gRNA, tetramethylrhodamine-glucan, and NE buffer. TM r3.1 Reaction buffer.

[0020] Furthermore, the mlh3-specific gRNA sequence is as follows: GCCGAUUCAAUCAGACCGAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO.1).

[0021] This application also provides a novel starter feed for aquatic seedlings, which is prepared by any of the methods described above.

[0022] This application also provides the application of any of the above-described methods in the preparation of novel aquatic seedling starter feed.

[0023] Furthermore, the application includes the steps of any of the foregoing methods.

[0024] The beneficial technical effects of this application are:

[0025] This application uses a specific rotifer microinjection technique combined with gene knockout rotifer mutant screening to obtain a new variety of obligate parthenogenetic rotifers, which can be used as a novel live feed for aquaculture seedlings. Attached Figure Description

[0026] Figure 1 A schematic diagram of a rotifer microinjection device, in which the rotifer holding pipette is 6-7 cm long and placed at a ~15° angle to the horizontal plane, with the end of the pipette in contact with the bottom of the petri dish; the injection needle is 6-7 cm long and placed at a ~20° angle to the horizontal plane, with the needle tip 50-100 μm from the bottom of the petri dish.

[0027] Figure 2 Figure 1 shows the microinjection of rotifers. Figure A shows the rotifer larvae holding pipette connected to the microinjection instrument. Figure B shows the actual microinjection procedure: the holding pipette adsorbs the larval ciliates, and the injection needle punctures the epidermal keratin membrane from the rear at a 20° to 30° angle and enters the ovary.

[0028] Figure 3 High-resolution melting curves of different genotype mlh3 mutants, compared with wild-type WT, mlh3 knockout homozygotes mlh3 - / - The Tm value decreases, mlh3 knockout heterozygote mlh3 + / - It presents two sharp peaks.

[0029] Figure 4 A sequence information diagram of CRISPR-mediated mlh3 gene knockout; in the diagram, the shaded area represents the gRNA target sequence, the underline represents PAM, > represents a base substitution, - represents a deletion, and the number of deleted nucleotides is indicated to the right of the sequence. Detailed Implementation

[0030] The embodiments of this application will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of this application. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased on the market.

[0031] Some terms are defined herein, unless otherwise defined below. All technical and scientific terms used in the specific embodiments of this application are intended to have the same meaning as commonly understood by those skilled in the art. While it is believed that the following terms will be well understood by those skilled in the art, the following definitions are set forth to better explain this application.

[0032] The term "approximately" in this application refers to an accuracy range that, as would be understood by those skilled in the art, still guarantees the technical effects of the discussed features. This term typically indicates a deviation from the indicated value of ±10%, preferably ±5%.

[0033] As used in this application, the terms “comprising,” “including,” “having,” “containing,” or “involving” are inclusive or open-ended and do not exclude other unlisted elements or method steps. The term “consisting of” is considered a preferred embodiment of the term “comprising.” If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists only of those embodiments.

[0034] Furthermore, the terms first, second, third, (a), (b), (c), and similar terms used in the specification and claims are for distinguishing similar elements and are not necessary for the order of description or chronological sequence. It should be understood that such terms are interchangeable in appropriate contexts, and the embodiments described herein can be implemented in a different order than that described or illustrated herein.

[0035] The present application will now be described in conjunction with specific embodiments.

[0036] Example 1: Establishment of gene knockout strategy and gRNA sequence optimization

[0037] Given that the target gene mlh3 plays a crucial role in the dismantling of double Holliday junctions during prophase of meiosis, mlh3 knockout rotifers may suppress sexual reproduction, thus enabling them to exclusively reproduce parthenogenetically. Therefore, the applicant is attempting to establish a CRISPR / Cas9-based mlh3 gene knockout system to achieve the breeding of obligate parthenogenetic rotifers.

