Method for cyclic catalytic synthesis of tetrahydrofolic acid based on NADPH cofactor

Abstract

The invention provides a method for improving tetrahydrofolic acid biosynthesis based on NADPH cofactor circulation, and aims to catalyze folic acid into tetrahydrofolic acid through an in-vitro enzyme catalysis technology. According to the invention, escherichia coli BL21 (DE3) is used as a host cell, and dihydrofolate reductase (SmDHFR) derived from serratia marcescens and formate dehydrogenase (pseudoFDH) derived from pseudomonas, which are obtained by screening, are expressed. A TB culture medium is used for fermentation, ultrasonic cell disruption and purification to obtain pure enzyme liquid of SmDHFR and pseFDH. SmDHFR is responsible for converting folic acid into tetrahydrofolic acid, and NADPH consumed in the process is converted into NADP < + >. And the pseudoFDH is used for reducing the generated NADP < + > into NADPH so as to realize the cyclic utilization of the NADPH cofactor. By exploring the optimal ratio of the addition concentrations of the two enzymes, the optimal reaction pH and the optimization of the substrate concentration, the final yield of tetrahydrofolic acid is 3661.14 mu M.

Description

Technical Field

[0001] The invention belongs to the field of biocatalysis, and specifically relates to a method for synthesizing tetrahydrofolate based on NADPH cofactor cycle, which uses bioenzyme catalysis and Escherichia coli protein expression, and adopts FDH-mediated NADPH cofactor cycle coupling DHFR-catalyzed folic acid synthesis method of tetrahydrofolate, and finally realizes the improvement of tetrahydrofolate biosynthesis based on NADPH cofactor cycle. Background Art

[0002] Tetrahydrofolate (THF) is the activated form of folic acid and an important intermediate for the preparation of L-5-methyltetrahydrofolate. Folic acid deficiency is associated with several diseases, such as neural tube defects, megaloblastic anemia, cardiovascular disease and cancer. L-5-methyltetrahydrofolate is the only biologically active form of folic acid in the human body and can be directly absorbed and utilized. If the L-5-MTHF content in the body is reduced and the homocysteine ​​concentration in the blood is increased, it will lead to hyperhomocysteinemia. L-5-MTHF must be taken directly to prevent folic acid deficiency. The synthesis of tetrahydrofolate is a crucial step that affects the entire synthesis process of L-5-MTHF. Therefore, the production and increase of tetrahydrofolate are crucial.

[0003] At present, the synthesis methods of tetrahydrofolate reported in the literature include catalytic hydrogenation, chemical reduction and dihydrofolate reductase method. Among them, the catalytic hydrogenation method requires a large amount of metal catalysts in its catalytic process, which is costly and has a complicated preparation process. The chemical reduction method is the most commonly used method in current industrial production, but the reducing agent is strongly alkaline, and its catalytic process is accompanied by a large number of side reactions, with low yield and low purity. The dihydrofolate reductase method adopts bioenzyme reduction, which has specificity, but requires a large amount of coenzyme NADPH and NADPH regeneration system in its production process. Therefore, the present invention introduces the NADPH cofactor cycle to solve the problem of requiring a large amount of coenzyme NADPH in the production process.

[0004] The present invention constructs a recombinant expression vector of the dihydrofolate reductase (SmDHFR) gene, introduces formate dehydrogenase (pseFDH) to construct a regeneration cycle of the NADPH cofactor, and further optimizes the reaction conditions of the two enzymes, the optimal temperature, the optimal pH, the optimal enzyme ratio and other biosynthesis processes to achieve an increase in the biosynthesis yield of tetrahydrofolate. Summary of the invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for synthesizing tetrahydrofolate based on NADPH cofactor cycle catalysis in view of the deficiencies in the prior art.

