Bacillus pumilus P2-7 and application thereof in disease prevention and control in prawn culture

Abstract

This invention provides a thermoresistant Bacillus pumilus P2-7 strain and its application in the prevention and control of diseases in shrimp farming, belonging to the field of bioengineering technology. The thermoresistant Bacillus pumilus P2-7 strain provided by this invention was deposited at the Guangdong Provincial Microbial Culture Collection Center on November 4, 2024, with accession number GDMCC NO.65408. This strain differs from traditional antibacterial Bacillus strains in its antagonistic mechanism; it does not secrete metabolites with antibacterial activity, but rather exerts its effects through phage therapy. It can significantly eliminate / inhibit pathogenic bacteria in water and effectively control Shevax disease in shrimp. It also shows good efficacy in simultaneously preventing septicemia, acute hepatopancreatic necrosis, white spot syndrome, and infectious hypodermal and hematopoietic tissue necrosis in shrimp farming.

Description

Thermoresistant Bacillus pumilus P2-7 and its application in disease control in shrimp farming Technical Field

[0001] This invention belongs to the field of bioengineering technology, and in particular relates to a heat-resistant short-spore bacillus, Bacillus pumilus P2-7, and its application in the prevention and control of diseases in shrimp farming. Background Technology

[0002] The presence of potentially pathogenic bacteria in water bodies, such as Pseudomonas aeruginosa, Shewanella algae, Plesiomonas shigelloides, Photobacterium damselae, Acinetobacter venetianus, Enterobacter cloacae, Stenotrophomonas maltophilia, and Providencia rettgeri, has become a significant factor threatening shrimp farming and even human health. For example, *Acinetobacter venetianus* can cause red leg disease in *Penaeus vannamei* (Huang X, et al. *Acinetobacter venetianus*, a potential pathogen of red leg disease in freshwater-cultured whiteleg shrimp *Penaeus vannamei* [J]. *Aquaculture Reports*, 2020, 18: 100543.), and *Providencia rettgeri* can cause red leg disease in *Marsupenaeus japonicus* (Cao H, et al. *Phenotypic and genomic characterization of pathogenic Providencia rettgeri from *Kurumashrimp* *Marsupenaeus japonicus*. *Transboundary and Emerging Diseases*, 2022, 1-11.). Therefore, controlling these pathogens in the water is extremely important for shrimp farming.

[0003] Bacteriophage probiotics are a class of microorganisms with bacteriophage characteristics and are hailed as natural biological control factors for pathogenic bacteria. For example, bacteriophage probiotics such as Bdellovibrio bacteriophage and Vibrio bacteriophage have been proven to have good application effects in the prevention and control of diseases in shrimp farming (Zhang Lvping, et al. Application study of Bdellovibrio bacteriophage in the prevention of Vibrio infection in shrimp [J]. Advances in Fisheries Science, 2009, 30(1):26-33. Zhao Yan. Preparation of Vibrio halophilic Vibrio BL9 bacterial agent and its application in antibiotic-free farming of Litopenaeus vannamei [D]. Huaqiao University, 2021.). However, these bacteriophage probiotics are all Gram-negative bacteria, and there are few reports on bacteriophage probiotics as Gram-positive bacteria and their application in the prevention and control of diseases in shrimp farming. Summary of the Invention

[0004] This invention provides a heat-resistant Bacillus simulans P2-7 and its application in the prevention and control of diseases in shrimp farming. This strain exerts its effects through phage, which can significantly eliminate / inhibit pathogenic bacteria in the water and effectively control shrimp Shevavirus disease. It also has good effects on the simultaneous prevention of septicemia, acute hepatopancreatic necrosis, white spot syndrome, and infectious hypodermal and hematopoietic tissue necrosis in shrimp farming.

[0005] To achieve the above objectives, the present invention provides a heat-resistant Bacillus pumilus P2-7, which was deposited on November 4, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, Guangdong, China, with accession number GDMCC NO.65408.

[0006] The present invention also provides the application of the heat-resistant Bacillus pumilus P2-7 according to the above technical solution in the removal / inhibition of pathogenic bacteria in aquaculture water.

[0007] As a preferred option, heat-resistant Bacillus simulans P2-7 inhibits bacteria through phage.

