CCNE1 amplification type tumor marker, detection method and application of POLQ inhibitor

Abstract

The invention relates to the technical field of tumor treatment, in particular to a CCNE1 amplification type tumor marker, a detection method and application of a POLQ inhibitor. The marker is a POLQ gene or a Pol theta protein coded by the POLQ gene. The preparation for treating the CCNE1 amplification type tumor comprises a POLQ inhibitor. According to the invention, the POLQ gene is taken as a therapeutic target, so that the problems of insufficient specificity, serious adverse reaction, limited curative effect and the like of CCNE1 amplification type tumors in the existing therapeutic means can be effectively solved; the POLQ inhibitor has good specificity and a remarkable effect in the process of precisely killing CCNE1-high tumors and inducing cell apoptosis, and has a good synergistic effect with a platinum agent or a PARP inhibitor, so that a brand new theoretical basis and experimental support are provided for related research of CCNE1 amplification type tumors.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor treatment, and in particular to applications of a CCNE1 amplified tumor marker, a detection method and a POLQ inhibitor. Background Art

[0002] Amplification of the CCNE1 gene is common in many cancers (such as ovarian cancer, gastric cancer, etc.), and the abnormal cell cycle regulation driven by it is closely related to the rapid proliferation and treatment resistance of tumors. Studies have shown that CCNE1-amplified tumors usually show obvious resistance to chemotherapy and targeted therapy (such as PARP inhibitors, PARPi), and patients often have poor clinical prognosis. Although new drugs such as WEE1 inhibitors (WEE1i), CDK2 inhibitors (CDK2i) and ATR inhibitors (ATRi) have shown therapeutic potential for CCNE1-amplified tumors in some studies, these drugs have also exposed certain limitations, such as insufficient specificity, severe adverse reactions, and non-selective toxicity to normal cells, which hinder their clinical application. At present, there are still significant deficiencies in the clinical treatment of CCNE1-amplified tumors, and there is a lack of approved and widely recognized treatment options. There is an urgent need to develop new safe and specific targeted therapeutic drugs.

[0003] In recent years, DNA repair pathways have become an important research direction for tumor treatment, among which DNA polymerase Polθ (encoded by the POLQ gene) has attracted much attention due to its key role in homologous recombination repair-deficient tumors. DNA damage is a common molecular event in tumor cells, and many anti-tumor drugs kill tumor cells by inducing DNA damage. However, tumor cells have a strong ability to repair DNA damage, which can repair treatment-induced damage and escape the lethal effects of drugs. DNA damage can be divided into many types, among which double-strand DNA breaks (DSBs) are considered to be the most serious type of DNA damage because they may cause chromosomal aberrations or cell death. The repair of DSBs mainly relies on two key mechanisms: Homologous Recombination Repair (HR): Using sister chromosomes as templates to repair breaks with high fidelity. Non-Homologous End Joining Repair (NHEJ): Template-independent repair, although more efficient, is prone to introducing mutations or deletions. In addition, there is an alternative repair pathway: microhomology (MMEJ). When the HR or NHEJ pathway is defective, tumors repair DSBs by increasing the activity of the MMEJ pathway. DNA polymerase Polθ is an important participant in the MMEJ pathway. In cells lacking HR function (Homologous Recombination Deficiency, HRD), the activity of Polθ is increased. Small molecule drugs targeting Polθ can effectively kill HRD tumors. Even HRD tumors that are resistant to PARPi are still sensitive to Polθ inhibitors. Unlike HRD tumors, CCNE1 amplified tumors have normal HR function, but these tumors have significant endogenous DNA damage and high replication pressure due to oncogene amplification. Despite this, there has been no systematic study of the sensitivity of CCNE1 amplified tumors to POLQ inhibition. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a CCNE1 amplified tumor marker, a detection method and an application of a POLQ inhibitor.

[0005] The technical solution of the present invention to solve the above technical problems is as follows:

[0006] The present invention provides a CCNE1 amplified tumor marker, wherein the marker is a POLQ gene or a Polθ protein encoded by the POLQ gene.

[0007] The present invention also provides a method for detecting the CCNE1 amplified tumor marker as described above, comprising detecting the expression level of the POLQ gene by using a fluorescent quantitative PCR method in CCNE1 amplified tumor cells, or detecting the content of Polθ protein by using Western Blot.

[0008] Furthermore, the primers for the fluorescent quantitative PCR include a forward primer and a reverse primer. The sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.2.

[0009] The present invention also provides the use of a POLQ inhibitor in preparing a drug for treating CCNE1 amplified tumors.

[0010] The present invention also provides a preparation for treating CCNE1 amplified tumors, wherein the preparation comprises a POLQ inhibitor.

[0011] Furthermore, the POLQ inhibitors include novobiocin and ART558.

[0012] Furthermore, the preparation also includes a platinum agent or a PARP inhibitor.

[0013] Furthermore, the preparation is selected from drugs, pharmaceutical raw materials, vaccines, targeted inhibitors, gene therapy vectors or biological materials.

[0014] Furthermore, the preparation also includes pharmaceutically acceptable excipients.

[0015] Furthermore, the CCNE1-amplified tumor includes, but is not limited to, CCNE1-amplified breast tumor, CCNE1-amplified ovarian tumor, CCNE1-amplified endometrial tumor or CCNE1-amplified gastric tumor.

