Adeno-associated virus vector medicine for treating atopic dermatitis

Abstract

The invention relates to a targeted YTHDF1-shRNA (short hairpin Ribonucleic Acid) medicine for treating atopic dermatitis and a pharmaceutical composition containing YTHDF1-shRNA and an adeno-associated virus vector. According to the shRNA medicine, the adeno-associated virus serves as a carrier, the effect of inhibiting YTHDF1 expression is achieved through local intradermal injection, atopic dermatitis symptoms are improved, and the shRNA medicine has wide application prospects in the aspect of clinical treatment of atopic dermatitis.

Description

Technical Field

[0001] The present invention relates to the field of medicines, and in particular to an adeno-associated virus vector medicine for treating atopic dermatitis. Background Art

[0002] Atopic dermatitis (AD) is a chronic, recurrent inflammatory skin disease associated with a genetic allergic constitution and has age-related characteristics. The clinical manifestations of atopic dermatitis include impaired skin barrier, severe itching, polymorphic skin lesions, and exudative tendency. The pathogenesis of atopic dermatitis is complex, involving barrier dysfunction, abnormal activation of the immune system, IgE-mediated allergic reactions, and environmental factors. Atopic dermatitis affects approximately 15%-20% of children worldwide, significantly affecting the quality of life of patients.

[0003] Recent studies have revealed that epigenetics plays a key role in the pathogenesis of AD, involving multiple mechanisms such as DNA methylation, histone modification, and microRNA (miRNA) regulation. Studies have found that genes related to skin barrier function and immune regulation often have abnormal DNA methylation in AD patients. In addition, histone modification affects the regulation of immune genes, promoting the activation of inflammatory cells, while miRNA dysregulation further regulates cytokine expression and worsens disease symptoms. Environmental factors such as pollutants and allergens also affect the onset of AD through epigenetic mechanisms, promoting immune abnormalities and skin barrier damage. Therefore, epigenetics not only provides clues for understanding the complex pathogenesis of AD, but also provides new directions for targeted treatment.

[0004] Adeno-associated virus (AAV) as a gene therapy vector has shown significant application potential in the treatment of skin diseases. The unique low immunogenicity, non-pathogenicity and ability to achieve long-term gene expression make AAV an ideal tool for the treatment of various genetic and inflammatory skin diseases. In the treatment of skin diseases, AAV can correct gene mutations, regulate abnormal immune responses, or restore skin barrier function through gene editing, gene replacement or RNA interference.

[0005] Currently, there are no reports on the use of AAV to treat atopic dermatitis using differentially expressed genes related to epigenetics as targets. Summary of the invention

[0006] To solve the above technical problems, the present invention includes the following aspects:

[0007] A first aspect of the present invention provides a drug for treating atopic dermatitis, wherein the drug is a YTHDF1 inhibitor.

[0008] Preferably, the YTHDF1 inhibitor is shRNA, and the sequence of the shRNA is shown in SEQ ID NO.1.

[0009] Preferably, the sequence of SEQ ID NO.1 is GCACTGACTGGTGTCCTTT.

[0010] The second aspect of the present invention provides an adeno-associated virus vector pharmaceutical composition for treating atopic dermatitis, wherein the pharmaceutical composition comprises the above-mentioned YTHDF1 inhibitor drug and an adeno-associated virus (AAV) as a vector.

[0011] Preferably, the AAV is a serotype 9 vector.

[0012] Preferably, the pharmaceutical composition is a local intradermal injection preparation.

[0013] Preferably, the method for preparing the pharmaceutical composition comprises the following steps:

[0014] (1) Constructing an shRNA expression vector, inserting the fragment encoding the specific shRNA sequence into the plasmid backbone of the AAV vector, and ensuring that both ends of the vector contain the AAV inverted terminal repeat sequence (ITR);

[0015] (2) co-transfecting the shRNA vector constructed in step (1) with the packaging plasmid into HEK293T cells, which provide the necessary components for viral replication and packaging;

[0016] (3) After transfection, the cell culture supernatant was collected and centrifuged to remove cell debris to obtain the supernatant containing AAV virus particles;

[0017] (4) concentrating the supernatant obtained in step (3) by ultracentrifugation to obtain AAV particles containing shRNA;

[0018] (5) AAV viral particles are further purified by ultracentrifugation to remove residual proteins and unpackaged DNA.

[0019] Preferably, the fragment encoding the specific shRNA sequence in step (1) is as shown in SEQ ID NO.1.

[0020] Preferably, the AAV vector in step (1) is a serotype 9 vector.

