SiRNA nano-liposome and application of siRNA nano-liposome in preparation of medicine for treating non-alcoholic fatty liver disease

Abstract

The invention discloses siRNA (small interfering Ribonucleic Acid) nano-liposome and application of the siRNA nano-liposome in preparation of a medicine for treating non-alcoholic fatty liver disease. The siRNA nano-liposome targeting acetyl-CoA carboxylase obtained through screening can specifically silence ACC genes, the off-target effect is reduced, the curative effect is lasting, the immunogenicity is reduced, the siRNA nano-liposome has remarkable long-term effectiveness and compliance, the treatment efficiency can be improved, and the toxic and side effects can be reduced.

Description

(I) Technical field

[0001] The invention belongs to the field of biomedical materials, and in particular relates to a siRNA nanoliposome and an application thereof in preparing a drug for treating non-alcoholic fatty liver disease. (II) Background technology

[0002] Non-alcoholic fatty liver disease (NAFLD) is a global epidemic disease closely related to metabolic disorders. Its incidence rate has increased year by year and has become one of the most common chronic liver diseases in adults and children worldwide. The disease spectrum ranges from simple hepatic steatosis to non-alcoholic steatohepatitis (NASH), cirrhosis and hepatocellular carcinoma (HCC). The pathogenesis of NAFLD is complex, involving the interaction of multiple factors such as insulin resistance, genetic susceptibility, environmental factors and lifestyle. Due to the diversity of its etiology and the complexity of the pathological process, the treatment of NAFLD faces major challenges, and there is currently no specific drug available for treatment. In addition, NAFLD is closely related to a variety of metabolic diseases such as type 2 diabetes and cardiovascular disease, which increases the complexity of treatment. Therefore, NAFLD has a wide audience, is difficult to treat, has a complex pathological mechanism, and currently lacks a radical cure.

[0003] In the pathophysiological process of NAFLD, lipid metabolism disorder is a key link. ACC (acetyl-CoA carboxylase) is at the starting position of fatty acid synthesis and is the rate-limiting enzyme for fatty acid synthesis. Compared with other targets, it directly controls the de novo synthesis of fatty acids in the liver. For example, targets such as fatty acid transport protein (FATP) mainly regulate the uptake process of fatty acids, while ACC regulates the production of fatty acids from the source. The ACC target can not only reduce fatty acid synthesis, but also have a comprehensive regulatory effect on metabolism. When ACC is inhibited, the synthesis of malonyl-CoA is reduced, which will relieve the inhibition of malonyl-CoA on carnitine palmitoyltransferase-1 (CPT-1). CPT-1 is a key enzyme for fatty acid β-oxidation, and the release of its inhibition allows more fatty acids to enter the mitochondria for oxidative decomposition. This dual regulatory effect on fatty acid synthesis and oxidation is a unique advantage of the ACC target. In contrast, oxidative stress-related targets such as superoxide dismutase (SOD) mainly focus on alleviating the damage of oxidative stress to the liver, and their regulatory effect on fatty acid metabolism is relatively weak. In the course of NAFLD disease progression, from simple fatty liver to nonalcoholic steatohepatitis (NASH) to liver fibrosis, abnormal lipid accumulation is a persistent problem. Intervention of the ACC target can effectively regulate lipid metabolism at an early stage, thereby potentially blocking the progression of the disease to a more severe stage. For example, inflammation-related targets such as nuclear factor-κB (NF-κB) mainly play a role in reducing inflammation after inflammation has occurred, while the ACC target can play a role in the early stages of liver fat accumulation, reducing fat accumulation before inflammation is initiated, and preventing the occurrence of inflammation and the subsequent initiation of fibrosis. In summary, ACC, as a target for NAFLD, shows significant advantages over other targets due to its core role in fatty acid synthesis, specific targeting, and improvement of liver pathology.

[0004] In the treatment of NAFLD, although small molecule inhibitors of ACC have shown the potential to improve liver fat, inflammation and fibrosis, they also have some disadvantages and side effects. These disadvantages are mainly reflected in the following aspects:

[0005] (1) It is impossible to achieve multi-gene coordinated regulation; NAFLD is a complex disease involving multiple genes, involving genes related to multiple biological processes such as inflammatory response, lipid metabolism, and insulin resistance. Small molecule inhibitors have different pharmacokinetic and pharmacodynamic properties, and it is difficult to achieve a suitable concentration and duration of action in vivo. Secondly, the combined use of multiple small molecule inhibitors may increase the risk of drug interactions and lead to an increased incidence of adverse reactions.

[0006] (2) Increased serum triglyceride (TG) levels: In some clinical studies, an increase in serum triglyceride (TG) levels was observed after the use of ACC inhibitors, especially in patients with higher baseline TG levels. This side effect may be related to the reduction of polyunsaturated fatty acids (PUFA) caused by ACC inhibition, which in turn activates SREBP-1c and induces an increase in GPAT1 expression and VLDL secretion. It is speculated that this may be due to the complex structure of biotin proteins such as ACC, which may have multiple similar fatty acid binding sites or other functional domains. It is difficult for small molecule inhibitors to specifically inhibit its fatty acid uptake function.

[0007] (3) Immunogenicity and toxic side effects of small molecule inhibitors: ACC small molecule inhibitors have low specificity and may have certain off-target effects, which have potential toxic side effects on the body. Moreover, as foreign substances, small molecule inhibitors may be immunogenic, thereby reducing their efficacy.

[0008] (4) Limitations of efficacy and pharmacokinetics: Some small molecule inhibitors may be unable to effectively inhibit the activity of ACC continuously due to their rapid drug metabolism, resulting in a short maintenance time of effective concentration in the body.

[0009] Therefore, in response to the shortcomings and side effects of small molecule inhibitors of ACC, researchers are exploring new treatment methods, such as using siRNA to silence ACC. siRNA technology uses the RNA interference (RNAi) mechanism to silence the expression of target genes at the post-transcriptional level, thereby playing a role in treating diseases. This method may provide a more accurate and specific treatment method, reduce side effects, and improve treatment effects. siRNA sequences can be designed for multiple key genes to intervene in the occurrence and development of diseases from multiple aspects. It can silence target gene expression through sequence specificity that is completely complementary to the target gene mRNA, and ensure drug safety and effectiveness with its own high specificity. It can also use nanomaterials such as liposomes to deliver nucleic acids into cells to reduce immune response side effects, and its long-term effect reduces the frequency of administration, improves patient compliance, and achieves long-term inhibitory effects.