[0016] The beneficial effects of the present invention are:

[0017] (1) The present invention uses the POLQ gene or the Polθ protein encoded by it as a CCNE1-amplified tumor marker, and in particular uses the POLQ gene as a therapeutic target, which can effectively solve the problems of insufficient specificity, severe adverse reactions and limited efficacy of existing treatments for CCNE1-amplified tumors;

[0018] (2) The preparation for treating CCNE1-amplified tumors of the present invention uses a POLQ inhibitor as the main therapeutic ingredient. The POLQ inhibitor has good specificity and significant effect in the process of accurately killing CCNE1-high tumors and inducing cell apoptosis;

[0019] (3) In the preparation for treating CCNE1-amplified tumors of the present invention, the POLQ inhibitor has a good synergistic effect with the platinum agent or the PARP inhibitor, and can significantly enhance the effect of the platinum agent or the PARP inhibitor;

[0020] (4) The CCNE1-amplified tumor marker and its detection method of the present invention provide a new theoretical basis and experimental support for the relevant research on CCNE1-amplified tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 is the CCNE1 amplified tumor marker of the present invention. In Example 1, the gene expression results of each database are: Figure 1 Figure a shows the differential gene expression results of CCNE1-high tumors relative to CCNE1-low tumors in a sample of an ovarian cancer clinical cohort in the GEO database (GSE208103); Figure 1 Middle b is a scatter plot of the correlation coefficient and significance (P value) between CCNE1 and POLQ expression in the TCGA database; Figure 1 Middle c is a tumor cell line in the GDSC database, showing the correlation between CCNE1 expression and FOXM1, MYBL2, PKMYT1 and POLQ expression;

[0022] Figure 2 is the CCNE1 amplified tumor marker of the present invention. In Example 1, the overall survival curve of CCNE1-high and CCNE1-low tumor patients with POLQ-high or POLQ-low obtained by pan-cancer analysis of clinical data from the TCGA database, Figure 2 A and Figure 2 b in the middle is ACC (adrenal cortical carcinoma), Figure 2 Medium c and Figure 2 The d in the middle is LIHC (hepatocellular carcinoma), Figure 2 Zhongehe Figure 2 f in the middle is PAAD (pancreatic cancer);

[0023] Figure 3 is the CCNE1 amplified tumor marker of the present invention. In Example 2, HeLa-CCNE1 Dox Comparison of results of Dox-induced CCNE1 in cell models; Figure 3 Figure a shows the Western Blot results of HeLa cells overexpressing CCNE1-encoded protein Cyclin E1 induced by different concentrations of Dox; Figure 3 Middle b: HeLa-CCNE1 treated with DMSO or Dox Dox EdU-PI staining flow cytometry results; Figure 3 Middle c is Dox-treated HeLa-CCNE1Dox RT-qPCR results of CCNE1 and POLQ expression at 0, 3, 5, and 7 days; Figure 3 d shows HeLa-CCNE1 treated with DMSO or Dox Dox , DNA repair reporter gene experiment results;

[0024] Figure 4 is the CCNE1 amplified tumor marker of the present invention. In Example 3, the effects of various drugs on HeLa-CCNE1Dox cells induced with or without Dox are shown in Table 3. Figure 4 The a in the middle is the killing curve of NVB. Figure 4 The b in the middle is the killing curve of ART558. Figure 4 The c in the middle is the killing curve of Cisplatin. Figure 4 The middle d is the killing curve of Talazoparib, Figure 4 The middle e is the killing curve of Olaparib, Figure 4 Where f is the IC corresponding to each drug 50 Result graph;

[0025] Figure 5 The CCNE1 amplified tumor marker of the present invention, in Example 3, shRNA knocked down HeLa-CCNE1 Dox The results after the POLQ gene in cells, Figure 5 Middle a is the Western Blot result of Polθ expression; Figure 5 b shows HeLa-CCNE1 induced with or without Dox Dox Cell, shPOLQ or shControl colony formation results;

[0026] Figure 6 is the CCNE1 amplified tumor marker of the present invention. In Example 3, the results of the effect of NBV on each cell line are as follows: Figure 3 Figure a is the killing curve of breast cancer cell line. Figure 6 Figure b is the killing curve of ovarian cancer cell line. Figure 6 The middle c is the killing curve of the endometrial cancer cell line. Figure 6 Middle d is the IC50 result graph of each cell line; Figure 6 Figure e shows the effect of NVB and Cisplatin combined with Dox on HeLa-CCNE1 induction Dox The cell killing curve Figure 6 f shows the effect of NVB and Talazoparib combination on HeLa-CCNE1 induced with or without Dox Dox Cell killing curve;

[0027] Figure 7is the CCNE1 amplified tumor marker of the present invention. In Example 4, POLQ inhibition is related to DNA damage. Figure 7 Middle a shows HeLa-CCNE1 treated with different concentrations of NVB Dox Western Blot results of cells; Figure 7 b in the middle is HeLa-CCNE1 Dox Western Blot results of shControl and shPOLQ induced CCNE1 overexpression with Dox for 0, 1, and 2 days, respectively; Figure 7 Middle c shows HeLa-CCNE1 after treatment with 200 μM NVB Dox Representative images of γH2AX immunofluorescence in cells. Figure 7 In d Figure 7 The fluorescence spot statistics result diagram in middle c; Figure 7 The middle e is HeLa-CCNE1 Dox Representative images of shControl and shPOLQ immunofluorescence in cells. Figure 7 Where f is Figure 7 The fluorescence spot statistics result diagram in middle e;

[0028] Figure 8 is a CCNE1 amplified tumor marker of the present invention, in Example 4, POLQ inhibits the accumulation of RAD51 repair products, Figure 8 Middle a is HeLa-CCNE1 treated with 200 μM NVB Dox Representative immunofluorescence images of RAD51 in cells. Figure 8 b is Figure 7 The fluorescence point statistical result diagram in a; Figure 8 c in the middle is HeLa-CCNE1 Dox Representative immunofluorescence images of RAD51 in shControl and shPOLQ. Figure 8 In d Figure 8 The fluorescence spot statistics result diagram in middle c;

[0029] Fig. 9 is the CCNE1 amplified tumor marker of the present invention. In Example 4, POLQ inhibition has an effect on cell apoptosis. Fig. 9 Middle a is HeLa-CCNE1 after treatment with 200 μM NVB Dox Cell apoptosis results diagram; Fig. 9 Middle b shows HeLa-CCNE1 after treatment with 200 μM NVB Dox Cell micronucleus counting results; Fig. 9 Middle c shows HeLa-CCNE1 after treatment with 200 μM NVB Dox Statistical results of cell chromosome abnormalities;

[0030] Fig.10 It is the CCNE1 amplified tumor marker of the present invention, in Example 2, the pCW57.1-CCNE1 plasmid map. DETAILED DESCRIPTION

[0031] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0032] The CCNE1 amplified tumor marker of the present invention is the POLQ gene or the Polθ protein encoded by the POLQ gene.