[0021] Preferably, the packaging plasmid in step (2) is an AAV9 packaging plasmid.

[0022] Preferably, the transfection time in step (3) is 72 hours.

[0023] Preferably, the ultracentrifugation method in step (5) is a cesium sulfate density gradient method.

[0024] Preferably, the preparation method further comprises the following steps:

[0025] (6) The purified AAV virus particles obtained in step (5) are mixed with PBS buffer, adjusted to the desired virus concentration, and stored in aliquots at -80°C for later use.

[0026] Preferably, the titer range of the AAV virus after adjustment in step (6) is 10 12 Up to 10 13 vg / mL.

[0027] The third aspect of the present invention provides a method for preparing the above-mentioned pharmaceutical composition, which comprises the following steps:

[0028] (1) Constructing an shRNA expression vector, inserting the fragment encoding the specific shRNA sequence into the plasmid backbone of the AAV vector, and ensuring that both ends of the vector contain the AAV inverted terminal repeat sequence (ITR);

[0029] (2) co-transfecting the shRNA vector constructed in step (1) with the packaging plasmid into HEK293T cells, which provide the necessary components for viral replication and packaging;

[0030] (3) After transfection, the cell culture supernatant was collected and centrifuged to remove cell debris to obtain the supernatant containing AAV virus particles;

[0031] (4) concentrating the supernatant obtained in step (3) by ultracentrifugation to obtain AAV particles containing shRNA;

[0032] (5) AAV viral particles are further purified by ultracentrifugation to remove residual proteins and unpackaged DNA.

[0033] Preferably, the fragment encoding the specific shRNA sequence in step (1) is as shown in SEQ ID NO.1.

[0034] Preferably, the AAV vector in step (1) is a serotype 9 vector.

[0035] Preferably, the packaging plasmid in step (2) is an AAV9 packaging plasmid.

[0036] Preferably, the transfection time in step (3) is 72 hours.

[0037] Preferably, the ultracentrifugation method in step (5) is a cesium sulfate density gradient method.

[0038] Preferably, the preparation method further comprises the following steps:

[0039] (6) The purified AAV virus particles obtained in step (5) are mixed with PBS buffer, adjusted to the desired virus concentration, and stored in aliquots at -80°C for later use.

[0040] Preferably, the titer range of the AAV virus after adjustment in step (6) is 10 12 Up to 10 13 vg / mL.

[0041] The fourth aspect of the present invention provides use of the above-mentioned medicine or pharmaceutical composition in the preparation of a medicine for treating atopic dermatitis.

[0042] Preferably, the drug or pharmaceutical composition treats atopic dermatitis by downregulating the expression level of YTHDF1.

[0043] A fifth aspect of the present invention provides use of a kit for detecting YTHDF1 in preparing reagents for early screening, early diagnosis, efficacy evaluation and tracking, and prognosis assessment of patients with atopic dermatitis.

[0044] Preferably, the YTHDF1 is upregulated in patients with atopic dermatitis.

[0045] The technical effects produced by the present invention are:

[0046] 1. Based on the bioinformatics mining of transcriptome data, the present invention unexpectedly discovered differentially expressed genes significantly associated with atopic dermatitis, and used a variety of technologies to reveal for the first time the expression of the differentially expressed gene YTHDF1 in atopic dermatitis from the human sample and animal levels, and found that YTHDF1 was upregulated in atopic dermatitis.

[0047] 2. The present invention synthesizes for the first time an adeno-associated virus vector pharmaceutical composition of AAV-YTHDF1, which achieves the effect of inhibiting the expression of YTHDF1 through local injection into the skin, thereby improving the symptoms of atopic dermatitis. The pharmaceutical composition provides a new drug option for the clinical treatment of atopic dermatitis and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The results of the increased expression of YTHDF1 in the skin lesions of AD patients and DNCB-induced AD mice are shown in the figure; Figure 1 A and 1B are HE staining (scale bar = 100 μm) and immunofluorescence staining (scale bar = 50 μm) of skin lesions of AD patients (n = 12) and healthy controls (n = 12); Figure 1C is the real-time reverse transcription PCR detection of YTHDF1 mRNA levels in different groups (n=6) after mice were treated with DNCB or control solvent; Figure 1 D is the immunoblotting detection of YTHDF1 protein levels in different groups (n=6) after mice were treated with DNCB or control solvent. The above results are expressed as mean±SEM, and the meanings of * are as follows: *P<0.05, **P<0.01, and ***P<0.001.