[0008] Preferably, the pathogenic bacteria are selected from at least one of the following: Pseudomonas aeruginosa FJ1-2, Shewanella algae SFH3, Plesiomonas shigelloides BD1, Photobacterium damselae YJ-1, Acinetobacter venetianus SHF1, Enterobacter cloacae HT2, Stenotrophomonas maltophilia WY1, and Providencia rettgeri S6.

[0009] The present invention also provides an application of the heat-resistant Bacillus pumilus P2-7 according to the above technical solution in the prevention and control of Shevajra disease in shrimp.

[0010] Preferably, the concentration of *Shewanella spp.* SFH3 is 5.0 × 10⁻⁶. 6 Adding 0.8 mg / L of thermostable Bacillus simulans P2-7 powder at CFU / ml can increase the protection rate of shrimp against Shevavirus disease to over 82%.

[0011] The present invention also provides an application of the heat-resistant Bacillus pumilus P2-7 described in the above technical solution in disease control in shrimp farming.

[0012] As a preferred method, in shrimp farming, simultaneously applying 0.4 mg / L of heat-resistant Bacillus simulans P2-7 powder and feeding the shrimp with feed containing 20 g / kg of heat-resistant Bacillus simulans P2-7 powder can prevent the occurrence of septicemia, acute hepatopancreatic necrosis, white spot syndrome, and infectious subcutaneous and hematopoietic tissue necrosis.

[0013] The present invention also provides a livestock feed, characterized in that it contains the heat-resistant Bacillus pumilus P2-7 described in the above technical solution as a feed ingredient.

[0014] Compared with the prior art, the advantages and positive effects of the present invention are as follows:

[0015] 1. This invention isolates and identifies a thermostable, short-spore-forming bacillus P2-7 with broad-spectrum phagocytic activity from shrimp farming sediment. It exhibits good phagocytic effects against pathogenic bacteria such as Pseudomonas aeruginosa FJ1-2, Shewanella algae SFH3, Shigella spp. BD1, Luteobacterium tumefaciens YJ-1, Acinetobacter ventriculae SHF1, Enterobacter cloacae HT2, Stenotrophomonas maltophilia WY1, and Providenella retinoidea S6, and can significantly eliminate / inhibit the aforementioned pathogenic bacteria in water.

[0016] 2. The heat-resistant short-spore bacillus P2-7 provided by this invention has a different antagonistic mechanism than traditional antibacterial bacillus. It cannot secrete metabolites with antibacterial activity, but exerts its effects through phage. It can effectively control Shevavirus disease in shrimp, and also has good effects in preventing septicemia, acute hepatopancreatic necrosis, white spot syndrome, infectious hypodermal and hematopoietic tissue necrosis in shrimp farming. Attached Figure Description

[0017] Figure 1 is a schematic diagram of the colony morphology of thermostable short-spore Bacillus P2-7 provided in an embodiment of the present invention;

[0018] Figure 2 is a schematic diagram of the phagocytic activity of the thermostable Bacillus simulans P2-7 against various pathogenic bacteria provided in the embodiments of the present invention;

[0019] Figure 3 is a schematic diagram of the plaque morphology of thermostable short-spore Bacillus P2-7 provided in an embodiment of the present invention;

[0020] Figure 4 is a schematic diagram of the cell morphology of thermostable short-spore Bacillus P2-7 provided in the embodiment of the present invention;

[0021] Figure 5 is a phylogenetic tree constructed based on the 16S rRNA gene sequence of thermostable Bacillus p2-7 provided in an embodiment of the present invention;

[0022] Figure 6 shows the inhibition rate of the heat-resistant Bacillus simulans P2-7 provided in the embodiments of the present invention against pathogenic bacteria in artificially simulated aquaculture water.

[0023] Figure 7 shows the average mortality rate of *Bacillus subtilis* P2-7 provided in the embodiments of the present invention for the control of Shevavirus disease in Litopenaeus vannamei. Detailed Implementation

[0024] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0025] Example 1: Isolation and screening of thermostable short-lived Bacillus subtilis

[0026] Experimental materials

[0027] Shrimp culture sediment was collected from a shrimp farm in Shandong Province. *Pseudomonas aeruginosa* FJ1-2, *Shewanella algae* SFH3, *Shigella spp.* BD1, *Bacillus melanogaster* YJ-1, *Acinetobacter ventricula* SHF1, *Enterobacter cloacae* HT2, *Stenotrophomonas maltophilia* WY1, and *Providencia retinoi* S6 were provided by the National Aquatic Animal Pathogen Bank of Shanghai Ocean University. Healthy, disease-free whiteleg shrimp with an average weight of 0.08 g, temporarily housed in the laboratory for 14 days, were provided by Changyi Haifeng Aquaculture Co., Ltd.