[0010] As a biological macromolecule, siRNA has significant advantages. It can target specific genes in a highly specific manner and achieve precise regulation of gene expression by interfering with the translation process of mRNA. This specificity is like a precision guided weapon that can "strike" pathogenic genes, showing great potential in the field of disease treatment. Moreover, based on its mechanism of action at the gene level, it can solve some disease problems caused by abnormal gene expression from the root. The advantages of siRNA over small molecule compounds in terms of safety and efficacy can be summarized as follows: 1) Gene-specific silencing (siRNA specifically silences target gene expression through the RNAi pathway); 2) Reduced off-target effects (the high specificity of siRNA can reduce the silencing of non-target genes); 3) Long-lasting efficacy (siRNA has a long half-life in the body and can provide long-lasting efficacy); 4) Low immunogenicity (siRNA, as a nucleic acid molecule, may have lower immunogenicity than some small molecule compounds, reducing side effects caused by immune response); 5) Long-term effect and compliance (the long-term effect of siRNA reduces the frequency of administration and improves patient compliance); 6) Chemical modification and delivery system (siRNA can be improved through chemical modification and specific delivery systems (such as GalNAc conjugation) to improve its stability and targeting, reduce side effects and enhance efficacy); 7) Easy detection of therapeutic effects (siRNA has a simple mechanism of action and directly degrades the mRNA of the target gene to achieve the effect of reducing the expression of the target gene, and its effect is easy to detect). These advantages make siRNA show great potential in disease treatment, especially in the precision medicine and personalized treatment of NAFLD.

[0011] However, siRNA also faces many challenges in its application. Among them, the delivery barrier is a major problem. It will encounter many obstacles in the process of entering the cell and it is difficult to reach the target site smoothly. The problems such as siRNA being easily degraded by nucleases in the body, poor stability, easy to be cleared by the kidneys in the blood circulation, and unable to effectively cross the cell membrane limit the clinical application of siRNA.

[0012] In this context, liposomes emerged as an important carrier. Liposomes are a synthetic lipid bilayer microcapsule structure, and its history can be traced back decades ago. After long-term research and development, it has become a mature drug delivery system. It has unique advantages. On the one hand, the structure of liposomes is similar to that of biological membranes, which enables it to better fuse with cell membranes, thereby effectively breaking through the delivery barrier and helping siRNA to enter the cell smoothly. On the other hand, liposomes can provide a relatively stable protective environment for siRNA, resisting the degradation of nucleases, greatly improving the stability of siRNA, and creating more favorable conditions for siRNA to exert its therapeutic effect.

[0013] At present, liposome-delivered siRNA drugs have been clinically approved in the field of lipid metabolism, such as Novartis's Inksilan sodium injection, which is a siRNA drug that effectively reduces the body's low-density lipoprotein cholesterol (LDL-C) level by targeting and inhibiting PCSK9 protein, becoming the first small interfering RNA (siRNA) drug to be marketed in China. However, there are only a handful of siRNA drugs marketed in the field of lipid metabolism using liposome delivery technology, especially in the field of ACC-targeted liposome siRNA delivery and disease treatment, which has not yet been achieved. This shows that there is still a lot of room for development in the research and development and application of siRNA drugs in the field of lipid metabolism.

[0014] At present, liposome siRNA delivery and disease treatment based on acetyl-CoA carboxylase (ACC) targeting has not yet been achieved. This is because it faces many challenges. On the one hand, to achieve precise silencing of the specific target gene ACC, it is necessary to optimize the design and delivery strategy of liposomes to ensure that siRNA can be effectively delivered to the target cells and exert its effect; on the other hand, the pathological mechanism of ACC-related diseases requires more in-depth research to clarify the best time and method of siRNA intervention. However, with the continuous advancement of technology and the deepening of the understanding of the disease, it is expected that breakthroughs will be made in ACC-targeted liposome siRNA delivery and disease treatment in the future, bringing new hope for the treatment of related diseases. (III) Summary of the invention

[0015] The purpose of the present invention is to provide a siRNA nanoliposome and its use in the preparation of a drug for treating non-alcoholic fatty liver disease. The siRNA nanoliposome targeting acetyl-CoA carboxylase obtained by screening can specifically silence the ACC gene, reduce off-target effects, have a lasting therapeutic effect, reduce immunogenicity, have significant long-term effect and compliance, can improve treatment efficiency and reduce toxic side effects.

[0016] The technical solution adopted by the present invention is:

[0017] The present invention provides a siRNA nanoliposome, wherein the siRNA nanoliposome is prepared according to the following method:

[0018] (1) Lipid-ethanol solution: dissolve lipid DLin-MC3-DMA, phosphorylcholine DSPC, plant-derived cholesterol, and DMG-PEG2000 in ethanol to prepare a lipid-ethanol solution;

[0019] (2) siRNA-citric acid buffer: siRNA is added to 50 mM, pH=4 citric acid buffer to prepare siRNA-citric acid buffer; the siRNA targets acetyl-CoA carboxylase;

[0020] (3) siRNA nanoliposomes: The lipid-ethanol solution in step (1) and the siRNA-citrate buffer in step (2) were filtered through a 0.22 μm filter membrane, respectively, and liposome nanoparticles encapsulating siRNA were prepared by a microfluidic mixing method, which was denoted as LNP@siACC.

[0021] Furthermore, in step (1), the molar ratio of lipid DLin-MC3-DMA, phosphorylcholine DSPC, plant-derived cholesterol, and DMG-PEG2000 is 50:10:1.5:38.5. The total concentration of solutes in the lipid-ethanol solution is 10-20 mM, preferably 12 mM.

[0022] Furthermore, the sense strand of the siRNA in step (2) is: GAGUCAAGUAUGUACUUAATT (SEQ ID NO. 1); and the antisense strand is: UUAAGUACAUACUUGACUCTT (SEQ ID NO. 2).

[0023] Furthermore, in step (2), the citric acid buffer solution is prepared as follows: 50 mL of 100 mM citric acid solution and 50 mL of sodium citrate solution are prepared using ultrapure water; 33.0 mL of citric acid solution and 17.0 mL of sodium citrate solution are taken, mixed, and sterile enzyme-free water (DEPC water) is added to make up the final volume to 50 mL to obtain a 50 mM citric acid buffer solution with a pH of 4.

[0024] Furthermore, in step (2), the final concentration of siRNA in the siRNA-citrate buffer is 0.1-1 μg / μL, preferably 0.108 μg / μL.

[0025] Furthermore, in step (3), the flow rate ratio of the lipid-ethanol solution to the siRNA-citrate buffer solution is 1:3.

[0026] Furthermore, the method for preparing liposome nanoparticles encapsulating siRNA by microfluidic mixing in step (3) is as follows: the filtered lipid-ethanol solution and siRNA-citric acid buffer are respectively introduced into a micromixer at flow rates of 0.6 mL / min and 1.8 mL / min, the mixed effluent is ultrafiltered and centrifuged, and the precipitate is collected to obtain the liposome nanoparticles encapsulating siRNA. The amount of the lipid-ethanol solution is calculated based on the molar amount of lipid, the amount of the siRNA-citric acid buffer is calculated based on the molar amount of siRNA, and the molar ratio of lipid to siRNA is 6:1.

[0027] The present invention also provides an application of the siRNA nanoliposome in preparing an acetyl-CoA carboxylase inhibitor.