[0049] Figure 2 The effect of local intradermal injection of AAV-YTHDF1 on DNCB-induced AD-like lesions; Figure 2 A is a schematic diagram of the experimental scheme; Figure 2 B and 2C are the gross appearance and histology of skin lesions of mice in each experimental group, respectively (original magnification, x100; scale bar = 100 μm); Figure 2 D and 2E are the AD skin lesion scores and ear thickness of mice in each experimental group, respectively; Figure 2 F and 2G are spleen size and spleen index of YTHDF1 in mice of each test group (n=6). The above results are expressed as mean±SEM, and the meanings of * are as follows: *P<0.05, **P<0.01 and ***P<0.001. DETAILED DESCRIPTION

[0050] Preparation Example 1: Preparation of YTHDF1-shRNA and NC-shRNA adeno-associated viruses

[0051] 1. Synthesis of YTHDF1-shRNA and NC-shRNA

[0052] According to the YTHDF1 gene sequence, shRNA targeting YTHDF1 was designed, and the sequence of the shRNA was GCACTGACTGGTGTCCTTT (SEQ ID NO. 1). The sequence of the negative control NC-shRNA was TTCTCCGAACGTGTCACGT (SEQ ID NO. 2), which should not specifically bind to any known mammalian gene, thereby ensuring its function as a negative control.

[0053] According to the designed shRNA sequence, the sense and antisense oligonucleotides were synthesized respectively. The 21bp oligonucleotide was synthesized by solid phase chemical synthesis, with a TT overhang at the 3' end. The synthesized sense and antisense chains were mixed in a 1:1 molar ratio, dissolved in TE buffer, heated to 95°C, kept for 5 minutes, and then slowly cooled to room temperature to form a double-stranded shRNA. The annealed shRNA fragment was inserted into the adeno-associated virus vector plasmid containing the U6 promoter and cloned using restriction endonuclease sites. The vector should contain the inverted terminal repeat sequence (ITR) of AAV at both ends to ensure subsequent viral packaging. The recombinant plasmid was transformed into Escherichia coli, positive clones were screened by antibiotics, single clones were selected and plasmids were extracted. The correct insertion of shRNA was verified by enzyme digestion and sequencing. High-quality shRNA expression plasmids were extracted using a plasmid extraction kit for subsequent adeno-associated virus packaging.

[0054] 2. Preparation of shRNA-loaded adeno-associated virus

[0055] The constructed shRNA expression plasmid and AAV packaging plasmid were co-transfected into HEK293T cells. HEK293T cells provide adeno-associated virus replication and packaging functions. 72 hours after transfection, the supernatant of HEK293T cell culture was collected, centrifuged to remove cell debris, and supernatant containing virus particles was obtained. The supernatant was concentrated by ultracentrifugation to collect AAV virus particles. The AAV virus particles were further purified by cesium sulfate density gradient ultracentrifugation to remove excess proteins, nucleic acids and unpackaged DNA to obtain high-purity shRNA-loaded AAV viruses. The titer of the purified AAV virus was determined by quantitative PCR and diluted with PBS. Usually the virus titer should be between 10 12 Up to 10 13 vg / mL to ensure the effective dose for experimental or clinical use. The purified AAV virus was dispensed into sterile tubes and stored at -80°C for subsequent use.

[0056] Experimental Example 1: Expression of YTHDF1 in skin lesions of AD patients, DNCB-induced AD skin lesions in mice, and inflammatory cell models

[0057] 1. Test methods

[0058] 1.1. Processing of human skin lesion specimens

[0059] Skin biopsy specimens from 12 AD lesions and 12 healthy volunteers were obtained from the First Affiliated Hospital of Anhui Medical University. AD was diagnosed according to the Hanifin and Rajka criteria. This study was approved by the Ethics Committee of Anhui Medical University and complied with the requirements of the Declaration of Helsinki Principles. All subjects signed informed consent for surgery.

[0060] 1.2. Construction of AD mouse model

[0061] BALB / c mice were provided by the Animal Center of Anhui Medical University. All mice were tested at 8-10 weeks of age and maintained at a light-dark cycle of 22±2℃ for 12 h under specific pathogen-free conditions. Food and water were available ad libitum. All surgeries were performed under isoflurane anesthesia. The DNCB-induced AD mouse model was established for related animal experiments. DNCB (Sigma, USA) was dissolved in a mixture of acetone and olive oil (volume ratio of 3:1). On the first day of the experiment, 20 μL of 2% DNCB solution was used to sensitize the ear skin of the model group mice, once a day, for a total of 1 sensitization. On the 5th, 7th, 9th, 11th, and 13th days of the experiment, 20 μL of 0.5% DNCB solution was applied to the ear skin of the AD model group mice for stimulation, and stimulation was performed once a day at the above time points. The blank group (Ctrl group) mice were coated with the same amount of acetone and olive oil (volume ratio of 3:1) matrix solution on the ear skin as a control.