[0028] Preparation of pathogenic bacteria suspension

[0029] Each pathogenic strain was inoculated into sterile nutrient broth and cultured at 30℃ and 200 r / min on a shaker for 24 h. The cultures were then centrifuged at 4℃ and 8000 r / min for 20 min, washed twice with sterile physiological saline, and the concentration of each pathogenic strain suspension was adjusted to 1.0 × 10⁻⁶ with sterile physiological saline. 10 CFU / mL, store at 4℃ for later use.

[0030] Isolation and screening of thermostable short-lived Bacillus subtilis

[0031] 1.0 g of shrimp culture sediment was weighed and suspended in 9 mL of sterile water. After shaking to mix, the mixture was incubated in a 90℃ water bath for 10 min. Then, the thermostable strain was isolated and purified on nutrient agar medium using the dilution plating method. As shown in Figure 1, a thermostable strain P2-7 with excellent phage activity was isolated and screened, forming white, wrinkled colonies with irregular edges on nutrient agar plates.

[0032] The heat resistance of heat-resistant Bacillus simulans

[0033] The concentration is 1.0 × 10 6 One mL of bacterial suspension of the thermostable strain P2-7 with excellent phage activity (CFU / mL) was inoculated into 49 mL of sterile nutrient broth. The broth was then treated in a water bath at 80℃ for 20 min, 90℃ for 10 min, and 100℃ for 5 min, respectively. Finally, the broth was incubated in a shaker at 30℃ and 200 r / min for 24 h. The growth of the thermostable strain P2-7 with excellent phage activity was then observed.

[0034] After being treated with water baths at 80℃ for 20 min, 90℃ for 10 min, and 100℃ for 5 min, strain P2-7 was cultured in a shaker at 30℃ and 200 r / min for 24 h. The culture broth was turbid in all cases, and the bacteria grew well (as shown in Table 1), indicating that strain P2-7 has good heat resistance.

[0035] Table 1. Growth of strain P2-7 under different heat treatment conditions

[0036]

[0037] Note: + indicates that the culture medium is turbid and the bacteria are growing well.

[0038] Mechanism of action of thermostable spore-forming bacteria

[0039] The isolated thermostable Bacillus simulans P2-7 colonies were resuspended in sterile physiological saline to prepare a concentration of 1.0 × 10⁻⁶. 6 The bacterial suspension was prepared at CFU / mL. The phage activity of the thermostable Bacillus pumilus strain P2-7 against *Pseudomonas aeruginosa* FJ1-2, *Shewanella algae* SFH3, *O. shigella* BD1, *Bacillus melanogaster* YJ-1, *Acinetobacter ventricosa* SHF1, *Enterobacter cloacae* HT2, *Stenotrophomonas maltophilia* WY1, and *Providencia retardans* S6 was determined using the tap water double-layer agar plate method. The antagonistic activity of the thermostable strain P2-7, exhibiting excellent phage activity, against *Pseudomonas aeruginosa* FJ1-2, *Shewanella algae* SFH3, *O. shigella* BD1, *Bacillus melanogaster* YJ-1, *Acinetobacter ventricosa* SHF1, *Enterobacter cloacae* HT2, *Stenotrophomonas maltophilia* WY1, and *Providencia retardans* S6 was analyzed using the disk diffusion method. By observing the formation of plaques and inhibition zones, the mechanism of action of the heat-resistant strain P2-7 with excellent phage activity was determined.

[0040] As shown in Figure 2, the thermostable Bacillus pumilus P2-7 exhibits good phage activity against Pseudomonas aeruginosa FJ1-2, Shewanella algae SFH3, Shigella spp. BD1, Bryophyte spp. YJ-1, Acinetobacter ventricosa SHF1, Enterobacter cloacae HT2, Stenotrophomonas maltophilia WY1, and Providenella retardinis S6. Within 24 hours, it can form round, clear, smooth, and well-defined phage plaques on double-layer agar plates (Figure 3). However, it cannot produce inhibition zones against Pseudomonas aeruginosa FJ1-2, Shewanella algae SFH3, Shigella spp. BD1, Bryophyte spp. YJ-1, Acinetobacter ventricosa SHF1, Enterobacter cloacae HT2, Stenotrophomonas maltophilia WY1, and Providenella retardinis S6. This indicates that strain P2-7 does not inhibit bacteria by producing antibacterial metabolites, but rather through phage.