[0028] The present invention also provides an application of siRNA nanoliposomes in the preparation of a drug for treating non-alcoholic fatty liver disease. The drug can target intracellular acetyl-CoA carboxylase, inhibit the expression of acetyl-CoA carboxylase, and reduce lipid synthesis, TG, and TC content.

[0029] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0030] (1) The siRNA screened by the present invention can target intracellular acetyl-CoA carboxylase, inhibit the expression of acetyl-CoA carboxylase, and reduce the content of TG and TC.

[0031] (2) The siRNA nanoliposomes prepared by the present invention have little toxicity and side effects and good stability.

[0032] The siRNA nanoliposome prepared by the present invention is mainly composed of phospholipids and cholesterol and other components. In the body, phospholipids can be decomposed into fatty acids, lysophospholipids and other products by phospholipases, and these products can be absorbed to provide energy or participate in cell membrane synthesis; cholesterol can be metabolized into bile acid in the liver, and can also be taken up by cells to maintain normal physiological functions or synthesize steroid hormones, so the components of liposomes can be metabolized in the body, avoiding the toxic side effects of small molecule inhibitors; before the siRNA nanoliposome prepared by the present invention contacts the cell membrane, it can maintain a relatively complete form and a certain physical stability in an environment such as an aqueous solution by virtue of the vesicle structure of the phospholipid bilayer and the regulating effect of cholesterol on membrane fluidity, thereby protecting the encapsulated siRNA from being degraded.

[0033] (3) The siRNA nanoliposome preparation process of the present invention is efficient and reproducible, and can achieve continuous and automated production.

[0034] The present invention adopts a microfluidic method to prepare siRNA nanoliposomes, which can accurately control the size, morphology and lipid composition of the liposomes, have good monodispersity, and the preparation process is efficient and reproducible, and can achieve continuous and automated production. The microfluidic equipment and its chip are from Suzhou Zhongxin Qiheng Scientific Instrument Co., Ltd. The instrument is Zhongxin Qiheng Cchippump-02 dual-channel split injection pump, and the chip is Zhongxin Qiheng micro-mixed liposome chip ZX-LS-31

[0035] (4) The siRNA nanoliposomes of the present invention can specifically silence intracellular acetyl-CoA carboxylase, reduce off-target effects, have long-lasting efficacy, reduce immunogenicity, and have significant long-term efficacy and compliance, thereby improving treatment efficiency and reducing toxic side effects.

[0036] The siRNA nanoliposomes of the present invention are incubated with HepG2 cells in vitro, which can significantly inhibit the growth of intracellular lipid droplets. NAFLD is characterized by changes in lipid droplet content in in vitro experiments, so it is believed that the drug can play a role in alleviating NAFLD. Compared with the small molecule inhibitors, traditional Chinese medicine and other drugs currently used in clinical practice, the present invention highlights the advantage of efficient inhibition. (IV) Description of the drawings

[0037] Figure 1 , Zeta potential diagram of LNP@siNC.

[0038] Figure 2 , particle size distribution of LNP@siNC.

[0039] Figure 3 , nucleic acid release curves of LNP@siNC changing with time in different pH environments.

[0040] Figure 4 , the change curves of particle size and potential of LNP@siNC under storage at different temperatures; A and C represent the changes of particle size and potential under freeze-drying conditions; B and D represent the changes of particle size and potential at 25, 4, -20, and -80℃.

[0041] Figure 5 , Confocal micrographs of LNP@siNC uptake by HepG2 cells at different incubation times.

[0042] Figure 6 , Bar graphs of ACC mRNA (A) and FASN mRNA expression levels (B) after HepG2 cells were incubated with LNP@siRNA of different sequences.

[0043] Figure 7 , Bar graphs of ACC mRNA (A) and FASN mRNA expression levels (B) after HepG2 cells were incubated with different concentrations of LNP@siACC2.

[0044] Figure 8 , Western blot image (A) and bar graph of ACC protein expression (B) after HepG2 cells were incubated with different concentrations of LNP@siACC2.

[0045] Fig. 9 , Western blot image (A) and ACC / GAPDH content ratio curve (B) after HepG2 cells were incubated with 50nM concentration of LNP@siACC2 for different times.

[0046] Fig.10 , Confocal microscopy images of HepG2 cells after incubation with different concentrations of LNP@siACC2.

[0047] Fig.11 , Oil Red staining micrographs of HepG2 cells after incubation with different concentrations of LNP@siACC2 and bar graph of relative content of red oil.

[0048] Fig.12 , bar graphs of TG (A) and TC (B) contents of HepG2 cells after incubation with different concentrations of LNP@siACC2. (V) Specific implementation methods

[0049] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0050] The materials for preparing lipid nanoparticles in the present invention were purchased from Yuanye Biotechnology; the chemical name of DLin-MC3-DMA is 4-(N,N-dimethylamino)butyric acid (dilinoleyl) methyl ester, and the molecular formula is: 43 H 79 NO 2，， CAS No.: 1224606-06-7; DSPC chemical name is distearoylphosphatidylcholine, molecular formula C 44 H 88 NO8P, CAS No.: 816-94-4;, molecular formula C 27 H 46 O, CAS No.: 57-88-5; DMG-PEG2000 chemical name 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol 2000, molecular formula: C 122 H 242 O 50， CAS number: 160743-62-4.

[0051] Example 1. Design of siRNA

[0052] In order to ensure the reliability of the experimental results and exclude the chance of siRNA knockdown, we designed three siRNAs to find the most effective siRNA. The design principles of siRNA are as follows: 1. The design of siRNA targets specific regions, which are often found in the 3' untranslated region (3'UTR) and the coding region (CDS). The 3'UTR region is often rich in siRNA recognition sequences and is not prone to repetition or excessive secondary structures. The 3'UTR region is often rich in siRNA recognition sequences and is not prone to repetition or excessive secondary structures; 2. Ensure that the targeting sequence does not contain common SNP sites; 3. The ideal siRNA sequence should have a GC content of 40%-60%; 4. The selected siRNA sequence should be as specific as possible to the target gene. We can use the BLAST tool to check the specificity of the siRNA sequence; 5. Avoid using regions with repetitive sequences, which may cause nonspecific silencing or induce immune responses. Based on this, the three designed siRNAs are recorded as siACC1, siACC2, and siACC3, and non-target siRNA is designed as a negative control, recorded as NCRNA. siRNA can silence target genes to varying degrees, while ncRNA does not have silencing function.

[0053] siACC1

[0054] Sense strand: CCCUCCGAGAAGAGAAUAATT (SEQ ID NO. 3);

[0055] Antisense strand: UUAUUCUCUUCUCGGAGGGTT (SEQ ID NO. 4).

[0056] siACC2

[0057] Sense chain: GAGUCAAGUAUGUACUUAATT (SEQ ID NO. 1);

[0058] Antisense strand: UUAAGUACAUACUUGACUCTT (SEQ ID NO. 2).

[0059] siACC3

[0060] Sense strand: GGGCUUAUAUUGCCUAUGATT (SEQ ID NO. 5);

[0061] Antisense strand: UCAUAGGCAAUAUAAGCCCTT (SEQ ID NO. 6).