[0006] In order to solve the above technical problems, the present invention discloses a method for synthesizing tetrahydrofolate based on NADPH cofactor cycle catalysis, which comprises the following steps: using Escherichia coli BL21 (DE3) as a host cell to express dihydrofolate reductase (SmDHFR) and formate dehydrogenase (pseFDH) in biocatalysis, using TB medium for fermentation culture, ultrasonically disrupting the cells and purifying to obtain SmDHFR pure enzyme solution and pseFDH pure enzyme solution; SmDHFR catalyzes the conversion of folic acid into tetrahydrofolate and consumes NADPH cofactor, while pseFDH converts NADP to formate in the reaction of oxidizing sodium formate. + Reduction to NADPH, therefore, after a two-step catalytic reaction cascade to achieve tetrahydrofolate synthesis, NADPH-NADP + Recycling of cofactors; the present invention fixes the concentration of dihydrofolate reductase (SmDHFR) and adjusts the concentration of formate dehydrogenase (pseFDH) to obtain the optimal enzyme ratio of the two enzyme addition concentrations; in addition, by exploring the optimal reaction pH of SmDHFR and pseFDH, the biosynthesis of tetrahydrofolate is improved based on the NADPH cofactor cycle. The specific technical scheme is as follows:

[0007] The present invention provides a method for synthesizing tetrahydrofolate based on NADPH cofactor cycle catalysis, wherein the catalytic system is subjected to a catalytic reaction to synthesize tetrahydrofolate;

[0008] The catalytic system includes folic acid, sodium formate, NADP + , dihydrofolate reductase and formate dehydrogenase; the catalytic reaction is that formate dehydrogenase converts NADP + Reduced to NADPH, using folic acid as substrate and NADPH as cofactor, dihydrofolate reductase catalyzes the reaction to synthesize tetrahydrofolate and NADP + , realizing the recycling of NADPH cofactor;

[0009] The dihydrofolate reductase is derived from Serratia marcescens, and its amino acid sequence is shown in SEQ ID NO.1; the formate dehydrogenase is derived from Pseudomonas sp., and its amino acid sequence is shown in SEQ ID NO.2.

[0010] Among them, in the catalytic system, the specific activity of dihydrofolate reductase is 0.25-0.27 U / mg, the specific activity of formate dehydrogenase is 0.10-0.12 U / mg. The concentration of folic acid is 0.1-50 mM, the concentration of sodium formate is 6-60 mM, and the concentration of NADP +The concentration of formate dehydrogenase is 1-10 mM, the concentration of dihydrofolate reductase is 10-100 μM, and the molar ratio of formate dehydrogenase to dihydrofolate reductase is 1-20:50. Preferably, the concentration of folic acid is 10-30 mM, the concentration of sodium formate is 6 mM, and the concentration of NADP + The concentration of is 1 mM, the concentration of dihydrofolate reductase is 100 μM, and the molar ratio of formate dehydrogenase to dihydrofolate reductase is 1:10, that is, the concentration of formate dehydrogenase is 10 μM.

[0011] Wherein, the catalytic system further comprises a solvent, and the solvent is a sodium hydrogen phosphate-sodium dihydrogen phosphate buffer or an acetic acid-sodium acetate buffer. Preferably, the solvent is an acetic acid-sodium acetate buffer with a pH of 4.5-5.5.

[0012] Wherein, the catalytic reaction is carried out under anaerobic conditions, the reaction temperature is 35-40°C, the reaction pH is 3.0-8.0, and the reaction time is 2-20h. Preferably, the reaction temperature is 37°C and the optimum pH is 5.0.

[0013] The dihydrofolate reductase is a pure dihydrofolate reductase enzyme solution, which is prepared by the following method: amplifying the gene encoding the dihydrofolate reductase, cloning it into an expression vector to construct a recombinant vector, introducing it into Escherichia coli to induce expression to obtain cells, and ultrasonically disrupting and purifying it;

[0014] The formate dehydrogenase is a pure formate dehydrogenase enzyme solution, which is prepared by the following method: amplifying a gene encoding formate dehydrogenase, cloning it into an expression vector to construct a recombinant vector, introducing it into Escherichia coli to induce expression to obtain cells, and ultrasonically disrupting and purifying it.

[0015] Among them, the nucleotide sequence of the gene encoding dihydrofolate reductase is shown as SEQ ID NO.3; the nucleotide sequence of the gene encoding dihydrofolate reductase is shown as SEQ ID NO.4; and the expression vector is pRSFDuet-1.