[0041] Example 2 Identification of thermostable spore-forming bacteria

[0042] Molecular identification

[0043] The heat-resistant strain P2-7 with excellent phage activity was inoculated into 100 mL of sterile nutrient broth and cultured in a shaker at 30℃ and 200 r / min for 24 h. After centrifugation at 4℃ and 12000 r / min for 1 min, the supernatant was discarded. Genomic DNA was then extracted using the Ezup column-based genomic DNA extraction kit (bacteria), and 16S rRNA was amplified by PCR using the genomic DNA as a template.

[0044] The forward primer is 27F: 5' AGAGTTTGATCCTGGCTCAG 3', reverse primer is 1492R: 5' GGTTACCTTGTTACGACTT 3'; The PCR amplification conditions were: 94℃ for 3 min; 94℃ for 1 min, 60℃ for 1 min, 72℃ for 1 min, for a total of 35 cycles. After sequencing the 16S rRNA gene of the thermostable strain P2-7 with excellent phage activity by Shanghai Maipu Biotechnology Co., Ltd., a phylogenetic tree was constructed using the neighbor-joining method with Mega 5.0 software.

[0045] Physiological and biochemical identification

[0046] The morphology of the heat-resistant strain P2-7 with excellent phage activity was observed by Gram staining using a conventional optical microscope. Then, the physiological and biochemical identification of the heat-resistant strain P2-7 with excellent phage activity was carried out with reference to the "Handbook of Systematic Identification of Common Bacteria".

[0047] As shown in Figure 4, *Bacillus pumilus* P2-7 is a short rod-shaped, Gram-positive bacterium. Homology comparison of its 16S rRNA gene sequence with known strains in the GenBank database revealed natural clustering between *Bacillus pumilus* P2-7 and *Bacillus pumilus* strains. A phylogenetic tree of strain P2-7 constructed using the neighbor-joining method (Figure 5) showed that *Bacillus pumilus* P2-7 is most closely related to *Bacillus pumilus* strain ZBG27 (GenBank accession number: OP223406). Furthermore, *Bacillus pumilus* P2-7 is VP-positive, can utilize citrate and propionate, and can grow under anaerobic conditions, but cannot utilize nitrates, liquefy gelatin, hydrolyze starch, or ferment D-xylose, L-arabinose, or D-mannitol, which largely conforms to the physiological and biochemical characteristics of *Bacillus pumilus*. Therefore, strain P2-7 is Bacillus pumilus, which was deposited on November 4, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, Guangdong, China, with accession number GDMCC NO. 65408.

[0048] Example 3: Analysis of the in vitro antibacterial effect of thermostable Bacillus pumilus against pathogenic bacteria in artificially simulated aquaculture water.

[0049] Before the experiment, the heat-resistant strain P2-7, which exhibits excellent phage activity, was inoculated at a 30% inoculum into a solid-state fermentation medium (wheat bran:corn flour:starch:peptone:water = 350:150:1:1:300). After solid-state fermentation at 30℃ for 5 days, the culture was dried and ultra-finely pulverized to obtain a bacterial count of 2×10⁻⁶. 10 CFU / g of bacterial powder. The in vitro antibacterial effect of thermostable Bacillus simulans P2-7 on pathogenic bacteria in artificially simulated aquaculture water was analyzed in a glass Erlenmeyer flask.