[0062] NCRNA

[0063] Sense strand: UUUGUGCAAUCCUUUCUCUCCU (SEQ ID NO. 7);

[0064] Antisense strand: AGAAGAAAG GAUUUGGCUACAAA (SEQ ID NO. 8).

[0065] Example 2: Preparation of siRNA-encapsulated nanoliposomes

[0066] (1) Lipid-ethanol solution

[0067] DLin-MC3-DMA, DSPC, plant-derived cholesterol, and DMG-PEG2000 were dissolved in ethanol at a molar ratio of 50:10:38.5:1.5 to prepare a lipid-ethanol solution with a solute concentration of 12 mM (about 7.5 mg / mL), which was filtered before use.

[0068] (2) siRNA-citrate buffer

[0069] Use ultrapure water to prepare 50 mL of 100 mM citric acid solution and sodium citrate solution respectively. Take 33.0 mL of citric acid solution and 17.0 mL of sodium citrate solution, mix them and add sterile enzyme-free water (DEPC water) to make up to a final volume of 50 mL. After standing at room temperature for 30 minutes, sterilize by high pressure to remove DEPC. After sterilization, use DEPC water to make up to 100 mL to obtain 50 mM citric acid buffer solution with pH = 4.

[0070] The siRNA1, siRNA2, siRNA3, and NCRNA synthesized in Example 1 were added to 50 mM, pH=4 citric acid buffer to prepare 0.108 μg / μL siRNA-citric acid buffer.

[0071] (3) Liposome nanoparticles encapsulating siRNA

[0072] The lipid-ethanol solution in step (1) was filtered through a 0.22 μm filter membrane, 0.8 mL of the filtrate was drawn into a 1 mL syringe, and the air in the syringe was expelled to prepare the lipid-ethanol solution sample.

[0073] The RNA-citrate buffer in step (2) was filtered through a 0.22 μm filter membrane, 2.4 mL was drawn with a 3 mL syringe, and the air in the syringe was expelled to prepare the RNA-citrate buffer sample.

[0074] The lipid-ethanol solution sample was passed into the micromixer at a flow rate of 0.6 mL / min, and the RNA-citrate buffer sample was passed into the micromixer at a flow rate of 1.8 mL / min (the total phospholipid concentration and siRNA were in accordance with the ratio of N:P=6:1). As the lipid solution and the aqueous phase solution were mixed and emulsified, the lipid molecules spontaneously formed a double-layer membrane structure at the aqueous phase interface, encapsulating the aqueous phase to form liposomes. The effluent was collected and ultrafiltered using a Milipore30KD ultrafiltration tube. The filtrate was centrifuged at 3000g for 20 minutes to remove impurities such as unencapsulated drugs and organic solvents. The precipitate was pure liposome nanoparticles encapsulating siRNA, which were recorded as LNP@siACC1, LNP@siACC2, LNP@siACC3, and LNP@siNC, respectively.

[0075] Example 3: Measurement of particle size, potential, and encapsulation efficiency of siRNA-encapsulated liposome nanoparticles

[0076] For cost-saving considerations, before the silencing effect was verified, LNP@siNC was uniformly used to measure the particle size, potential, and encapsulation efficiency to evaluate the siRNA-encapsulated liposome nanoparticles prepared in Example 2.

[0077] 1. Zeta potential and particle size

[0078] 1 mL, 1 μM LNP@siNC prepared in Example 2 was dispersed in 1 mL of ultrapure water to ensure that the particles remained stable during the measurement process, and added to the sample pool of a dynamic light scattering instrument (from Malvern Panalytical brand, model ZS30), taking care to avoid bubbles and ensure that the sample was evenly distributed, and the sample pool was placed in the measurement position of the dynamic light scattering instrument. After the instrument was stabilized, the particle size and zeta potential were measured to provide key data for evaluating the physical properties and stability of liposomes and their performance in applications such as drug delivery. The specific parameters of the instrument are as follows: the measurement temperature is 25°C, the dispersion medium is water, the Dispersant RI is 1.330, the Viscosity (cP) is 0.8872, and the Measurement Position (mm) is 4.65. Three groups were measured in parallel to ensure the reliability of the data.

[0079] Zeta potential Figure 1 As shown, the particle size Figure 2 As shown, the average zeta potential of LNP@siNC is -0.213 mV, and the average particle size is 218 nm, which meets the requirements of liposomes (potential size is 0±40 mV, particle size is 30-300 nm).

[0080] 2. Encapsulation rate

[0081] The liposome encapsulation efficiency was measured by fluorescent dye detection using Quant-iT TM RNA kit is used for detection. The QuantiT TM Reagen is an ultra-sensitive fluorescent nucleic acid dye that can detect 1-200ng of nucleic acid in solution. This nucleic acid dye cannot penetrate LNP, so only free nucleic acid not encapsulated by LNP can be bound. Triton-100 is often used as a demulsifier as a surfactant. LNP-siNC obtained by treating with 1% Triton-100 can release the encapsulated nucleic acid and obtain the total nucleic acid amount. The encapsulation rate can be obtained by calculating the difference in the amount of nucleic acid before and after demulsification and dividing it by the total amount of nucleic acid.

[0082] Nucleic acid standard curve: According to the kit instructions, dilute 20×TE with DEPC water to 1×TE; dilute Quant-iT TM The RNA standard in the RNA kit was diluted to two final concentrations: 2 μg / mL and 100 ng / mL. The QuantiT TM Reagen was diluted to 200-fold and 2000-fold final concentrations; standard curves containing / not containing Triton-100 were prepared at the same time. Reagents were added to CellCarrier-96UltraMicroplates according to Tables 1 and 2, and the fluorescence intensity was read using Synergy H1 Microplate Reader Biotek (multi-function microplate reader for short), with the excitation light set to 480nm and the emission light set to 520nm. The standard curve was drawn with RNA concentration as the horizontal axis and absorbance as the vertical axis.

[0083] Table 1

[0084]

[0085] Table 2

[0086]

[0087] Liposome encapsulation efficiency detection:

[0088] LNP demulsification: Triton-100 was diluted to 2% with 1×TE, 100 μL was added to CellCarrier-96 UltraMicroplates, and then 1 μL of LNP-siNC prepared in Example 1 was added, treated for 5 minutes, and 100 μL of 200-folddilutedquant-iTRiboGreen Reagent was added.

[0089] LNP free nucleic acid determination: Add 100 μL 1×TE to CellCarrier-96Ultra Microplates, take 1 μL of the prepared LNP demulsification solution and add it, mix well, add 100 μL 12000-fold diluted quant-iTRiboGreen Reagent, use Synergy H1 Microplate Reader Biotek (referred to as multifunctional microplate reader) to read the fluorescence intensity, set the excitation light to 480 nm, and the emission light to 520 nm. According to the standard curve, the encapsulation efficiency of the prepared siRNA-encapsulated liposome nanoparticles was calculated to be 82.09%.