[0016] Wherein, the induced expression is carried out using IPTG, and the added concentration of IPTG is 0.75mM.

[0017] Preferably, the method specifically comprises the following steps:

[0018] (1) The gene encoding dihydrofolate reductase was cloned into the pRSFDuet-1 plasmid to construct a recombinant expression vector pRSFDuet-folA, and the gene encoding formate dehydrogenase was cloned into the pRSFDuet-1 plasmid to construct a recombinant expression vector pRSFDuet-fdh;

[0019] (2) introducing the recombinant expression vector pRSFDuet-folA into Escherichia coli, culturing with TB liquid culture medium and adding 0.75 mM IPTG to induce protein expression to obtain cells, ultrasonically disrupting and purifying to obtain a pure enzyme solution of dihydrofolate reductase (DHFR); introducing the recombinant expression vector pRSFDuet-fdh into Escherichia coli, culturing with TB liquid culture medium and adding 0.75 mM IPTG to induce protein expression to obtain cells, ultrasonically disrupting and purifying to obtain a pure enzyme solution of formate dehydrogenase (FDH); preferably, the Escherichia coli is Escherichia coli BL21 (DE3).

[0020] (3) Folic acid, sodium formate, NADP + , the pure enzyme solution of dihydrofolate reductase and the pure enzyme solution of formate dehydrogenase prepared in step (2) are mixed in an acetic acid-sodium acetate buffer for catalytic reaction; the catalytic reaction is carried out under anaerobic conditions, the reaction temperature is 37°C, and the reaction time is 2-17h. The present invention successfully realizes the pseFDH-mediated NADPH cofactor cycle coupling SmDHFR-catalyzed tetrahydrofolate synthesis. Preferably, the catalytic reaction system is: 20mM folic acid, 6mM sodium formate, 1mM NADP + , 100 μM dihydrofolate reductase SmDHFR pure enzyme, 10 μM formate dehydrogenase pseFDH pure enzyme, and the rest is 20 mM pH 5.0 acetic acid-sodium acetate buffer.

[0021] Beneficial effects:

[0022] The present invention aims to solve the above problems and provides a method for improving tetrahydrofolate biosynthesis based on NADPH cofactor cycle. The present invention constructs a gene recombinant expression vector of dihydrofolate reductase and formate dehydrogenase, and adopts a method of formate dehydrogenase-mediated NADPH cofactor cycle coupling dihydrofolate reductase catalyzing folic acid synthesis into tetrahydrofolate, thereby finally achieving the improvement of tetrahydrofolate biosynthesis based on NADPH cofactor cycle.

[0023] Compared with the prior art, the present invention has the following beneficial effects: in the present invention, dihydrofolate reductase is used to convert folic acid into tetrahydrofolate, consuming two molecules of NADPH. Formate dehydrogenase is introduced to convert the NADP generated by the reaction into + Reduced to NADPH to achieve the recycling of NADPH cofactor. In addition, by exploring the optimal enzyme ratio of the two enzymes, the optimal pH and the optimization of substrate concentration, the final tetrahydrofolate production reached 3661.4μM. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific implementation methods, and the above steps or other advantages of the present invention will become more clear.

[0025] Figure 1 This is the cycle diagram of folic acid synthesis of tetrahydrofolate and NADPH cofactor, where folA is the gene encoding dihydrofolate reductase and fdh is the gene encoding formate dehydrogenase.

[0026] Figure 2 SDS-polyacrylamide gel electrophoresis was used to verify the Figure 2 A is the supernatant (CE) and precipitate (IB) of crude dihydrofolate reductase DHFR from different sources; Figure 2 B is the pure enzyme solution of dihydrofolate reductase DHFR from different sources (PE); Figure 2 C is the supernatant (CE) and precipitate (IB) of crude formate dehydrogenase FDH from different sources; Figure 2 D is pure enzyme solution of formate dehydrogenase FDH from different sources (PE); protein marker (M).