[0033] The POLQ gene is closely related to CCNE1-amplified tumors and can be used as a marker for CCNE1-amplified tumors. Using it as a therapeutic target can effectively solve the problems of insufficient specificity, severe adverse reactions and limited efficacy of existing treatments for CCNE1-amplified tumors. High expression of POLθ protein is an important feature of CCNE1-amplified tumors, and its detection results can provide a reliable basis for the screening and auxiliary diagnosis of such tumors.

[0034] The present invention focuses on the unique subtype of CCNE1-amplified tumors, reveals the significant correlation between high expression of POLQ and CCNE1 amplification, and based on the mechanism of action of POLQ in the tumor DNA repair pathway and its potential as a therapeutic target, for the first time, uses POLQ inhibitors as preparations for the treatment of CCNE1-amplified tumors, and verifies the good specificity and efficacy of POLQ inhibitors in precisely killing CCNE1-high tumors, providing a new theoretical basis and experimental support for related research on CCNE1-amplified tumors.

[0035] Specifically, the present invention has found through multiple experiments that the POLQ gene encoding the DNA polymerase Polθ has a specific high expression feature in CCNE1 amplified tumors, and by inhibiting Polθ activity, the viability of CCNE1 amplified tumor cells can be significantly reduced.

[0036] In addition, it should be noted that since POLθ expression may be affected by other tumor types or molecular environments, testing POLθ protein content alone may not be sufficient to fully confirm CCNE1-amplified tumors. If CCNE1-amplified tumors need to be confirmed, CCNE1 expression testing (such as CyclinE1 immunohistochemistry) is also required. The most important criterion is to detect the CCNE1 gene copy number using FISH or genomic sequencing.

[0037] The present invention also provides the use of a POLQ inhibitor, which can be used to prepare a preparation for treating CCNE1 amplified tumors.

[0038] Furthermore, the CCNE1-amplified tumor includes a CCNE1-amplified breast tumor, a CCNE1-amplified ovarian tumor, a CCNE1-amplified endometrial tumor or a CCNE1-amplified gastric tumor.

[0039] The present invention also provides a preparation for treating CCNE1 amplified tumors, comprising a POLQ inhibitor.

[0040] POLQ inhibitors include Novobiocin (NVB) and ART558.

[0041] Furthermore, the preparation also includes a platinum agent or a PARP inhibitor.

[0042] The present invention further verifies the potential of Polθ inhibitors (including but not limited to Novobiocin and ART558) in selectively killing CCNE1-amplified tumor cells, and provides a new therapeutic strategy for the targeted treatment of CCNE1-amplified tumors.

[0043] The present invention also provides a method for detecting the CCNE1 amplified tumor marker as described above, comprising detecting the expression of the POLQ gene by using fluorescent quantitative PCR in CCNE1 amplified tumor cells, or detecting the content of Polθ protein by using Western Blot.

[0044] The method for detecting the CCNE1 amplified tumor marker of the present invention can specifically detect the expression level of the POLQ gene, the content of the Polθ protein, or immunohistochemistry (IHC) detection of tissue samples.

[0045] In clinical promotion, the detection of CCNE1 amplified tumor markers can be selected as single indicator detection or multi-indicator combined detection according to specific scenarios. The specific selection criteria are:

[0046] For screening and preliminary diagnosis, immunohistochemistry (IHC) testing is recommended because it is mature, easy to operate and suitable for promotion in clinical pathology departments.

[0047] For confirmed or difficult cases, it is recommended to combine gene expression detection (qPCR) or protein content detection (such as Western Blot) for multi-dimensional diagnosis to improve the specificity and accuracy of diagnosis. In addition, the detection method provided by the present invention is flexible, allowing clinical institutions to choose the most suitable detection scheme according to resource conditions and actual needs.

[0048] The steps for detecting the expression level of the POLQ gene are as follows: obtaining a sample, and after preliminary processing, using real-time fluorescence quantitative PCR (qPCR) to detect the relative expression level of the POLQ gene, with GAPDH as a reference gene.

[0049] The PCR primer sequences are:

[0050] SEQ ID NO.1(POLQ-F):ACCTCTCCATCAAGGCATTTCT

[0051] SEQ ID NO.2(POLQ-R):GCAAAAGTTTCCAGCAGATACCC

[0052] GAPDH-F:GGAGCGAGATCCCTCCAAAAT

[0053] GAPDH-R:GGCTTGTTGTCATACTTCTCATGG

[0054] In the above process, specifically, the process of obtaining samples and preliminary processing is to collect tumor tissue or cell samples, extract total RNA using Trizol reagent, and measure the concentration and purity of RNA using Nanodrop instrument to ensure that the A260 / A280 ratio is between 1.8-2.0.

[0055] The specific process of mRNA expression detection is to reverse transcribe the extracted RNA into cDNA using a reverse transcription kit, and calculate the results using the 2^(-ΔΔCt) method.

[0056] Preferably, the reverse transcription kit is such as Novozymes HiScript IIQ RT SuperMix for qPCR.

[0057] The steps for detecting the Polθ protein content are as follows: obtaining samples, determining the protein concentration by the BCA method after preliminary treatment, and detecting the POLQ protein expression by Western Blot.

[0058] In the above process, specifically, the process of obtaining samples and preliminary processing is to use RIPA lysis buffer to extract total protein from cells or tissues.