[0090] Example 4: Release of siRNA from liposome nanoparticles encapsulating siRNA at different pH values

[0091] 1. PBS, pH 7.0

[0092] A sterile centrifuge tube was used as a release container. 1 mL, 1 μM LNP@siNC prepared according to the method of Example 2 and 1 mL of pH 7.0 PBS were added to simulate the physiological environment of pH 7.0. The pH value was maintained with hydrochloric acid or sodium hydroxide. 100 μL of sample was taken at 0 h, 0.5 h, 1 h, 2 h, 4 h, 8 h, 12 h, and 24 h, and 5 sets of parallel samples were set at each time point. The samples were added to CellCarrier-96Ultra Microplates, and the free nucleic acid content was detected by the method of Example 3. The curve of the nucleic acid release amount over time was plotted. The results are shown in Figure 3 shown.

[0093] 2. PBS, pH 5.0

[0094] The pH 7.0 in step 1 was changed to pH 5.0 PBS, and the other operations were the same.

[0095] Nucleic acid release curve Figure 3As time goes by, the release of LNP@siNC in pH 7.0 and pH 5.0 buffers gradually increases. The release at pH 7.0 increases from 0.56% of the total nucleic acid in the first 0.5h to 9.24% in the final 24h; the release at pH 5.0 increases from 0.72% of the total nucleic acid in the first 0.5h to 17.36% in the final 24h. Although their release increases gradually, it is still a small amount compared to the release of liposomes internalized by the cell membrane.

[0096] A small amount of nucleic acid was released under physiological conditions (pH 7.0) and slightly acidic conditions (pH 5.0), indicating that the bilayer structure of liposomes can effectively maintain integrity under these conditions. This provides an important advantage for liposomes as drug carriers, namely, they can effectively transport drugs to the target site in cells. Before fusion with the cell membrane, liposomes can protect drugs from being released prematurely, reduce drug loss in non-target sites, and thus improve drug delivery efficiency.

[0097] Example 5. Stability of siRNA-encapsulated liposome nanoparticles

[0098] 1 mL, 1 μM LNP@siNC prepared according to the method of Example 2 was dispersed in 1 mL of PBS at pH 7.0, divided into 5 groups, and placed under different temperature conditions (-80°C, -20°C, 4°C, 25°C, freeze-dried), where freeze-drying refers to the use of a vacuum freeze dryer (Kewanda ZLGJ-18), and each group was sampled on the 1st day, 2nd day, 3rd day, 4th day, 5th day, and 6th day. After the sample was taken out, it was necessary to stand at room temperature for 15 minutes to allow the sample to adapt to the external environment to avoid the influence of rapid temperature changes on the measurement results. The particle size and zeta potential were tested by the method of Example 3, and the curves of particle size and potential changes over time were drawn with time as the horizontal coordinate and particle size and potential as the vertical coordinates, and the attenuation of particle size and zeta potential at different temperatures was analyzed.

[0099] like Figure 4 As shown, it can be seen that the particle size and potential of LNP@siNC at -80°C remain basically unchanged. The higher the temperature, the smaller the particle size of the liposomes and the larger the charge fluctuation. Therefore, it is believed that low temperature conditions (such as -80°C and -20°C) are usually beneficial to maintaining the stability of liposomes, because low temperature can slow down the aggregation and fusion of liposomes and reduce drug leakage. Higher temperatures (such as 25°C) may accelerate the degradation and drug leakage of liposomes, affecting their stability. By comprehensively considering the changes in particle size and potential at different temperatures, the most stable storage conditions for liposomes are determined: short-term storage can be stored at -20° to avoid repeated freezing and thawing. For long-term storage, freeze-drying is recommended to maintain the encapsulation effect to the greatest extent.

[0100] Example 6: Confocal microscopy observation of HepG2 cells' uptake of siRNA-encapsulated liposome nanoparticles

[0101] 1. LNP@siNC complex labeled with CY3 fluorescent tag

[0102] NCRNA was labeled with CY3 fluorescent label, which is a commonly used fluorescent dye with good fluorescence properties and photostability. They were complexed with specific groups on siRNA to form CY3-labeled siRNA, which was recorded as LNP@siNC-CY3.

[0103] 2. Uptake of LNP@siNC by HepG2 cells

[0104] HepG2 cells in the logarithmic growth phase were taken and the cells were plated at an appropriate density (1×10 4 ) were inoculated into a confocal glass-bottomed cell culture dish with DMEM high-glucose culture medium (purchased from Zhejiang Senrui Biotechnology Co., Ltd., item number CR-12800, hereinafter referred to as DMEM culture medium). The confocal cell culture dish was then placed in a cell culture incubator and cultured for 12 hours at 37°C and 5% CO2 to allow the cells to adhere to the wall and grow to a suitable density. The old culture medium in the culture dish was discarded, and 1 mL of DMEM culture medium containing 50 nM LNP@siNC-CY3 was added. The cell culture dish was then returned to the cell culture incubator and samples were taken at different time points (0.5 h, 4 h, 12 h, and 24 h). The cells were gently washed three times with PBS (pH 7.0) preheated at 37°C to remove the unabsorbed complexes. 4% PFA (4% paraformaldehyde solution) was added and the cells were fixed at room temperature for 15-20 minutes. During the fixation process, it was ensured that the 4% PFA completely covered the cells. The 4% PFA was aspirated and the cells were washed three times with PBS for 5 minutes each to remove the residual PFA. Add DAPI staining solution to stain the cell nucleus, and stain for 10 minutes at 25°C. The working concentration of DAPI is determined according to the product manual, generally 1-5μg / mL. Aspirate the DAPI staining solution, wash the cells three times with PBS, 5 minutes each time, then add an appropriate amount of PBS to keep the cells moist, and observe with a Leica laser scanning confocal microscope, setting the excitation wavelength at 550nm and the emission wavelength at 570nm.

[0105] The results are as follows Figure 5As time goes by, the red color of CY3 labeling gradually increases. Compared with the control group (not transfected with LNP@siRNA), the experimental group (transfected with LNP@siRNA) is basically taken up by all cells in the field of view at 24 hours, which is specifically manifested as red surrounding the blue cell nucleus labeled with DAPI. The above experimental results prove that the delivered liposome LNP@siNC is almost completely taken up by HepG2 cells within 24 hours.

[0106] Example 7: Effect of siRNA sequence on ACC knockout

[0107] HepG2 cells were cultured at 5×10 4 The cells were inoculated at a density of 10 cells / well in a 12-well plate supplemented with 1 mL of DMEM medium and cultured in an incubator at 37°C and 5% CO2 for 12 hours. When the cells grew to a density of 60-70%, five groups were set up: untreated control group (Control), experimental group 1 (LNP@siACC1), experimental group 2 (LNP@siACC2), experimental group 3 (LNP@siACC3) and negative control group (LNP@siNC). Three replicates were set up for each group.