[0027] Figure 3 This is a graph of folic acid consumption and tetrahydrofolate production in the enzyme catalysis system, in which only SmDHFR is added to form a single-enzyme catalysis system without a cofactor cycle, and SmDHFR and pseFDH are added together to form a dual-enzyme catalysis system with a cofactor cycle. Figure 4 is a comparison chart of reaction buffers with different pH values. Figure 4 A is the specific enzyme activity of SmDHFR in different pH catalytic systems; Figure 4 B is the specific enzyme activity of pseFDH in different pH catalytic systems; Figure 4 C is the yield diagram of tetrahydrofolate produced from folic acid catalyzed by two enzyme cascades under different pH conditions.

[0028] Figure 5 To optimize the reaction conditions, tetrahydrofolate yield diagram, Figure 5 A is a graph showing the yield of tetrahydrofolate in the catalytic system with the addition molar ratio of the two enzymes adjusted; Figure 5 B is the yield of tetrahydrofolate in the catalytic system with different folic acid concentrations added; Figure 5 C is a graph comparing the yield of tetrahydrofolate in the catalytic system before and after optimization of pH and enzyme ratio under the condition of the optimal folic acid concentration of 20 mM.

[0029] Figure 6 This is the result of screening dihydrofolate reductase and formate dehydrogenase from different sources. Figure 6 A is a graph showing the results of NADPH consumption by dihydrofolate reductase from different sources; Figure 6 B is a graph showing the specific activity of dihydrofolate reductase from different sources;

[0030] Figure 6 C is the result diagram of NADPH generation by formate dehydrogenase from different sources; Figure 6D is the specific activity diagram of formate dehydrogenase from different sources. DETAILED DESCRIPTION

[0031] In order to make the contents of the present invention easier to understand, the technical solutions of the present invention are further described below in conjunction with specific implementation methods.

[0032] In the following examples, the effects of pure enzymes from different batches may vary slightly, so when exploring the reaction conditions, comparisons were made in the catalytic system from the same batch.

[0033] The folic acid synthesis of tetrahydrofolate and NADPH cofactor cycle diagram of the present invention is as follows Figure 1 shown.

[0034] Example 1 Construction of recombinant plasmids pRSFDuet-folA and pRSFDuet-fdh

[0035] (1) Amplification of target gene

[0036] The target genes described in this example are dihydrofolate reductase encoding gene folA and formate dehydrogenase encoding gene fdh. The nucleotide sequence of dihydrofolate reductase encoding gene folA is shown in SEQ ID NO.3, which is derived from Serratia marcescens; the nucleotide sequence of formate dehydrogenase encoding gene fdh is shown in SEQ ID NO.4, which is derived from Pseudomonas sp.101.

[0037] By molecular biology design, folA-F and folA-R were target gene primers with homology arms, and the genome sequence of Serratia marcescens was used as a template to perform PCR amplification to obtain the amplification product of the target gene folA shown in SEQ ID NO. 3. By molecular biology design, fdh-F and fdh-R were target gene primers with homology arms, and the synthetic formate dehydrogenase gene fdh sequence was used as a template to perform PCR amplification to obtain the amplification product of the target gene fdh shown in SEQ ID NO. 4. The primer sequences, PCR amplification system and amplification conditions used in the experiment are shown in Table 1, Table 2 and Table 3, respectively.

[0038] Table 1 Target gene primer sequences

[0039] Primers Sequence (5'-3') folA-F CCACAGCCAGGATCCGAATTCGGGTACAATGATTATCAGCCTGATCG folA-R GCATTATGCGGCCGCAAGCTTTCAGCGGCCGCTGCAG fdh-F CCACAGCCAGGATCCGAATTCCATGGAATTCATGGCCAAAGTG fdh-R GCATTATGCGGCCGCAAGCTTCCTTAAACTGCTTTTTTGAATTTGGCTGC

[0040] Table 2 PCR amplification system

[0041]

[0042]

[0043] Table 3 PCR amplification conditions

[0044] step program temperature time 1 Pre-denaturation 95℃ 3min 2 transsexual 95℃ 15s 3 annealing 55℃ 15s 4 extend 72℃ 60s 5 Cyclic amplification Go to step 2 30 cycles 6 extend 72℃ 5min 7 Hold 12℃ forever 8 END

[0045] After PCR amplification, add it to the well of the prepared agarose gel for nucleic acid separation, set the agarose gel electrophoresis instrument to 130V, 25min. After the gel electrophoresis is completed, put the agarose gel into the gel imaging instrument, observe the size of the gene fragment band, quickly cut the gel for the correct bright band, perform gel recovery, obtain the purified target gene folA fragment and fdh fragment with homology arms, and put them in a -20℃ refrigerator for use.