[0038] The specific experimental methods, steps, and optimization process are as follows:

[0039] The CRISPR reagent designed in this application includes 600 ng / μl Cas9 nuclease and 300 ng / μl mlh3-specific gRNA (molar ratio of the two is 1:3). To screen for highly efficient gRNAs, the applicant designed three groups of gRNAs, each targeting a different region on the mlh3 gene exon: CCGATTCAATCAGACCGAGT, ATCCGAGGCTCTATGCACAG, and CGACAATGGAAGAGGGATCG. The corresponding sequences for the three gRNAs are as follows:

[0040] gRNA-1:

[0041] GCCGAUUCAAUCAGACCGAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO. 1);

[0042] gRNA-2:

[0043] GAUCCGAGGCUCUAUGCACAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO. 2);

[0044] gRNA-3:

[0045] GCGACAAUGGAAGAGGGAUCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO. 3).

[0046] The proportions of each genotype in the F2 generation were obtained through experimental testing, as shown in the table below:

[0047]

[0048] It can be seen that mlh3 obtained after gRNA-1 gene editing - / - The proportion of homozygous mutants was the highest, significantly better than the gRNA-2 and gRNA-3 groups, and no chimeras were produced, resulting in the highest gene editing efficiency. In summary, this application establishes gRNA-1 as a specific gRNA for mlh3 in subsequent studies.

[0049] Example 2: Preparation of the microinjection device and optimization of the injection procedure

[0050] Rotifer larvae are very small, only 1 / 2 to 2 / 3 the size of adults, and their cuticles (armor) have a certain degree of rigidity. These characteristics make ovarian injection extremely difficult, necessitating the development of effective microinjection methods to successfully deliver CRISPR reagents to immature ovaries.

[0051] I. Preparation of Microinjection Device

[0052] The applicant has designed a specific microinjection device, which includes a rotifer aspiration component, a container component, and an injection component (see [link to device]). Figure 1 and 2 The corresponding preparation method is as follows:

[0053] The applicant used a clamping pipette as the rotifer larva aspiration component. The inner diameter of the opening at the end of the clamping pipette is 100-150 μm, just large enough to accommodate the larval ciliates. A petri dish with a diameter of 50-60 mm was selected as the holding component, with a 2-3 mm incision depth on one side edge to accommodate the clamping pipette. The injection component used a specific injection needle, which was drawn from a 1 mm outer diameter quartz capillary (QF100-70-10, SUTTER INSTRUMENT) using a SUTTER P-2000 needle puller (drawing parameters: heat 800, filament 4, velocity 60, delay 150, pull 175). The needle was ground at a 20-30° angle for 15 seconds on a SUTTER BV-10 needle grinder, resulting in a needle tip opening diameter of 2-3 μm. This injection needle is extremely sharp, capable of piercing the stratum corneum and penetrating the ovary.

[0054] All the parameters above were summarized and obtained by the applicant during the process of exploring rotifer injection experimental conditions. For example, the grinding angle of the injection needle and the size of the needle tip opening are particularly important for the injection success rate, directly determining the effect of ovarian puncture and the degree of damage to the animal. The injection effects of different grinding angles are shown in the table below:

[0055]

[0056] II. Exploration and Optimization of Microinjection Methods

[0057] The applicant has conducted in-depth exploration and optimization research on the operation steps of microinjection into rotifer larvae using the microinjection device prepared above. The specific process is shown in the table below:

[0058]

[0059]

[0060] In comparison, the following methods were used for microinjection of rotifer larvae based on the aforementioned device to achieve the best results: applying a negative pressure of -3 to -5 hPa to the rotifer larvae holding tube to stably hold the rotifers; the injection needle is at a 20 to 30 degree angle to the horizontal plane, penetrating the cornea and entering the ovary; applying a positive pressure of 400 to 900 hPa to the injection needle for 1 to 2 seconds, with an injection volume of 30 to 50 pL, is sufficient to fill the entire ovary.