[0108] The three experimental groups were respectively added with 1 mL of DMEM medium containing LNP@siACC1, LNP@siACC2, and LNP@siACC 3 prepared according to the method of Example 2 at a final concentration of 100 nM. The negative control group was added with 1 mL of DMEM medium containing LNP@siNC at a final concentration of 100 nM.

[0109] After culturing each group of culture plates in an incubator at 37°C and 5% CO2 for 24 hours, the cells in each group were collected and total RNA was extracted using an RNA extraction kit to ensure the purity and integrity of the RNA. TM The extracted total RNA was reverse transcribed into cDNA using the PCR amplification kit (from Biotime Biotechnology Co., Ltd., catalog number D7168S). GAPDH was used as the endogenous gene, and primers for detecting ACC mRNA, FASN mRNA and GAPDH were used to detect the Ct values ​​of ACC mRNA, FASN mRNA, the downstream gene of ACC, and endogenous gene GAPDH in each group by RT-qPCR.

[0110] RT-qPCR reaction system: HRbio TMqPCR SYBR Green Master Mix 5μL, Forward Primer 0.2μL, Reverse Primer 0.2μL, template DNA 2μL (product from Fujian Herui Biotechnology Co., Ltd., product number HRF0051), and then add sterile and enzyme-free water to 10μL.

[0111] RT-qPCR detection procedure: Pre-denaturation condition is 95℃ for 5 minutes to fully denature the template DNA and activate the Taq enzyme. Denaturation condition is 95℃ for 10-30 seconds to melt the double-stranded DNA into single strands. Annealing condition is 55℃-60℃ for 20 seconds to allow the primer to specifically bind to the template. Extension condition is 72℃ for 20 seconds, at which temperature the Taq enzyme synthesizes a new DNA chain using dNTPs as raw materials. The three steps of denaturation, annealing and extension are one cycle, and 40 cycles are performed.

[0112] Primers for ACC mRNA detection:

[0113] Forward 5'-GCAAAGACCATTAGAGGTAGCC-3'

[0114] Reverse 5'-TTGCTGTAGAAACCCGAACC-3'.

[0115] Primers for FASN mRNA detection:

[0116] Forward 5'-TACGATGGTCACCCTCAATG-3'

[0117] Reverse 5'-TGCTGCCGTGTCCTTCTACT-3'.

[0118] Primers for GAPDH detection:

[0119] Forward 5'-GCAAATTCCATGGCACCGT-3'

[0120] Reverse 5'-GCAAATTCCATGGCACCGT-3'

[0121] The relative gene expression changes were determined by the ΔΔCT method, and the ACC gene expression levels in the experimental group and the control group were compared. The mean values ​​of each group were taken, and the results are shown in Figure 6 shown.

[0122] ΔCt=Ct(target gene)-Ct(reference gene)

[0123] ΔΔCt=ΔCt(experimental group)-ΔCt(control group)

[0124] Figure 6 It can be seen that at the mRNA level, LNP@siACC1 knocked down ACC in cells by 39.07% and FASN by 28.76%. LNP@siACC2 knocked down ACC in cells by 65.33% and FASN by 59.33%. LNP@siACC3 knocked down ACC in cells by 47.12% and FASN by 30.7%. It was proved that among the three siRNAs we designed, siRNA2 had the best effect in knocking down the adipogenesis-related gene ACC and the downstream FASN gene, so we used siRNA2 as the default sequence for subsequent experiments.

[0125] Example 8: Effect of LNP@siACC2 concentration on knockdown of target gene ACC and downstream gene FASN

[0126] HepG2 cells were cultured at 5×10 4 The cells were inoculated at a density of 10 cells / well in a 12-well plate supplemented with 1 mL of DMEM medium and cultured in an incubator at 37°C and 5% CO2 for 12 hours. When the cells grew to a density of 60-70%, the original medium was discarded and 5 groups were set up: untreated control group (Control), 25nM experimental group, 50nM experimental group, 100nM experimental group and negative control group (NC). Three replicates were set up for each group.

[0127] The untreated control group was added with 1 mL of DMEM medium, and the experimental groups were added with 1 mL of DMEM medium containing LNP@siACC2 prepared according to the method of Example 2 at a final concentration of 25, 50, and 100 nM. The negative control group was added with 1 mL of DMEM medium containing LNP@siNC prepared according to the method of Example 2 at a final concentration of 100 nM. The Ct value detection method of each group was the same as that of Example 7.

[0128] Figure 7 It can be seen that at 25nM, intracellular ACC was knocked down by 56.38% at the mRNA level, at 50nM, intracellular ACC was knocked down by 68.45%, and at 100nM, intracellular ACC was knocked down by 77.49%. FASN, a downstream gene of ACC, was knocked down by 38.91% at the mRNA level at 25nM, 46.24% at 50nM, and 38.57% at 100nM. It is proved that LNP@siACC2 prepared in Example 2 successfully knocked down ACC and its downstream FASN genes, and the effect of inhibiting lipogenesis-related genes by knocking down the ACC gene was significant.

[0129] Example 9: Western blotting to observe the inhibitory effect of LNP@siACC2 on lipid deposition

[0130] In order to further clarify the effect of LNP@siACC2 on lipid synthesis induced by DMEM medium containing 1mM free fatty acids (FFA medium for short), we detected the expression of related proteins in HepG2 cells. In the study of in vitro NAFLD (non-alcoholic fatty liver disease) models, we often use FFA (free fatty acid) medium to simulate the disease type. Palmitic acid (PA) and oleic acid (OA) were selected for combined induction to mimic the mixed state of fatty acids in the human body. They can induce fat accumulation in hepatocytes and simulate the occurrence and progression of NAFLD. That is, HepG2 cells were cultured in the presence of 1mM free fatty acids (FFA, containing oleic acid and palmitic acid, with a volume ratio of 2:1) and then used for the specified assay. FFA medium refers to DMEM medium containing 1mM free fatty acids.

[0131] HepG2 cells were cultured at 5×10 4 The cells were inoculated at a density of 10 cells / well in a 12-well plate with 1 mL of DMEM medium, and cultured at 37°C, 5% CO2 for 12 hours. When the cells grew to a density of 60-70%, the well plate was set up into 5 groups: untreated control group (Control), 25 nM experimental group, 50 nM experimental group, 100 nM experimental group and negative control group (NC). Three replicates were set up for each group.

[0132] The old DMEM medium was discarded from each group of culture wells, 1 mL of FFA medium was added to the untreated control group, and 1 mL of FFA medium containing LNP@siACC2 prepared by the method of Example 2 was added to the experimental groups, so that the final concentrations of LNP@siACC2 were 25 nM, 50 nM, and 100 nM, respectively. 1 mL of FFA medium containing LNP@siNC prepared by the method of Example 2 was added to the negative control group, so that the final concentration of LNP@siNC was 100 nM.

[0133] Each group of culture plates was cultured in an incubator at 37°C and 5% CO2 for 48 hours.