[0062] 1.3 HE staining and immunofluorescence

[0063] Samples were extracted from the ears of the above-mentioned AD model mice and human tissues of AD skin lesion volunteers, fixed with 10% formalin, and embedded in paraffin. The specimens were then cut into 4 μm thick sections. The tissue sections were dewaxed and HE stained. The sections after antigen repair and serum blocking were incubated with YTHDF1 antibody (Proteintech) at 4°C overnight. The next day, the sections were incubated with secondary antibodies labeled with Alexa Fluor 594. Fluorescence microscope (Leica, Germany) was used for photography.

[0064] 1.4 Real-time reverse transcription PCR

[0065] Total RNA of the AD mouse model was extracted using TRIzol reagent (Invitrogen) according to the instructions of the reagent. Complementary DNA (cDNA) was synthesized using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). PCR primers were synthesized by Shanghai Biotechnology Co., Ltd., and the relevant primer sequences are shown in Table 1 below. cDNA was amplified using SYBR qPCR SuperMix Plus (novoprotetien scientific) and analyzed using Roche LightCycler 480Ⅱ (Roche, Switzerland). The expression level of each gene was normalized using the internal reference gene GAPDH and 2 -ΔΔCtMethods Relative mRNA levels were calculated.

[0066] Table 1 PCR primer sequences

[0067] Serial number Primer Name Sequence 5'-3' 1 Ythdf1(mouse)-F ACAGTTACCCCTCGATGAGTG(SEQ ID NO.3) 2 Ythdf1(mouse)-R GGTAGTGAGATACGGGATGGGA(SEQ ID NO.4) 3 Gapdh(mouse)-F GGTTGTCTCCTGCGACTTCA(SEQ ID NO.5) 4 Gapdh(mouse)-R TGGTCCAGGGTTTCTTACTCC(SEQ ID NO.6)

[0068] 1.5 Immunoblotting

[0069] Total protein from AD model mice and AD skin lesion volunteer tissues was extracted using RIPA buffer. Protein samples were separated by SDS-PAGE and transferred to nitrocellulose membranes, and YTHDF1 and GAPDH antibodies (Proteintech) were incubated at 4°C overnight, and the secondary antibody was incubated at room temperature for 1 hour the next day, and then the signal was visualized using Super ECL Prime (UElandy).

[0070] 2. Test results

[0071] In order to study the potential role of YTHDF1 in atopic dermatitis, this study detected the expression of YTHDF1 in the skin lesions of AD patients. HE staining showed that the spinous layer of AD patients was significantly thickened, and there was infiltration of lymphocytes and eosinophils in the superficial dermis and around blood vessels ( Figure 1 A). Immunofluorescence detection showed that YTHDF1 was strongly expressed in the epidermis of AD patients, mainly distributed throughout the epidermis, but was rarely expressed in normal skin tissue ( Figure 1 B), showing that YTHDF1 expression is upregulated in the epidermis of AD patients compared with healthy subjects.

[0072] In this study, DNCB was used to induce AD-like dermatitis in mice. Real-time reverse transcription PCR and immunoblotting were used to detect the mRNA and protein expression of YTHDF1 in mouse skin. It was found that the expression of YTHDF1 in DNCB-induced AD mouse skin lesions was significantly higher than that in the healthy control group ( Figure 1 C and Figure 1 D). These data suggest that YTHDF1 is involved in the pathogenesis of AD.

[0073] Test Example 2: Inhibitory effect of AAV-YTHDF1 of the present invention on AD-like dermatitis

[0074] 1. Test methods

[0075] 1.1. Trial Grouping and Dosing Regimen

[0076] 24 mice were randomly divided into 4 groups, 6 mice in each group, namely blank control group (Control group), model group (DNCB group), control drug group (DNCB+AAV-Ctrl group) and drug group of the present invention (DNCB+AAV-YTHDF1 group). The drug group of the present invention and the control drug group are respectively the adeno-associated virus loaded with YTHDF1 shRNA and the adeno-associated virus loaded with NC-shRNA prepared in Preparation Example 1. Except for the blank control group and the model group, the mice in each test group were injected with 20 μL of the above-mentioned adeno-associated virus intradermally in both ears on the first day (1d), and 2% DNCB was applied 18 days later (19d). After 4 days (23d), 0.5% DNCB was applied every other day. After 4 applications, the mice were killed on the 31st day, and the test parameters were determined according to the following method. The whole test process lasted 31 days. The model group directly started to apply an equal amount of DNCB on the 19th day, for a total of 6 times, and the mice were killed on the 31st day ( Figure 2 A).