[0059] The specific process of using Western Blot to detect POLQ protein expression is as follows: protein separation (10% SDS-PAGE), membrane transfer (PVDF membrane), and blocking with 5% BSA for 1 hour; primary antibody incubation: POLQ primary antibody (such as Thermo Fisher PA5-69577), 4°C overnight; after secondary antibody incubation, use ECL development and combine image analysis software for quantification.

[0060] The steps of immunohistochemistry (IHC) detection of tissue samples are as follows: obtain samples, add POLQ primary antibody and incubate after preliminary treatment, then use secondary antibody for staining, and evaluate the staining intensity and positive cell ratio under optical microscopy after DAB color development.

[0061] In the above process, specifically, the tumor tissue was fixed in 10% neutral buffered formaldehyde, embedded in paraffin and sliced ​​(4 μm), and after citric acid antigen retrieval, POLQ primary antibody (such as Abcam ab201673) was added and incubated at 4°C overnight.

[0062] Secondary antibody staining was used, and DAB staining was performed and the staining intensity and the proportion of positive cells were evaluated by light microscopy.

[0063] The above test results are determined as follows:

[0064] In the results of qPCR and Western Blot, the expression of POLQ was compared between CCNE1-high and CCNE1-low groups, and significant upregulation was defined as high expression. High expression can be determined by relative quantitative detection and absolute quantitative detection.

[0065] Specifically, relative quantitative detection is to calculate the expression fold of unknown samples relative to the control group, taking normal tissue samples or CCNE1-low tumor samples as reference. When the relative expression exceeds 2 times (such as 2^(-ΔΔCt)>2 in qPCR or gray value>2 times in Western Blot), it is defined as high expression.

[0066] Absolute quantitative detection is to establish a standard curve to determine the specific threshold of the mRNA copy number or protein concentration of the POLQ gene (such as POLQ copy number > 500 / mL RNA in qPCR, or POLQ concentration > 50ng / μL in Western Blot).

[0067] Both methods are suitable for clinical promotion, and the specific selection can be flexibly adjusted according to laboratory conditions or clinical needs. The present invention also recommends using normal tissue or standard products as controls during the detection process to ensure the accuracy and repeatability of the results.

[0068] In immunohistochemistry, samples with a POLQ positivity rate of >50% or a staining intensity score of 2+ were considered to have high expression.

[0069] Example 1 Correlation analysis between CCNE1 and POLQ gene expressions

[0070] This example verifies the correlation between CCNE1 gene expression level and POLQ gene expression level in various tumors, and evaluates the effect of POLQ expression in CCNE1-high tumors on patient survival.

[0071] The specific experimental method of this embodiment is as follows:

[0072] (1) Ovarian cancer treatment-related samples were screened in the GEO database (Gene Expression Omnibus), and the dataset GSE208103 was selected as the research object. According to the expression level of CCNE1 gene in the samples, the samples were divided into CCNE1-high group and CCNE1-low group. Among them, CCNE1-high group was defined as samples with CCNE1 gene expression higher than the sample median, and CCNE1-low group was defined as samples with CCNE1 gene expression lower than the sample median.

[0073] The limma package in R language was used to analyze the differentially expressed genes between the two groups of samples. The criteria for screening differentially expressed genes were: |logFC|>0.5 (absolute value of log2 fold change greater than 0.5) and adjusted P value (adj.p.value) <0.05. All analyses strictly followed the correction method for multiple hypothesis testing to improve the reliability of the results. The analysis results are shown in Figure 1 As shown in a.

[0074] according to Figure 1 As can be seen in Figure a, in the GEO cohort, POLQ was significantly upregulated in CCNE1-high tumor samples.

[0075] (2) Select the TCGA-TARGET-GTEx comprehensive dataset from the Xena browser and download the RNA sequencing expression data of CCNE1 and POLQ genes in different tumor and normal tissue samples in transcripts per million (TPM). Based on this data, a pan-cancer gene correlation analysis was performed. The Pearson correlation analysis method was used to calculate the correlation coefficient (R value) and significance (P value) between the expression of CCNE1 and POLQ genes. Tumor types with correlation coefficients R>0.5 and P values ​​<0.05 were defined as tumor types with significant positive correlation between CCNE1 and POLQ gene expression.

[0076] The above TCGA Pan-Cancer analysis Figure 1 As shown in b. Figure 1 As can be seen in b, CCNE1 and POLQ are positively correlated in various tumors.

[0077] (3) Download the gene expression data of each tumor cell line from the GDSC (Genomics of Drug Sensitivity in Cancer) database. Use the Pearson correlation analysis method to calculate the correlation coefficient (R value) and significance (P value) between the expression of CCNE1 and POLQ, FOXM1, MYBL2 and PKMYT1 genes. Focus on the correlation between the target gene POLQ and CCNE1, and verify whether the correlation between FOXM1, MYBL2 and PKMYT1 is consistent with the literature reports ( Figure 1 c).

[0078] The above analysis results are as follows Figure 1 As shown in c, according to Figure 1 As can be seen in c, in the GDSC database, CCNE1 was significantly positively correlated with FOXM1, MYBL2, PKMYT1 and POLQ.

[0079] (4) Using the RNA sequencing gene expression data (FPKM) of each tumor sample in the TCGA (The Cancer Genome Atlas) database, we analyzed the effect of POLQ gene expression on the overall survival (OS) of patients with specific cancer types (such as hepatocellular carcinoma (LIHC), pancreatic cancer (PAAD), and adrenocortical carcinoma (ACC)).

[0080] According to the expression level of CCNE1 gene, the patient samples were divided into CCNE1-high group and CCNE1-low group. The CCNE1-high group was defined as patients with CCNE1 expression level higher than the sample median, while the CCNE1-low group was defined as patients with CCNE1 expression level lower than the sample median.