[0046] (2) Enzyme digestion and homologous recombination

[0047] The plasmid pRSFDuet-1 was double-digested with restriction endonucleases EcoRI and HindIII. After the digestion, gel electrophoresis and gel recovery were performed to obtain a linearized pRSFDuet-1 digestion vector, which was homologously recombined with the target fragment folA purified in step (1) and transformed into Escherichia coli DH5α to obtain a recombinant plasmid pRSFDuet-folA. Similarly, the linearized pRSFDuet-1 digestion vector was homologously recombined with the target fragment fdh purified in step (1) and transformed into Escherichia coli DH5α to obtain a recombinant plasmid pRSFDuet-fdh. The digestion and homologous recombination were performed in a water bath, with double digestion at 37°C for 1h and then at 90°C for 10min; homologous recombination at 37°C for 1h. The double digestion system and homologous recombination system used in the experimental process are shown in Tables 4 and 5.

[0048] Table 4 Double enzyme digestion system

[0049] sample Volume (μL) Plasmids 41 EcoRI 2 HindIII 2 10× buffer enzyme 5 Total volume 50

[0050] Table 5 Homologous recombination system

[0051] sample Volume (μL) Linearized vector 4 Target gene with homology arms 4 Homologous recombinase C112 2 5× buffer enzyme 4 <![CDATA[ddH 2 The]]> 6 Total volume 20

[0052] Example 2 Construction of NADPH cofactor cycle in in vitro enzyme catalysis system

[0053] The recombinant plasmids pRSFDuet-folA and pRSFDuet-fdh prepared in Example 1 were transfected into Escherichia coli BL21 (DE3) by chemical transformation to obtain recombinant Escherichia coli BL21-folA and BL21-fdh. The obtained recombinant Escherichia coli were cultured in 150 mL of TB liquid medium at 37°C until OD 600When the pH reaches 0.6-0.8, add isopropyl-β-D-thiogalactoside (IPTG) to the culture medium at a final concentration of 0.75mM, set the shaker temperature to 18°C, and continue culturing for 14-16h to induce protein expression. After the induction, collect the cells by centrifugation at 6000rpm and 4°C for 8min, wash the cells twice with 50mM disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (pH 7.0), collect the bacteria and resuspend them with 50mM disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (pH 7.0). Lyse the bacteria by ultrasonication in an ice bath, centrifuge at 4°C and 4000rpm for 15min, separate the supernatant and the precipitate, and the supernatant is the crude enzyme solution. Use Ni produced by SUNRESIN The soluble protein was purified by FF (IDA) affinity chromatography column. The obtained supernatant crude enzyme solution was mixed with the Ni affinity chromatography column for 30 minutes, and nonspecific proteins were eluted with a low concentration of imidazole (50mM PBS buffer containing 300mM NaCl, wherein the imidazole concentration was 30mM), and then the target protein was eluted with a high concentration of imidazole and collected (50mM PBS buffer containing 300mM NaCl, wherein the imidazole concentration was 300mM). The target protein was concentrated, and the buffer was replaced with a storage buffer (50mM PBS, pH 7.0) using a centrifugal filter device produced by Milliproe to obtain a pure enzyme solution. The protein concentration was determined using a protein assay kit produced by Tiangen Biotech. The purity of the separated protein was evaluated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using the Bio-Rad Mini-Protean Tetra electrophoresis system produced by Bio-Rad. The prepared crude enzyme solution and pure enzyme solution were further verified by gel electrophoresis, as shown in Figure 2 As shown, the protein size of dihydrofolate reductase (SmDHFR) from Serratia marcescens is 19.9 kDa, and the protein size of formate dehydrogenase (pseFDH) from Pseudomonas sp. is 44.5 kDa. Take an appropriate amount of pure enzyme solution for in vitro enzyme catalysis experiment.