[0061] Example 3: Cultivation and Evaluation of Obligate Parthenogenetic Rotifers

[0062] This embodiment utilizes the gene knockout system established in Example 1, combined with the microinjection device and method of Example 2, to evaluate the effectiveness and technical advantages of the method system of this application. The specific experimental and evaluation steps are as follows:

[0063] 1) Rotifer culture: A small number of Brachionus manjavacas were placed in 100 mL of culture medium and cultured continuously for several days at 21–23 °C with a photoperiod of 12 / 12 h until the rotifer density reached 30–50 rotifers / mL. The culture medium was prepared by adding f / 2 medium to seawater filtered through a 0.22 μm filter membrane with a salinity of 15–17 ppt, and then adding Tetrapanax papyrifer to bring the final concentration to 2 x 10⁻⁶. 5 ~6x10 5 Cells / mL.

[0064] 2) Obtaining rotifer larvae: Pipette 3-5 mL of rotifer culture medium into a multi-well cell culture plate, and use a pipette to repeatedly blow and aspirate to detach the eggs attached to the posterior side of the rotifer body from the parent body; then remove the adult rotifers and culture the eggs until the next day to obtain rotifer larvae.

[0065] 3) Microinjection: Rotifer larvae were placed in a zooplankton quieting solution (e.g., Protoslo Quieting solution: https: / / www.carolina.com / protist-viewing-supplies / protoslo-quieting-solution-laboratory-grade-15-ml / 885141.pr) diluted 3 times with seawater for 3-5 minutes to slow their movement; then the larvae were transferred to the microinjection device prepared in Example 2, and the CRISPR reagent prepared in Example 1 was microinjected under an inverted microscope (total magnification 100x). Specifically: The microinjection device was connected to a pneumatic microinjector, and 2 μl of CRISPR reagent was loaded onto the injection needle. Rotifer larvae were placed in a petri dish containing seawater, and a negative pressure of -3 hPa was applied to the rotifer larvae's adductor tube to attract the rotifer's ciliary crown. The injection needle was inserted into the ovary through the cuticle at a 20-degree angle to the horizontal plane. The injection pressure was 500 hPa, the duration was 2 seconds, and the injection volume was 50 pL. A total of 26 rotifer larvae were injected using this method.

[0066] 4) Genotyping of offspring: The injected rotifers were transferred to cell culture plates containing culture medium; the next day, 16 rotifers survived (survival rate ~60%), and were cultured individually. Each female rotifer produced 2 offspring per day. The first 6 F1 individuals were selected for culture to form polyclonal populations; from the polyclonal populations, a single F2 individual was selected, and genomic DNA was crudely extracted using the proteinase K method for high-resolution melting curve analysis to evaluate the gene knockout population (see [link to relevant documentation]). Figure 3 Then, the PCR products are sequenced to identify the genotype of the clone population.

[0067] The identified mutations included base substitutions and nucleotide deletions, with the genotype (mlh3) showing deletions of 2bp, 5bp, 7bp, and 10bp in the target region. -2 / -2 mlh3 -5 / -5 mlh3 -7 / -7 mlh3 -10 / -10 ) causes loss of mlh3 gene function; while base substitution or deletion of 3bp and 18bp results in changes or deletions of one to several amino acids in the MLH3 protein, without causing substantial damage to its protein function (see Figure 4 In the F2 clone population, mlh3 - / - It accounts for approximately 64%, mlh3 + / - It accounts for approximately 26%, mlh3 + / + It accounts for approximately 10%.

[0068] 5) Evaluation of new obligate parthenogenetic rotifer varieties: The clonal population with the homozygous mutant mlh3 (genotype mlh3 loss of gene function) was selected. - / -High-density culture was carried out; during the continuous intensive culture process of up to 70 days, the population density reached 800-1000 individuals / mL. These clone populations still only reproduced parthenogenetically and no male rotifers were observed.