[0134] Total cellular protein of each sample was extracted using RIPA lysis buffer (Biyuntian Biotechnology Co., Ltd., catalog number P0013B) and quantified using the BCA protein kit (from Sangon Biotechnology Co., Ltd., catalog number C503051-0500). Equal amounts of protein from each group of total cellular protein were separated using 6% SDS-PAGE, then transferred to the membrane at 250 mA for 3 h, and blocked with TBST buffer containing 5% skim milk powder for 2 h. The membrane was then probed with primary antibodies against GAPDH (1:1000) and ACC (1:1000), respectively. The membrane was incubated with the primary antibody at 4°C overnight, washed with TBST, and incubated with the secondary antibody at room temperature for 2 h. The secondary antibodies were mouse secondary antibody-labeled GAPDH (1:1000) and rabbit secondary antibody-labeled ACC (1:1000). Using ChemiDoc TM The protein signal was detected and quantified using the Imaging System (from Bio-Rad Catalog No. 12018025). Figure 8 A and B.

[0135] Figure 8 The results showed that when the concentration of LNP@siACC2 in the experimental group was 25nM, the expression level of ACC protein decreased to 43.16% of the normal level, when the concentration of LNP@siACC2 was 50nM, the expression level of ACC protein decreased to 31.74% of the normal level, and when the concentration of LNP@siACC2 was 100nM, the expression level of ACC protein decreased to 26.79% of the normal level. The above results are basically consistent with the results observed at the mRNA level, indicating that LNP@siACC2 can knock down ACC gene expression, inhibit lipid synthesis, and thus can be used to alleviate and reduce lipid accumulation in hepatocytes.

[0136] Example 10: Western blot observation of the time-effect of LNP@siACC2 on the inhibitory effect on ACC protein level

[0137] Based on the previous experimental results and the experimental cost, we finally selected 50nM LNP@siACC2 to verify the inhibitory effect of siRNA.

[0138] HepG2 cells were cultured at 5×10 4The cells were inoculated at a density of 10 cells / well in a 12-well plate with 1 mL of DMEM medium, and cultured in an incubator at 37°C and 5% CO2 for 12 hours. When the cells grew to a density of 60-70%, the old DMEM medium was discarded, and three groups were set up: an untreated control group (Control), a 50nM experimental group, and a negative control group (NC). Three replicates were added to each group. The untreated control group was added with 1 mL of DMEM medium, and the 50nM experimental group was added with 1 mL of DMEM medium containing LNP@siACC2 prepared according to the method of Example 2 at a final concentration of 50 nM. The negative control group was added with 1 mL of DMEM medium containing LNP@siNC prepared according to the method of Example 2 at a final concentration of 100 nM.

[0139] Each group of culture plates was cultured in an incubator at 37°C and 5% CO2 for 1-8 days. The control and NC groups were sampled on the first day, and the experimental group was sampled every day. Western blotting was performed using the method of Example 8. The results are shown in Table 1. Fig. 9 A, while the experimental group used the method of Example 8 to quantify the protein content, the content ratio of ACC / GAPDH is shown in Fig. 9 Middle B.

[0140] Fig. 9 It can be seen that the expression level of ACC protein did not decrease significantly on the first day of transfection in the experimental group, but dropped sharply on the second day and lasted until the eighth day. The effect was most obvious on the fifth day, when the protein level dropped to 18%, and then began to recover slowly, indicating that LNP@siACC can maintain the gene silencing of ACC for one week.

[0141] Example 11 Confocal Observation of the Inhibitory Effect of LNP@siACC2 on FFA-Induced Lipid Droplets in HepG2 Cells

[0142] HepG2 cells were cultured at 5×10 4 The cells were inoculated at a density of 10 cells / well in a 12-well plate supplemented with 1 mL of DMEM medium. After culturing for 12 hours in an incubator at 37°C and 5% CO2, the cells grew to a density of 60-70%, the old DMEM medium was discarded, and five groups were set up: an untreated control group (Control), a 25 nM experimental group, a 50 nM experimental group, a 100 nM experimental group, and a model group (Model). Three replicates were set up for each group.

[0143] The untreated control group was added with 1 mL of DMEM medium. The experimental groups were respectively added with 1 mL of DMEM medium containing different concentrations of LNP@siACC2, so that the final concentrations of LNP@siACC2 were 25 nM, 50 nM, and 100 nM, respectively. The model group (Model) was added with 1 mL of FFA medium. After each group was cultured for 24 hours, the untreated control group was replaced with 1 mL of fresh DMEM medium, and the 25 nM experimental group, 50 nM experimental group, 100 nM experimental group, and model group were all replaced with 1 mL of FFA medium (same as Example 9) to verify the induction of FFA medium on new lipid droplets after knocking down the ACC gene.

[0144] After culturing each group of culture plates in an incubator at 37°C and 5% CO2 for 24 hours, the original culture medium was discarded, and the Bodipy staining solution in the lipid droplet green fluorescence detection kit (BODIPY 493 / 503) was added to cover the samples, and the samples were stained for 20 minutes in the dark. The Bodipy staining solution was removed, and the samples were washed with PBS 2-3 times and observed directly under a confocal microscope. Fig.10 As shown, the cells in the control group showed weak green fluorescence, indicating that the cells in the control group had a lower fat content, and the cells in the model group showed obvious green fluorescence, indicating that there was a large amount of lipid accumulation in the cells in the model group. Compared with the model group, the experimental group showed green fluorescence of different intensities under the action of LNP@siACC, indicating that lipid droplets were inhibited to varying degrees. LNP@siACC2 knocked down the ACC gene and could effectively inhibit lipid deposition in hepatocytes.

[0145] Example 12: Observation of the inhibitory effect of LNP@siACC2 on lipid deposition by Oil Red staining

[0146] HepG2 cells were cultured at 5×10 4 The cells were inoculated at a density of 10 cells / well in a 12-well plate supplemented with 1 mL of DMEM medium. After culturing for 12 hours in an incubator at 37°C and 5% CO2, the cells grew to a density of 60-70%, the old DMEM medium was discarded, and five groups were set up: untreated control group (Control), 25 nM experimental group, 50 nM experimental group, 100 nM experimental group, and model group (Model). Three replicates were set up for each group.

[0147] The untreated control group was added with 1 mL of DMEM culture medium. The experimental groups were respectively added with 1 mL of DMEM culture medium containing different concentrations of LNP@siACC2, so that the final concentrations of LNP@siACC2 were 25 nM, 50 nM, and 100 nM. The model group (Model) was added with 1 mL of FFA culture medium (same as Example 9). After each group continued to culture for 24 hours, the untreated control group was replaced with 1 mL of fresh DMEM culture medium, and the 25 nM experimental group, 50 nM experimental group, 100 nM experimental group and model group were all replaced with 1 mL of FFA culture medium.

[0148] Oil Red staining was used to verify the effect of FFA medium in inducing lipid deposition in hepatocytes after knockdown of the ACC gene.