[0077] 1.2. Appearance and histological observation of mouse skin lesions

[0078] The H&E staining method is the same as the corresponding part of 1.4 in Experimental Example 1.

[0079] 1.3. Ear thickness measurement

[0080] The thickness of the middle part of both ears of mice was measured using a vernier caliper (Mitutoyo, Japan), and the average value was taken after three measurements.

[0081] 1.4 AD skin lesion scoring

[0082] The inflammatory conditions of the skin lesions on the ears and backs of the mice in each test group were observed, including erythema (hemorrhage), edema (papules), epidermal exfoliation (scratches), and scaling (dryness), and photographed and recorded. The specific scoring criteria are shown in Table 2.

[0083] Table 2 Scoring table for local skin lesions in mice

[0084]

[0085] 2. Test results

[0086] The test results showed that after local injection of the AAV-YTHDF1 of the present invention, the redness and swelling of the mouse ears were alleviated and the scales were reduced ( Figure 2 B); HE staining showed mild thickening of the epidermis and a decrease in the number of inflammatory cells infiltrating the dermis ( Figure 2 C). In addition, the ear thickness and AD dermatitis scores of mice in the AAV-YTHDF1 treatment group were significantly reduced ( Figure 2 D and Figure 2E); at the same time, compared with AAV-Ctrl, the spleen size and spleen index of the AAV-YTHDF1 group were significantly reduced ( Figure 2 F and Figure 2 G).

[0087] The above test results indicate that the AAV-YTHDF1 adeno-associated virus prepared by the present invention can achieve the effect of inhibiting the expression of YTHDF1 through local injection of the skin, thereby improving the symptoms of atopic dermatitis, and is expected to become a new drug option in the clinical treatment of atopic dermatitis.

[0088] Although specific embodiments of the present invention have been described, it will be appreciated by those skilled in the art that various changes and modifications may be made to the present invention without departing from the scope or spirit of the present invention. Therefore, the present invention is intended to cover all such changes and modifications that fall within the scope of the appended claims and their equivalents.

Claims

1. A drug for treating atopic dermatitis, characterized in that: The drug is a YTHDF1 inhibitor.

2. The drug according to claim 1, characterized in that The YTHDF1 inhibitor is shRNA, and the sequence of the shRNA is shown in SEQ ID NO.

1.

3. An adeno-associated virus vector pharmaceutical composition for treating atopic dermatitis, characterized in that: The pharmaceutical composition comprises the YTHDF1 inhibitor drug according to any one of claims 1 to 2 and an adeno-associated virus (AAV) as a vector.

4. The pharmaceutical composition according to claim 3, characterized in that The AAV is a serotype 9 vector.

5. The pharmaceutical composition according to claim 3, characterized in that The pharmaceutical composition is a local intradermal injection preparation.

6. The method for preparing the pharmaceutical composition according to any one of claims 3 to 5, characterized in that: The following steps are involved: (1) Constructing an shRNA expression vector, inserting the fragment encoding the specific shRNA sequence into the plasmid backbone of the AAV vector, and ensuring that both ends of the vector contain the AAV inverted terminal repeat sequence (ITR); (2) co-transfecting the shRNA vector constructed in step (1) with the packaging plasmid into HEK293T cells, which provide the necessary components for viral replication and packaging; (3) After transfection, the cell culture supernatant was collected and centrifuged to remove cell debris to obtain the supernatant containing AAV virus particles; (4) concentrating the supernatant obtained in step (3) by ultracentrifugation to obtain AAV particles containing shRNA; (5) AAV viral particles are further purified by ultracentrifugation to remove residual proteins and unpackaged DNA.

7. Use of the drug according to any one of claims 1 to 2 or the pharmaceutical composition according to any one of claims 3 to 5 in the preparation of a drug for treating atopic dermatitis.

8. The use according to claim 7, characterized in that: The medicine or pharmaceutical composition treats atopic dermatitis by downregulating the expression level of YTHDF1.

9. Use of a kit for detecting YTHDF1 in the preparation of reagents for early screening, early diagnosis, efficacy evaluation and tracking, and prognosis assessment of patients with atopic dermatitis.

10. The use according to claim 9, characterized in that: The YTHDF1 expression is upregulated in patients with atopic dermatitis.

Images