[0050] Each of the following pathogenic bacteria was added separately to 200 mL of filtered aquaculture water that had been autoclaved (121°C, 20 min) to achieve a concentration of 5 × 10⁻⁶. The bacteria included Pseudomonas aeruginosa FJ1-2, Shewanella algae SFH3, Shigella sigmatis BD1, Breastbacterium megaterium YJ-1, Acinetobacter ventriculae SHF1, Enterobacter cloacae HT2, Stenotrophomonas maltophilia WY1, and Providencia reticularis S6. 6CFU / mL, then immediately add thermostable Bacillus pumilus P2-7 bacterial powder to a final concentration of 0.4 mg / L. Simultaneously, filter aquaculture water treated with autoclaving (121℃, 20 min) under the same conditions, with only the pathogenic bacteria added, served as a control. Each treatment was repeated in triplicate. After 5 days of shaking at 30℃ and 180 r / min, the concentration (CFU / mL) of each pathogenic bacteria in the aquaculture water was measured. The concentration of pathogenic bacteria was determined using the dilution plating method (TCBS plate method). The inhibition rate was calculated according to formula (1). All data are expressed as mean ± deviation.

[0051] Inhibition rate = {(concentration of pathogenic bacteria in control group - concentration of pathogenic bacteria in treatment group) / concentration of pathogenic bacteria in control group} × 100%…(1)

[0052] As shown in Figure 6, the thermoresistant Bacillus pumilus P2-7 powder exhibits good inhibitory effects on the growth of Pseudomonas aeruginosa FJ1-2, Shewanella algae SFH3, Shigella spp. BD1, Bryophyte auneris YJ-1, Acinetobacter ventricosa SHF1, Enterobacter cloacae HT2, Stenotrophomonas maltophilia WY1, and Providencia retardans S6 in artificially simulated aquaculture water, with inhibition rates reaching 99.81%, 99.98%, 99.02%, 99.59%, 99.67%, 98.71%, 99.64%, and 95.40%, respectively. This indicates that thermoresistant Bacillus pumilus P2-7 can be used for the ecological control of pathogenic bacteria such as Pseudomonas aeruginosa, Shewanella algae, Shigella spp. BD1, Bryophyte auneris YJ-1, Acinetobacter ventricosa SHF1, Enterobacter cloacae, Stenotrophomonas maltophilia, and Providencia retardans in aquatic environments.

[0053] Example 4: Analysis of the control effect of thermoresistant Bacillus pumilus P2-7 on Shevavirus disease in Litopenaeus vannamei.

[0054] The experiment included one negative control group, one positive control group, and two experimental groups, with three parallel aquariums in each group. Each aquarium contained 10 L of culture water and 10 Pacific white shrimp. The experimental group aquariums were supplemented with heat-resistant Bacillus subtilis P2-7 powder at concentrations of 0.4 mg / L and 0.8 mg / L, respectively. The negative control group aquariums received no added substances, while the positive control group aquariums were supplemented with 0.4 mg / L antibacterial Bacillus subtilis (produced by Yurentang Biotechnology (Zhanjiang) Co., Ltd.). The aquariums of the negative control group, positive control group, and experimental groups were supplemented daily with Shewanella algae SFH3 to a final concentration of 5.0 × 10⁻⁶. 6CFU / ml was used for immersion infection for 10 consecutive days. During the experiment, the negative control group, positive control group and experimental group were fed normal feed (purchased from Qingdao Sailing Feed Co., Ltd.) twice a day (8:00 and 15:00). After the experiment, the incidence and mortality of Litopenaeus vannamei were observed, the mortality rate was calculated, and the protection rate was calculated according to formula (2). During the experiment, each aquarium was continuously aerated, and the water temperature was set to 28℃. All data are expressed as mean ± deviation.

[0055] Protection rate = {(mortality rate of negative control group - mortality rate of experimental group) / mortality rate of negative control group} × 100%…(2)

[0056] As shown in Figure 7, both the negative and positive control groups of Litopenaeus vannamei experienced high mortality rates after immersion infection with Shevanella algae, with average mortality rates of 93.33% and 76.67%, respectively. However, the average mortality rates of Litopenaeus vannamei treated with 0.4 mg / L and 0.8 mg / L of thermostable Bacillus pumilus P2-7 powder were significantly reduced, at 33.33% and 16.67%, respectively. Therefore, the protection rates of 0.4 mg / L and 0.8 mg / L of thermostable Bacillus pumilus P2-7 powder against Shevanella algae infection in Litopenaeus vannamei reached 64.29% and 82.14%, respectively. Thus, thermostable Bacillus pumilus P2-7 can be used for the ecological control of Shevanella algae infection in Litopenaeus vannamei.