[0054] Through the above method, pure enzyme solutions of dihydrofolate reductase (SmDHFR) and formate dehydrogenase (pseFDH) were purified and obtained. The protein concentration of SmDHFR pure enzyme solution was 125 g / L and the specific activity was 0.26 U / mg; the protein concentration of pseFDH pure enzyme solution was 39 g / L and the specific activity was 0.11 U / mg.

[0055] The SmDHFR enzyme activity U is defined as: the amount of enzyme required to catalyze folic acid and consume 1 μmol NADPH in 1 min at 37° C. and pH 5.0;

[0056] The pseFDH enzyme activity U is defined as the amount of enzyme required to catalyze sodium formate to generate 1 μmol NADPH in 1 min at 37° C. and pH 7.0.

[0057] When there is no cofactor cycle in the system for single enzyme catalysis reaction, the total volume of the reaction system is 1 mL, including: 1 mM folic acid, 6 mM NADPH, 100 μM SmDHFR pure enzyme solution, and the rest is 50 mM pH 7.0 disodium hydrogen phosphate-sodium dihydrogen phosphate buffer;

[0058] When there are two enzyme cascade catalytic reactions with cofactor circulation in the system, the total volume of the reaction system is 1 mL, including: 1 mM folic acid, 6 mM sodium formate, 1 mM NADP + , 100 μM SmDHFR pure enzyme solution, 10 μM pseFDH pure enzyme solution, and the rest is 50 mM pH 7.0 disodium hydrogen phosphate-sodium dihydrogen phosphate buffer.

[0059] The above catalytic reactions were all carried out at 37°C in an anaerobic chamber. The reaction time was 17 hours, and samples were taken at regular intervals. Figure 3 As shown: The concentration of folic acid (FA) and the yield of tetrahydrofolate (THF) were determined. The enzymatic reaction without cofactor circulation in the catalytic system, that is, only SmDHFR was added to the reactants, and NADPH was added to verify that SmDHFR can catalyze folic acid to produce tetrahydrofolate; the cascade enzymatic reaction with cofactor circulation in the catalytic system, that is, SmDHFR and pseFDH were added to the reactants, and NADP was added + The experimental results show that pseFDH can catalyze NADP + Reduced to NADPH, SmDHFR oxidizes NADPH to NADP + At the same time, folic acid is converted to tetrahydrofolate to complete the NADPH cofactor cycle. The yield of THF and the concentration of FA were determined by HPLC.

[0060] Example 3 Exploring the Optimal Reaction pH of SmDHFR and pseFDH

[0061] This example explores the optimal reaction pH of SmDHFR and pseFDH, sets different gradient pH reaction buffers, pH 3.5, pH 4.0, pH 4.5, pH 5.0, pH 5.5, pH 6.0, pH 6.5, pH 7.0, pH 7.5, pH 8.0, and other reaction conditions remain unchanged to determine the yield of tetrahydrofolate. Specifically, the total volume of the enzyme-catalyzed reaction system is 1 mL, including the following three reaction systems:

[0062] 1) 1mM folic acid, 6mM NADPH, 100μM SmDHFR pure enzyme solution, different pH buffers;

[0063] 2) 6mM sodium formate, 1mM NADP + , 10 μM pseFDH pure enzyme solution, different pH buffers;

[0064] 3) 1mM folic acid, 6mM sodium formate, 1mM NADP + , 100μM SmDHFR pure enzyme solution, 10μM pseFDH pure enzyme solution, different pH buffers.

[0065] Among them, different pH buffers: pH 3.5-6.0 is acetic acid-sodium acetate buffer or pH 6.5-8.0 is disodium hydrogen phosphate-sodium dihydrogen phosphate buffer.

[0066] The above reaction system was carried out in an anaerobic chamber at 37°C for 2 hours. Figure 4 ), the optimum pH for SmDHFR is 5.0, and the optimum pH for pseFDH is 7.0; the optimum pH for the cascade enzyme catalysis reaction of the two enzymes is 5.0.