[0081] The effect of POLQ expression on OS was evaluated by Cox proportional hazards model, and survival analysis was performed in CCNE1-high and CCNE1-low groups. The analysis results included hazard ratio (HR), 95% confidence interval (CI) and P value to evaluate the independent predictive ability of POLQ expression on survival and its potential role in patients with different CCNE1 expression levels.

[0082] The survival curve of the TCGA database obtained by analysis is as follows Figure 2 As shown, according to Figure 2 It can be seen that in CCNE1-high tumors, POLQ-high patients had significantly shorter OS.

[0083] According to the above analysis results of this example, it can be concluded that the expression of CCNE1 and POLQ genes in tumors is closely related, and POLQ may affect the clinical prognosis of CCNE1-high patients.

[0084] Example 2 Overexpression of CCNE1 promotes POLQ expression and microhomology-mediated end-joining activity

[0085] In this example, HeLa-CCNE1 was constructed Dox Cell model to evaluate the effect of CCNE1 overexpression on POLQ expression and microhomology-mediated end joining (MMEJ) activity. All cells used in this example and subsequent examples were derived from the ATCC cell bank.

[0086] The specific experimental process of this embodiment is as follows:

[0087] 1. A CCNE1 overexpression cell model was constructed in HeLa cells using the Dox (doxycycline) induction system.

[0088] (1) Lentivirus packaging in HEK293T cells: Prepare a plasmid mixture with a ratio of 4:1:3 of pCW57.1-CCNE1 (Addgene Plasmid #164144,), pMD2.G and psPAX2 (total amount is 6 μg / well, 6-well plate). Use Lipo8000 to transfect according to the recommended instructions and transfect the plasmid mixture into HEK293T cells. 6 hours after transfection, replace the culture medium with fresh one to reduce the toxicity of the transfection reagent. 48 hours and 72 hours after transfection, collect the cell culture supernatant and filter (0.45 μm filter membrane) to obtain the supernatant containing lentiviral particles. Store the viral supernatant at -80°C for future use, or use it immediately for infection. The pCW57.1-CCNE1 plasmid map is shown in the figure. Fig.10 shown.

[0089] (2) Lentivirus infection of HeLa cells: HeLa cells were inoculated in 6-well plates and allowed to reach about 70% confluence the next day. 8 μg / mL Polybrene (Yishen Biotech) was added to the culture medium containing the viral supernatant, mixed and added to the HeLa cell culture medium. Fresh culture medium was replaced 6 hours after infection. 48 hours after infection, 5 μg / mL Blasticidin (MCE) was added for antibiotic selection.

[0090] (3) Antibiotic screening and establishment of stable cell lines: During the antibiotic screening period (about 7-10 days), the culture medium containing blasticidin was replaced until all uninfected cells died. After the screening was completed, the concentration of blasticidin in the culture medium was maintained at 1 / 3, i.e., about 1.67 μg / mL, to maintain the stability of the cell line.

[0091] (4) Model verification: Cyclin E1 expression was induced by Dox (MCE) gradient, and the effects of different concentrations (such as 0, 0.1, 0.2, 0.5, and 1 μg / mL) on the expression of the target protein were detected. Western Blot was used for verification. The verification results are shown in Figure 2. Figure 3 As shown in a. The Cyclin E1 antibody is 11554-1-AP from Wuhan Tri-Eagle Technology Co., Ltd.

[0092] according to Figure 3 As can be seen in a, Dox induced significant overexpression of CCNE1.

[0093] The specific process of Western Blot experiment is to add RIPALysis Buffer (purchased from Sevier) to the cell culture fluid to be tested for lysis, and use Coomassie Brilliant Blue solution to determine the protein concentration. After adding protein loading buffer and mixing, the protein sample is placed at 100°C and boiled for 5 minutes. Electrophoresis is performed using 10% SDS-PAGE gel, and the PVDF membrane is transferred, and then blocked with TBST solution containing 5% BSA at room temperature for 1 hour. Depending on the molecular weight of the target protein, the membrane is cut into several strips and incubated with the primary antibody at 4°C overnight. After the strips are rewarmed the next day, they are fully washed with TBST 3 times, 10 minutes each time, and incubated with the corresponding secondary antibody at room temperature for 1 hour. Then rinse with TBST 3 times, 10 minutes each time, and then use ECL developer to develop the color. Bio-rad exposure instrument is used to collect film.

[0094] EdU-PI flow cytometry was used to detect changes in the cell cycle under Dox-induced conditions to further verify the effect of CCNE1 on the cell cycle. The test results are shown in Figure 3 As shown in b.

[0095] according to Figure 3 As can be seen in middle b, Dox induced significant overexpression of CCNE1 and also had a significant effect on the cell cycle, with a significant increase in the number of cells in the S phase.

[0096] The specific experimental method of EdU-PI staining cell cycle flow cytometry is to use BeyoClick TM EdU-647 Cell Proliferation Detection Kit. First, the treated cells were cultured according to the experimental design and EdU (2×Click-iT TMThe cells were incubated in EdU solution (diluted) for 2 hours to label newly synthesized DNA. Afterwards, the cells were collected, washed once with pre-cooled PBS, and fixed with 4% paraformaldehyde at room temperature for 15 minutes. After fixation, the cells were permeabilized with 0.5% Triton X-100 / PBS for 20 minutes. Next, the Click reaction mixture was prepared according to the kit instructions: including EdU reaction buffer (Component C), CuSO 4 (Component D), fluorescent labeling reagent 647 (Component A) and reaction accelerator (Component E), and react with cells for 30 minutes under light-proof conditions to allow EdU to specifically bind to the 647 fluorescent dye. After the fluorescent labeling is completed, the cells are washed twice with PBS to remove the residual reagents. Then, propidium iodide (PI, 50 μg / mL) (BD) containing RNase A is used to stain the cells for 15 minutes in the dark to mark the total amount of DNA. Finally, the samples are detected by flow cytometry, where the 647 channel is used to analyze the proliferation activity of EdU incorporation and the PE channel is used for the cell cycle distribution of PI labeling.