[0149] After culturing each group of culture well plates in an incubator at 37°C and 5% CO2 for 24 hours, the original culture medium was discarded, PBS was added for rinsing 3 times, and universal tissue fixative (from Sewell Bio, item number G1101-500ML) was added for fixation for 15 minutes. The fixative was discarded and Oil Red O working solution (purchased from Sigma, item number O0625-25g) was added, and staining was carried out in the dark for 15 minutes. The Oil Red O working solution was discarded, 75% alcohol was used for differentiation for 2 seconds, and tap water was used for 1 minute. Observation was performed under a microscope and photographed. The results are shown in Fig.11 .

[0150] After the photo was taken, the liquid was discarded to minimize the residual liquid. An equal volume of 60% isopropanol aqueous solution was added to each well of the culture plate, and the plate was shaken for 5-10 minutes to fully dissolve the Oil Red O in the cells in the isopropanol solution. A certain volume of Oil Red O solution was aspirated into the 96-well plate, and the 60% isopropanol aqueous solution was used as a blank to adjust the zero. The absorbance value of each well was measured at a wavelength of 520nm, and the Oil Red O content of each well was calculated.

[0151] like Fig.11 As shown in the figure, the cells in the control group were rarely stained with Oil Red O, but the cells in the model group were obviously stained with Oil Red O, and a large amount of Oil Red O dye solution was accumulated, indicating that the cells in the model group contained a large amount of lipid accumulation. Compared with the model group, the degree of Oil Red O staining in the experimental group gradually decreased with the increase of LNP@siACC2 concentration. Quantitative analysis of Oil Red O showed that compared with the control group, the content of Oil Red O in the model group increased by about 2 times, and compared with the model group, the content of Oil Red O in the experimental group decreased significantly, with a significant decrease at 25nM, a decrease of 24.16%, a decrease of 48.19% at 50nM, and a decrease of 55.23% at 100nM. The above experimental results show that knocking down the ACC gene has the effect of improving free fatty acid-induced lipid deposition in hepatocytes.

[0152] Example 13: Determination of intracellular TG and TC content to verify the inhibitory effect of LNP@siACC on lipid deposition

[0153] HepG2 cells were cultured at 5×10 4 The cells were inoculated at a density of 10 cells / well in a 12-well plate supplemented with 1 mL of DMEM medium. After culturing for 12 hours in an incubator at 37°C and 5% CO2, the cells grew to a density of 60-70%, the old DMEM medium was discarded, and 7 groups were set up: untreated control group (Control), 25nM experimental group, 50nM experimental group, 100nM experimental group, model group (Model), and positive control drug group. Three replicates were set up for each group.

[0154] Untreated control group adds 1mL DMEM culture medium. Experimental group adds 1mL DMEM culture medium containing different concentrations of LNP@siACC2 respectively, makes LNP@siACC2 final concentration be 25nM, 50nM, 100nM respectively. Model group (Model) adds 1mL FFA culture medium (same as Example 9). Positive control drug group adds 1mL DMEM culture medium containing final concentration 1.8μM positive drug (positive drug is a known acetyl-CoA carboxylase (ACC) inhibitor, purchased from MCE, CAS No. 591778-68-6). After each group continues to cultivate for 24 hours, untreated control group replaces 1mL fresh DMEM culture medium, and 25nM experimental group, 50nM experimental group, 100nM experimental group, model group and positive control drug group are all replaced with 1mL FFA culture medium.

[0155] After culturing each group of culture well plates in an incubator at 37°C and 5% CO2 for 24 hours, the original culture medium was discarded, PBS was added for rinsing 3 times, the residual liquid was aspirated, and a cell homogenate medium containing 2% Triton X-100 (purchased from Sangon Biotech Co., Ltd., CAS No. 9002-93-1) was added, and ultrasonic dissolution was performed for about half an hour to fully dissolve the intracellular TG. The triglyceride (TG) and total cholesterol (TC) contents in the test samples were determined according to the instructions of the triglyceride kit and the total cholesterol kit, and the protein concentration in the test samples was determined by the BCA method for calibration. Fig.12 Compared with the control group, the TG and TC contents of the model group (FFA modeling) increased by about 1.7 times, which was a significant difference. The positive drug results showed that the 1.8μM positive drug effectively inhibited the increase of TG content induced by FFA, which decreased by 55%, but it was also found that the lower concentration of 50nM LNP@siACC achieved the same effect. That is, after LNP@siACC drug delivery, there was a significant decrease and the TC and TG contents were significantly suppressed with the increase of concentration. The experimental results proved that knocking down the ACC gene would reduce the lipid deposition effect of hepatocytes.

Claims

1. A siRNA nanoliposome, characterized in that: The siRNA nanoliposomes were prepared as follows: (1) Lipid-ethanol solution: dissolve lipid DLin-MC3-DMA, phosphorylcholine DSPC, plant-derived cholesterol, and DMG-PEG2000 in ethanol to prepare a lipid-ethanol solution; (2) siRNA-citric acid buffer: siRNA is added to 50 mM, pH=4 citric acid buffer to prepare siRNA-citric acid buffer; the siRNA targets acetyl-CoA carboxylase; (3) siRNA nanoliposomes: The lipid-ethanol solution in step (1) and the siRNA-citrate buffer in step (2) are filtered through 0.22 μm filter membranes respectively, and liposome nanoparticles encapsulating siRNA are prepared by a microfluidic mixing method.

2. The siRNA nanoliposome according to claim 1, characterized in that In step (1), the molar ratio of lipid DLin-MC3-DMA, phosphorylcholine DSPC, plant-derived cholesterol, and DMG-PEG2000 is 50:10:1.5:38.

5.

3. The siRNA nanoliposome according to claim 2, characterized in that: The total solute concentration in the lipid-ethanol solution of step (1) is 10-20 mM.

4. The siRNA nanoliposome according to claim 1, characterized in that Step (2) The sense strand of siRNA is: GAGUCAAGUAUGUACUUAATT; the antisense strand is: UUAAGUACAUACUUGACUCTT.

5. The siRNA nanoliposome according to claim 1, characterized in that Step (2) The final concentration of siRNA in the siRNA-citrate buffer is 0.1-1 μg / μL.

6. The siRNA nanoliposome according to claim 1, characterized in that: In step (3), the flow rate ratio of the lipid-ethanol solution and the siRNA-citrate buffer solution is 1:

3.

7. The siRNA nanoliposome according to claim 1, characterized in that: The method for preparing liposome nanoparticles encapsulating siRNA by microfluidic mixing in step (3) is as follows: the filtered lipid-ethanol solution and siRNA-citrate buffer are respectively introduced into a micromixer at flow rates of 0.6 mL / min and 1.8 mL / min, the mixed effluent is ultrafiltered and centrifuged, and the precipitate is collected to obtain the liposome nanoparticles encapsulating siRNA.

8. Use of the siRNA nanoliposome according to claim 1 in the preparation of an acetyl-CoA carboxylase inhibitor.

9. Use of the siRNA nanoliposome according to claim 1 in preparing a drug for treating non-alcoholic fatty liver disease.

10. The use according to claim 9, characterized in that The drug can target and inhibit the expression of acetyl-CoA carboxylase in cells.

Images