[0067] Example 4 Optimization of in vitro enzyme catalytic reaction conditions

[0068] In this example, the addition ratio of the two enzymes was first investigated, the SmDHFR enzyme concentration was fixed at 100 μM, and the pseFDH enzyme concentration was changed (2 μM, 4 μM, 10 μM, 20 μM, 40 μM) to adjust the addition ratio of the two enzymes (the molar ratio of SmDHFR: pseFDH was 50:1, 25:1, 10:1, 5:1, 5:2, respectively), and other reaction conditions remained unchanged to determine the tetrahydrofolate production. Specifically, the total volume of the enzyme-catalyzed reaction system was 1 mL, including: 1 mM folic acid, 6 mM sodium formate, 1 mM NADP + , 100μM SmDHFR pure enzyme solution, different concentrations of pseFDH pure enzyme solution, and the rest was 20mM pH 5.0 acetic acid-sodium acetate buffer. The reaction was carried out at 37℃ in an anaerobic chamber for 2h. By comparative analysis (such as Figure 5 The optimal enzyme ratio of the two enzymes is SmDHFR:pseFDH=10:1.

[0069] Then, the concentration of substrate folic acid was optimized, and different substrate concentration gradients were set, namely 100μM, 500μM, 1mM, 5mM, 10mM, 20mM, 30mM, and 50mM. Other reaction conditions remained unchanged, and the tetrahydrofolate production was measured. Specifically, the total volume of the enzyme-catalyzed reaction system was 1mL, including: different concentrations of folic acid, 6mM sodium formate, 1mM NADP +, 100μM SmDHFR pure enzyme solution, 10μM pseFDH pure enzyme solution, 20mM pH 5.0 acetic acid-sodium acetate buffer. The reaction was carried out at 37°C in an anaerobic chamber for 2h. By comparative analysis ( Figure 5 B), and finally determined that 20 mM folic acid was the optimal substrate concentration.

[0070] Finally, the reaction time was extended until the reaction was complete to compare the tetrahydrofolate yield, and the reaction time was optimized to 17h. The present invention optimizes the enzyme-catalyzed reaction pH, the addition ratio of the two enzymes, and the substrate concentration. The optimized reaction pH was 5.0, and the addition molar ratio of SmDHFR:pseFDH was 10:1 (the reaction pH before optimization was 7.0, and the enzyme addition ratio was 25:1). The results showed that ( Figure 5 C), under the condition of the optimal folic acid concentration of 20 mM, the NADPH cofactor cycle was added and the reaction conditions were optimized, and the tetrahydrofolate production reached 3661.14 μM (1.65 g / L), which was 107% higher than the reaction results under the reaction conditions before optimization.

[0071] The enzyme catalysis designed in this experiment all used pure enzyme solution.

[0072] Comparative Example 1 Screening of dihydrofolate reductase and formate dehydrogenase

[0073] The present invention screens different dihydrofolate reductases and formate dehydrogenases.

[0074] First, dihydrogen reductase (DHFR) was screened. Five DHFRs from different sources were selected, namely: SmDHFR from Serratia marcescens (amino acid sequence of SEQ ID NO.1), SpDHFR from Serratia proteamaculans (amino acid sequence of SEQ ID NO.5), EcDHFR from Escherichia coli BL21 (DE3) (amino acid sequence of SEQ ID NO.6), CgDHFR from Corynebacterium glutamicum K051 (amino acid sequence of SEQ ID NO.7), and PaDHFR from Pseudomonas aeruginosa PAO1 (amino acid sequence of SEQ ID NO.8). Crude enzyme solutions and pure enzyme solutions of the five enzymes were obtained according to the method described in Example 2. The protein gel images thereof are shown in FIG. Figure 2 A and Figure 2As shown in B. Under the same conditions (1 mM folic acid, 1 mM NADPH, 100 μg pure enzyme solution, pH 5.0 acetic acid-sodium acetate buffer, 37°C), DHFR from Serratia marcescens showed the greatest NADPH consumption, indicating that it had the best specific activity, as shown in Figure 6 A and Figure 6 As shown in B.