[0057] Example 5: Analysis of the application effect of thermostable Bacillus pumilus P2-7 in disease control in shrimp farming production

[0058] The experiment included one negative control pool, one positive test pool, and one test pool, each with a cement pool size of 30 m³. 2 20,000 Pacific white shrimp larvae were stocked in each pond. In the negative control pond, the Pacific white shrimp were fed conventional feed (purchased from Qingdao Sailing Feed Co., Ltd.) six times a day at a rate of 3% of their total weight, and disinfected with potassium persulfate every two weeks. In the positive control pond, the Pacific white shrimp were fed feed supplemented with antibacterial Bacillus subtilis (produced by Yurentang Biotechnology (Zhanjiang) Co., Ltd.) at a final dose of 20 g / kg, six times a day at a rate of 3% of their total weight, and were also sprayed with antibacterial Bacillus subtilis (produced by Yurentang Biotechnology (Zhanjiang) Co., Ltd.) at a dose of 0.4 mg / L every 10 days. In the experimental pond, the Pacific white shrimp were fed feed containing 20 g / kg of heat-resistant Bacillus simulans P2-7 bacterial powder, six times a day at a rate of 3% of their total weight, and were also sprayed with heat-resistant strain P2-7 bacterial powder with excellent bacteriostatic activity at a dose of 0.4 mg / L every 10 days. The experiment lasted for 90 days. During the experiment, the disease and mortality of Litopenaeus vannamei shrimp in each pond were observed, and the survival rate was recorded.

[0059] Table 1. Effects of thermostable Bacillus pumilus P2-7 on disease control in shrimp farming.

[0060]

[0061] Note: + indicates the presence of the disease, - indicates the absence of the disease.

[0062] As shown in Table 1, the negative control ponds containing heat-resistant Bacillus pumilus P2-7 powder showed septicemia, acute hepatopancreatic necrosis, white spot syndrome, and infectious hypodermal and hematopoietic necrosis after one month of culture, with a morbidity and mortality rate as high as 100%. The positive control group using antibacterial Bacillus subtilis showed outbreaks of white spot syndrome and infectious hypodermal and hematopoietic necrosis after two months of culture, with a survival rate of only 28% throughout the entire experimental period. The experimental ponds using heat-resistant Bacillus pumilus P2-7 powder showed no septicemia, acute hepatopancreatic necrosis, white spot syndrome, or infectious hypodermal and hematopoietic necrosis throughout the entire culture period, with a survival rate of 96%. This indicates that heat-resistant Bacillus pumilus P2-7 powder can simultaneously prevent the occurrence of septicemia, acute hepatopancreatic necrosis, white spot syndrome, and infectious hypodermal and hematopoietic necrosis in shrimp farming.

Claims

1. A thermostable, short-spore-forming Bacillus pumilus P2-7, characterized in that, It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on November 4, 2024, with accession number GDMCC NO. 65408; the heat-resistant short-spore Bacillus P2-7 showed good growth after being treated in a water bath at 100℃ for 5 min.

2. The application of the thermostable short-spore bacillus P2-7 according to claim 1 in inhibiting pathogenic bacteria in aquaculture water by phage, wherein the pathogenic bacteria are selected from at least one of Shewanella algae SFH3, Plesiomonas shigelloides BD1, Acinetobacter venetianus SHF1, Enterobacter cloacae HT2, Stenotrophomonas maltophilia WY1, and Providencia rettgeri S6.

3. The application of the heat-resistant Bacillus simulans P2-7 as described in claim 1 in the preparation of feed for the prevention and control of Shevanella disease in shrimp, characterized in that, The Shiva disease is caused by the seaweed Shiva SFH3.

4. The application according to claim 3, characterized in that, The concentration of Shewanella SFH3 in the seaweed was 5.0 × 10⁻⁶. 6 Adding 0.8 mg / L of thermostable Bacillus simulans P2-7 powder at CFU / ml can increase the protection rate of shrimp against Shevavirus disease to over 82%.

5. The application of the thermoresistant Bacillus simulans P2-7 as described in claim 1 in the preparation of disease control feed for shrimp farming, characterized in that, In shrimp farming, 0.4 mg / L of heat-resistant Bacillus simulans P2-7 powder is applied simultaneously, and feed containing 20 g / kg of heat-resistant Bacillus simulans P2-7 powder is also provided.

6. Livestock feed, characterized in that, The feed contains the heat-resistant short-spore Bacillus P2-7 as described in claim 1.

Images