[0069] Using the methods described above, this application established four new obligate parthenogenetic rotifer varieties, with genotypes mlh3 and mlh3 respectively. -2 / -2 mlh3 -5 / -5 mlh3 -7 / -7 mlh3 -10 / -10 These gene-edited rotifer varieties, as novel live feed for aquaculture seedlings, can achieve stable and sustainable high-density cultivation, reduce the volume of aquaculture water, improve the energy utilization efficiency of live feed, and reduce seedling costs.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application, and are not intended to limit them. Although this application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of this application.

Claims

1. A method for cultivating obligate parthenogenetic rotifers, characterized in that, Includes the following steps: 1) Rotifer culture: Take Brachiopoda folds and place them in a culture medium for several days; 2) Obtaining rotifer larvae: Aspirate rotifer culture medium into a cell culture plate, and repeatedly blow and aspirate to detach the eggs attached to the posterior side of the rotifer body from the parent body. The eggs are cultured until the next day to obtain rotifer larvae. 3) Microinjection: The larvae are placed in a zooplankton resting solution diluted with seawater; The larvae were then transferred to a microinjection device for microinjection. 4) Genotyping of offspring: The injected rotifers were transferred to cell culture plates containing culture medium to produce F1 generation. Individual F1 individuals were selected and cultured to form multiple clones. Individual F2 individuals were selected from the multiple clones, and genomic DNA was extracted for PCR analysis to evaluate the gene knockout population. The PCR products were then sequenced to identify the genotype of the clone population. 5) Select homozygous mutants with loss of function of the mlh3 gene from the clonal population and culture them at high density to obtain a clonal population that only reproduces parthenogenetically and no male rotifers are observed. In step 3), the microinjection includes: connecting the microinjection device to a pneumatic microinjector; loading the injection needle with CRISPR reagent; placing the rotifer larva in a petri dish filled with seawater; applying a negative pressure of -3 to -5 hPa to the rotifer larva's gripping tube to adsorb the rotifer's ciliary crown; inserting the injection needle at a 20 to 30 degree angle to the horizontal plane, penetrating the cuticle and entering the ovary; the injection pressure is 400 to 900 hPa, and the duration is 1 to 2 seconds. The microinjection device includes a rotifer larvae-holding pipette, a petri dish with a side incision, and an injection needle with an opening of 2–3 μm. The outer diameter of the rotifer larvae-holding pipette is 200–250 μm, the inner diameter is 100–150 μm, and it is bent at an angle of 13–18 degrees 5–10 mm from the opening. The petri dish has a diameter of 50–60 mm and a side edge incision depth of 2–3 mm to accommodate the holding pipette. The needle tip opening diameter is 2–3 μm, and the needle tip grinding angle is 20–30°. The CRISPR reagent includes: Cas9 nuclease, mlh3-specific gRNA, tetramethylrhodamine-glucan, and NEBuffer. TM r3.1 reaction buffer; The mlh3-specific gRNA sequence is as follows: GCCGAUUCAAUCAGACCGAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU.

2. The cultivation method according to claim 1, characterized in that, In step 1), the culture medium is prepared by adding f / 2 culture medium to seawater with a salinity of 15-17 ppt after filtration through a membrane, and then adding tetrapanax algae to bring the final concentration to 2 x 10⁻⁶. 5 ~6x10 5 Cells / mL.

3. The cultivation method according to claim 2, characterized in that, Step 1) specifically includes: taking a small amount of Brachiopoda foldis and placing it in the culture medium, and culturing it continuously for several days at 21-23°C with a photoperiod of 12 / 12 h until the rotifer density reaches 30-50 rotifers / mL.

4. The cultivation method according to claim 1, characterized in that, Step 2) specifically includes: aspirating 3-5 mL of rotifer culture medium into a multi-well cell culture plate, repeatedly blowing and aspirating with a pipette to detach the eggs attached to the posterior side of the rotifer body from the parent body; then removing the adult rotifers and culturing the eggs until the next day to obtain rotifer larvae.

5. The application of the method according to any one of claims 1-4 in the preparation of novel aquatic seedling starter feed.

Images