[0075] The present invention also compares the specific activities of formate dehydrogenases (FDHs) from two different sources, namely pseFDH from Pseudomonas sp. (amino acid sequence is SEQ ID NO.2) and cdFDH from Candida dubliniensis (amino acid sequence is SEQ ID NO.9). The crude enzyme solutions and pure enzyme solutions of the two enzymes were obtained according to the method described in Example 2. The protein gel images are shown in FIG. Figure 2 C and Figure 2 D. The reaction system is 6mM sodium formate, 1mM NADP + , 100 μg pure enzyme solution, pH 7.0 phosphate buffer, 37°C. The results showed that FDH from Pseudomonas sp. showed the best specific activity, e.g. Figure 6 C and Figure 6 D, where Figure 6 The control in C was without adding any enzyme.

[0076] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

[0077] The present invention provides a method and idea for synthesizing tetrahydrofolate based on NADPH cofactor cycle catalysis. There are many methods and approaches to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A method for synthesizing tetrahydrofolate based on NADPH cofactor cycle catalysis, characterized in that: The catalyst system is subjected to a catalytic reaction to synthesize tetrahydrofolate; Wherein, the catalytic system includes folic acid, sodium formate, NADP + , dihydrofolate reductase and formate dehydrogenase; the catalytic reaction is that formate dehydrogenase converts NADP + Reduced to NADPH, using folic acid as substrate and NADPH as cofactor, dihydrofolate reductase catalyzes the reaction to synthesize tetrahydrofolate and NADP + , while achieving the recycling of NADPH cofactor; The dihydrofolate reductase is derived from Serratia marcescens, and its amino acid sequence is shown in SEQ ID NO.1; the formate dehydrogenase is derived from Pseudomonas sp., and its amino acid sequence is shown in SEQ ID NO.

2.

2. The method according to claim 1, characterized in that In the catalytic system, the specific activity of dihydrofolate reductase is 0.25-0.27 U / mg, and the specific activity of formate dehydrogenase is 0.10-0.12 U / mg.

3. The method according to claim 1, characterized in that In the catalytic system, the concentration of folic acid is 0.1-50 mM, the concentration of sodium formate is 6-60 mM, and the concentration of NADP is + The concentration of formate dehydrogenase is 1-10 mM, the concentration of dihydrofolate reductase is 10-100 μM, and the molar ratio of formate dehydrogenase to dihydrofolate reductase is 1-20:

50.

4. The method according to claim 3, characterized in that In the catalytic system, the concentration of folic acid is 10-30 mM; the molar ratio of formate dehydrogenase to dihydrofolate reductase is 1:

10.

5. The method according to claim 1, characterized in that The catalytic system comprises a solvent, and the solvent is disodium hydrogen phosphate-sodium dihydrogen phosphate buffer or acetic acid-sodium acetate buffer.

6. The method according to claim 5, characterized in that The solvent is acetic acid-sodium acetate buffer with a pH of 4.5-5.

5.

7. The method according to claim 1, characterized in that The catalytic reaction is carried out under anaerobic conditions, with a reaction temperature of 35-40°C, a reaction pH of 3.0-8.0, and a reaction time of 2-20 hours.

8. The method according to claim 1, characterized in that The dihydrofolate reductase is a pure dihydrofolate reductase enzyme solution, which is prepared by the following method: amplifying the gene encoding the dihydrofolate reductase, cloning it into an expression vector to construct a recombinant vector, introducing it into Escherichia coli to induce expression to obtain cells, and ultrasonically disrupting and purifying it; The formate dehydrogenase is a pure formate dehydrogenase enzyme solution, which is prepared by the following method: amplifying a gene encoding formate dehydrogenase, cloning it into an expression vector to construct a recombinant vector, introducing it into Escherichia coli to induce expression to obtain cells, and ultrasonically disrupting and purifying it.

9. The method according to claim 8, characterized in that The nucleotide sequence of the gene encoding dihydrofolate reductase is shown as SEQ ID NO.3; the nucleotide sequence of the gene encoding dihydrofolate reductase is shown as SEQ ID NO.4; and the expression vector is pRSFDuet-1.

10. The method according to claim 8, characterized in that The induced expression is carried out using IPTG, and the added concentration of IPTG is 0.75mM.

Images