[0097] 2. HeLa-CCNE1 Dox Exploring the correlation between POLQ expression and MMEJ activity and CCNE1 expression in cell models

[0098] (1) RT-qPCR was used to detect the expression changes of CCNE1 and POLQ genes at different time points. The specific treatment time point was HeLa-CCNE1 Dox Cells were treated with 200 ng / ml Dox for 0, 3, 5, and 7 days.

[0099] RNA was extracted using Trizol reagent at these time points, and RNA concentration was measured using Nanodrop 2000 (Merck). Reverse transcription polymerase chain reaction was performed using a dedicated RT-qPCR premix (HiScriptⅡQ RT SuperMix for qPCR (+gDNAwiper), Novazon). RT-PCR was performed using a universal high-sensitivity dye quantitative PCR detection kit (ChamQ Universal SYBR qPCR Master Mix, Novazon). The test results are shown in Table 1. Figure 3 As shown in c.

[0100] according to Figure 3 As can be seen in middle c, the upregulation of CCNE1 was accompanied by a significant increase in POLQ expression.

[0101] The primers used for RT-PCR detection are shown in Table 1.

[0102] Table 1 RT-PCR primers and sequences

[0103] Primer name sequence hCCNE1 F AGAGGAAGGCAAACGTGACC hCCNE1 R TATTGTCCCAAGGCTGGCTC hPOLQ-F ACCTCTCCATCAAGGCATTTCT hPOLQ-R GCAAAAGTTCCAGCAGATACCC hGAPDH-F GGAGCGAGATCCCTCCAAAAT hGAPDH-R GGCTGTTGTCATACTTCTCATGG

[0104] (2) DNA repair reporter gene assay was used to detect changes in MMEJ activity.

[0105] HeLa-CCNE1 Dox The cells were induced with or without Dox to express CCNE1. The three DNA repair reporter gene plasmids DR-GFP, EJ2-GFP, and EJ5-GFP were transfected with Lipo8000 transfection reagent. After 24 hours, the pCBASceI plasmid was transfected. After 48 hours, the proportion of GFP-positive cells was detected by flow cytometry. The test results are shown in Figure 3 As shown in d. Figure 3 As can be seen in middle d, Dox treatment leads to a significant enhancement of MMEJ activity.

[0106] According to the experimental results of this example, it can be found that Dox induces significant overexpression of CCNE1 and has a significant effect on the cell cycle, with a significant increase in the number of cells in the S phase. Overexpression of CCNE1 promotes POLQ expression and microhomology-mediated end-joining activity.

[0107] Example 3 POLQ inhibitor specifically kills CCNE1-high tumors

[0108] This example evaluates the specific killing effect of POLQ inhibitors in CCNE1-high tumors and the effect of combining with commonly used drugs.

[0109] 1. In HeLa-CCNE1 Dox Validation of the effect of POLQ inhibition on CCNE1-high tumors in cell models

[0110] (1) CCK8 cell activity detection:

[0111] HeLa-CCNE1 Dox The cells were seeded at a number of 2000 cells / well in a 96-well plate. On the next day, CCNE1 overexpression was induced with or without 200 ng / ml Dox. NVB, ART558, Cisplatin, Talazoparib, and Olaparib were added at a dilution ratio of 1:2. The maximum concentrations of the drugs were 500 μM, 120 μM, 10 μM, 2000 nM, and 200 μM, respectively. Eight concentration gradient points were set (taking NVB as an example, the concentration gradient was: 500, 250, 125, 62.5, 31.25, 15.625, 7.8125, and 0).

[0112] The cells were incubated at 37°C in a 5% CO2 After culturing in the incubator for 5 days, CCK8 reagent (Yacoin Biotechnology Co., Ltd.) was added to each well at a volume of 10%, incubated at 37°C for 1.5-2.5 hours, and the absorbance was detected at a wavelength of 450 nM using an ELISA reader. GraphPad Prism8 was used to draw the cell survival curve and calculate the IC 50 The cell killing curves in the experimental groups with each drug added are shown in Figure 2. Figure 4 As shown in a~e, the IC of the experimental group with each drug added 50 Value Figure 4 As shown in figure f.

[0113] according to Figure 4 It can be seen that NVB and ART558 have significantly stronger killing effects on CCNE1-high (Dox-induced) cells than CCNE1-low (uninduced) cells, while Cisplatin, Talazoparib, and Olaparib did not show significant differences. NVB and ART558 have higher specificity for CCNE1-high cells.

[0114] (2) Construction of shRNA POLQ knockdown cells

[0115] shRNA knockdown of HeLa-CCNE1 Dox For the POLQ gene in cells, three pairs of suitable shRNA primers were selected from the official website of shRNA primer design of Merck Company. The specific primers are shown in Table 2.

[0116] (The official website for shRNA primer design is https: / / www.sigmaaldrich.cn / CN / zh / semiconfigurators / shrna?activeLink=product Search).

[0117] Table 2 shRNA primers and sequences

[0118]

[0119] Primer annealing: The shRNA primer was diluted to 10 μM and annealed on a PCR instrument according to the following system. The specific reaction process was to react at 85°C for 10 minutes, and then slowly cool to 25°C at a rate of 1°C per minute to obtain annealed primers.

[0120] Table 3 PCR system

[0121] Forward Primer 10μL Reverse primer 10μL Annealing Buffer 5μL Enzyme-free water 25μL

[0122] The digested vector pLKO.1 was connected to the annealed primers, and the mixture was mixed according to the ratio of 1 μL of digested vector, 2 μL of annealed primers, and 3 μL of Ligation-High Buffer, and incubated at 16°C for 3 hours on a PCR instrument. After transformation, shaking, and plasmid extraction of the ligated product, the first generation sequencing was performed using human U6 promoter primers, and the sequencing results were compared with the original vector on SnapGene.

[0123] The subsequent lentiviral packaging and antibiotic screening steps were the same as before. Here, the screening antibiotic was Puromycin (MCE Company), the screening concentration was 1 mg / ml, and the maintenance concentration was 0.33 mg / ml.

[0124] Western Blot verification of knockdown effect Figure 5 As shown in a, the expression of Polθ in shPOLQ cells was significantly reduced. Polθ antibody was purchased from Thermo Fisher Scientific, catalog number PA5-69577.

[0125] (3) Clone formation experiment: HeLa-CCNE1 Dox 1000 cells of shControl and shPOLQ were plated in six-well plates. The next day, 200 ng / ml of Dox was added or not, and the cells were incubated at 37°C with 5% CO. 2 Culture in an incubator for 14 days, changing the medium every 3-4 days.

[0126] After 14 days, the cells formed obvious clones, washed three times with PBS, fixed with 4% paraformaldehyde for 15 minutes, and then stained with crystal violet dye (Sevier Company) for 30 minutes. After staining, the dye was rinsed off with double distilled water, and the cells were naturally air-dried and photographed. The results are shown in the figure. Figure 5 As shown in b.

[0127] according to Figure 5 It can be seen that shRNA knockdown of POLQ significantly inhibited the clone formation ability of CCNE1-high cells.

[0128] 2. Effects of POLQ inhibition on CCNE1-high tumors in different tumor cell lines

[0129] In this example, three breast cancer cell lines (MCF7, MDA-MB-231, HCC1569) with low, medium and high CCNE1 expression, three ovarian cancer cell lines (ES2, OVCAR8, OVCAR3), and two endometrial cancer cell lines (HEC1A, KLE) were selected, and their killing curves against NVB were detected by CCK8 experiment, and IC 50 The result is as follows Figure 6As shown in ad, it can be seen that the killing effect of NVB on CCNE1 high-expression cell lines is significantly better than that on low-expression cell lines.

[0130] 3. HeLa-CCNE1 Dox Effects of POLQ inhibition combined with PARPi or platinum on CCNE1-high tumors in cell models.

[0131] HeLa-CCNE1 Dox In cells, CCNE1 expression was induced with or without Dox, and the effect of drug combination on cell survival was evaluated with or without NVB100 μM. The results were as follows Figure 6 Zhongehe Figure 6 As shown in middle f, the combined treatment showed that NVB significantly enhanced the killing of CCNE1-high cells by Cisplatin and Talazoparib.

[0132] In the above experimental results of this embodiment, NVB and ART558 were significantly stronger in killing CCNE1-high (Dox-induced) cells than CCNE1-low (uninduced) cells, and Cisplatin, Talazoparib, and Olaparib did not show significant differences. NVB and ART558 have higher specificity for CCNE1-high cells. shRNA knockdown of POLQ significantly inhibited the cloning ability of CCNE1-high cells. The killing effect of NVB on CCNE1 high-expressing cell lines was significantly better than that on low-expressing cell lines. NVB significantly enhanced the killing of CCNE1-high cells by Cisplatin and Talazoparib. From the above results, it can be concluded that POLQ inhibitors have significant potential to specifically kill CCNE1-high tumors and can enhance the therapeutic effect of DNA damaging drugs.

[0133] Example 4 POLQ inhibition leads to DNA damage and cell apoptosis in CCNE1-high tumors

[0134] This example specifically investigates the mechanism by which POLQ inhibition induces DNA damage and cell apoptosis in CCNE1-high tumors. The experimental method of this example is as follows:

[0135] 1. HeLa-CCNE1 Dox POLQ inhibition caused more severe DNA damage in cell models.

[0136] HeLa-CCNE1 DoxCells were treated with or without Dox to induce CCNE1 overexpression. After adding different concentrations of NVB, Western Blot was performed to detect DNA damage markers (γH2AX). The test results are shown in Figure 7 As shown in a. Immunofluorescence experiments were used to detect the distribution and quantity changes of γH2AX fluorescent spots in cells after NVB treatment. The test results are shown in Figure 7 Medium c and Figure 7 As shown in middle d, it can be seen that the POLQ inhibitor NVB significantly increased DNA damage in CCNE1-high cells.

[0137] HeLa-CCNE1 Dox Cells shControl and shPOLQ were induced with or without Dox to overexpress CCNE1, and DNA damage markers (γH2AX) were detected by Western Blot. The results are shown in Figure 7 As shown in b. Immunofluorescence experiments were used to detect the distribution and quantity changes of γH2AX fluorescent spots in cells after NVB treatment. The test results are shown in Figure 7 Zhongehe Figure 7 As shown in middle f, it can be seen that POLQ knockdown also significantly increased DNA damage in CCNE1-high cells.

[0138] The above-mentioned γH2AX antibody is ab81299 from Abcam. The above-mentioned immunofluorescence experimental method is specifically as follows: the cells to be tested are inoculated on the slide and treated according to the experimental design. Wash 3 times with PBS, add 4% paraformaldehyde to fix for 15 minutes, and use 0.5% Triton-X 100, 5% BSA to permeabilize and block for 60 minutes. After adding the primary antibody and incubating overnight, add the secondary antibody and bind at room temperature for 1 hour, and finally use DAPI to stain the nucleus and anti-fluorescence quenching sealing agent to seal the slide. Use a fluorescence microscope in a dark room to observe and collect images in turn.

[0139] 2. In HeLa-CCNE1 Dox In a cell model, it was verified that POLQ inhibition resulted in more accumulation of RAD51 repair products.

[0140] HeLa-CCNE1 Dox Cells were treated with or without Dox to induce CCNE1 overexpression, and then treated with 200 μM NVB to detect the distribution and number changes of large RAD51 fluorescent spots in cells; HeLa-CCNE1 Dox Cells shControl and shPOLQ were used or not to induce CCNE1 overexpression with Dox, and the distribution and number of large RAD51 fluorescent spots in cells were detected. The results are shown in Figure 7 The RAD51 antibody is ab133534 from Abcam.

[0141] Immunofluorescence revealed that NVB and POLQ knockdown caused more accumulation of RAD51 repair products in CCNE1-high cells.

[0142] 3. HeLa-CCNE1 Dox POLQ inhibition increases genomic instability and leads to apoptosis in cell models

[0143] HeLa-CCNE1Dox cells were treated with or without Dox to induce CCNE1 overexpression and 200 μM NVB, and apoptosis was detected by flow cytometry, the number of micronuclei was detected by immunofluorescence, and the number of abnormal chromosomes was detected by chromosome analysis. The results are shown in Fig. 9 Middle K, Fig. 9 Middle l, Fig. 9 As shown in middle m, it can be seen that NVB significantly increased the genomic instability and apoptosis rate of CCNE1-high cells.

[0144] The specific method of Annexin V-FITC / PI double staining method for detecting cell apoptosis is to collect the treated cells, including floating cells and adherent cells in the culture medium, wash them twice with PBS, and suspend them in 1× Annexin V binding buffer. The cell density is adjusted to 1×10 6 / mL. Subsequently, 5μL Annexin V-FITC and 5μL PI staining solution were added, gently mixed, and incubated at room temperature in the dark for 10-15 minutes. After incubation, flow cytometry was used to detect early apoptotic cells (Annexin V-FITC positive, PI negative), and PI channel was used to detect late apoptotic or necrotic cells (Annexin V-FITC positive, PI positive). Results The distribution of cell populations was analyzed by flow cytometry to quantify the proportion of early and late apoptosis.

[0145] The specific method of micronucleus detection is as follows: First, the treated cells are inoculated in a six-well plate pre-laid with a glass slide and cultured, and treated according to the experimental design. After the treatment is completed, the culture medium is discarded, the cells are washed twice with PBS, and then the cells are fixed with 4% paraformaldehyde for 15 minutes. After fixation, wash twice with PBS, and permeabilize the cells with 0.1% Triton X-100 / PBS for 10 minutes. Next, add DAPI staining solution (final concentration 1μg / mL), stain for 10 minutes in the dark, wash the slides twice with PBS after staining, gently dry the surface liquid, and seal the slides on the slides. Finally, the images of the cell nuclei and micronuclei are observed and photographed by fluorescence microscopy, and the number of micronuclei in every 100 cells is counted.

[0146] The specific process of chromosome analysis is to culture the treated cells in a medium containing Colcemid (final concentration 0.1 μg / mL) for 6-8 hours to block the cells in metaphase of mitosis. Subsequently, the cells were collected and treated with 0.075M KCl solution for 20 minutes, and the cell suspension was gently blown to avoid cell damage. After hypotonicity, the cells were fixed with a freshly prepared fixative (methanol: glacial acetic acid = 3:1), and the fixation process was repeated 3 times. After fixation, the cell suspension was dripped onto a pre-cooled glass slide to prepare a chromosome smear, which was air-dried and stained with DAPI staining solution (final concentration 1 μg / mL) for 10 minutes. After staining, the slide was sealed with an anti-fluorescence quenching sealant, and the chromosomes were observed under a high-power microscope under a fluorescence microscope. Abnormalities such as chromosome breakage, deletion, and rearrangement were recorded, and the number of abnormal chromosomes per 100 cells was counted.

[0147] The above experimental results of this example show that the POLQ inhibitor NVB significantly increased DNA damage in CCNE1-high cells, and POLQ knockdown also significantly increased DNA damage in CCNE1-high cells. Immunofluorescence showed that NVB and POLQ knockdown caused more accumulation of RAD51 repair products in CCNE1-high cells. NVB significantly increased the genomic instability and apoptosis rate of CCNE1-high cells.

[0148] Therefore, it can be concluded that POLQ inhibitors induce DNA damage and accumulation of RAD51 toxic repair products, causing genomic instability, specifically killing CCNE1-high tumor cells, and significantly inducing cell apoptosis.

[0149] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A CCNE1 amplified tumor marker, characterized in that: The marker is the POLQ gene or the Polθ protein encoded by the POLQ gene.

2. A method for detecting a CCNE1 amplified tumor marker according to claim 1 or 2, characterized in that: The method comprises using a fluorescent quantitative PCR method to detect the expression level of the POLQ gene in CCNE1 amplified tumor cells, or using Western Blot to detect the content of Polθ protein.

3. The method for detecting a CCNE1 amplified tumor marker according to claim 2, characterized in that: The primers for the fluorescent quantitative PCR include a forward primer and a reverse primer. The sequence of the forward primer is shown in SEQ ID NO.1, and the sequence of the reverse primer is shown in SEQ ID NO.

2.

4. Application of POLQ inhibitors in the preparation of drugs for the treatment of CCNE1-amplified tumors.

5. A preparation for treating CCNE1-amplified tumors, characterized in that: The formulation includes a POLQ inhibitor.

6. A preparation for treating CCNE1-amplified tumors according to claim 5, characterized in that: The POLQ inhibitors include novobiocin and ART558.

7. A preparation for treating CCNE1-amplified tumors according to claim 6, characterized in that: The formulation also includes a platinum agent or a PARP inhibitor.

8. A preparation for treating CCNE1-amplified tumors according to any one of claims 5 to 7, characterized in that: The preparation is selected from drugs, pharmaceutical raw materials, vaccines, targeted inhibitors, gene therapy vectors or biological materials.

9. A preparation for treating CCNE1-amplified tumors according to any one of claims 5 to 7, characterized in that: The preparation also includes pharmaceutically acceptable excipients.

10. A preparation for treating CCNE1-amplified tumors according to any one of claims 5 to 7, characterized in that: The CCNE1-amplified tumor includes a CCNE1-amplified breast tumor, a CCNE1-amplified ovarian tumor, a CCNE1-amplified endometrial tumor or a CCNE1-amplified gastric tumor.

Images