Application of 2 ''-O-galloyl hyperoside in preparation of anti-fibrosis drugs

Abstract

The invention discloses an application of 2 ''-O-galloyl hyperoside in preparation of an anti-fibrosis drug. The 2 ''-O-galloyl hyperoside in the invention inhibits the up-regulation of the expression of alpha-smooth muscle actin (alpha-SMA) and / or fibronectin of cells in a pulmonary epithelial intercellular transformation model, a skin fibroblast activation model, a hepatic stellate cell activation model and a bleomycin-induced mouse pulmonary fibrosis animal model, and can inhibit the up-regulation of the expression of the alpha-smooth muscle actin (alpha-SMA) and / or fibronectin (fibronectin) of the cells in the pulmonary epithelial intercellular transformation model, the skin fibroblast activation model, the hepatic stellate cell activation model and the bleomycin-induced mouse pulmonary fibrosis animal model. According to the present invention, the transcription of the alpha-smooth muscle actin (ACTA2) gene, the I-type collagen (COl1A1) gene, the fibronectin (FN1) gene and / or the alpha-smooth muscle actin (ACTA2) gene is up-regulated, such that the significant anti-fibrosis effect is represented, and the application can be used for preparing the anti-fibrosis drug.

Description

Technical Field

[0001] The invention belongs to the technical field of anti-fibrosis drugs, and specifically relates to an application of 2″-O-galloyl fusinoside in the preparation of anti-fibrosis drugs. Technical Background

[0002] Fibrosis is the result of abnormal tissue repair, and its main characteristics are the formation of excess fibrous connective tissue and deposition of extracellular matrix, which leads to structural remodeling of organs such as the lungs, liver, intestines and skin. Fibrosis is usually caused by severe or repeated tissue damage. In the early stage, it is mainly characterized by local inflammatory reactions. As the disease progresses, the infiltration and infiltration of immune cells gradually decrease, epithelial cells differentiate into fibroblast-like cells, fibroblasts proliferate abnormally, and the extracellular matrix accumulates excessively, eventually leading to the occurrence of fibrosis. The continuous development of fibrosis will lead to the destruction of tissue structure, organ dysfunction and failure, and even death.

[0003] Since the pathological mechanism of fibrosis is complex and has not yet been fully explored, there are currently very few drugs that can specifically treat fibrotic diseases. In 2014, nintedanib and pirfenidone were launched as drugs for the treatment of idiopathic pulmonary fibrosis, but these two drugs can only slow down the process of fibrosis and cannot reverse fibrosis. As for fibrosis of other organs, there are no drugs on the market that can specifically target the fibrosis process. At present, the commonly used clinical drug treatment regimen is glucocorticoids combined with cytotoxic drugs, hoping to prevent the early fibrosis process through immunosuppression, but the treatment effect is limited and is usually accompanied by side effects such as bone marrow suppression and granulocytopenia or even deficiency. In addition to drug treatment, severe fibrosis is often treated surgically. In recent years, antibodies that specifically target key factors in the fibrosis process are being developed, and mesenchymal stem cell transplantation technology has also been used in the treatment of fibrotic diseases, but the above methods still have problems such as high treatment costs and immature treatment systems. Therefore, the development of new anti-fibrosis drugs has broad application prospects and important social significance.

[0004] Euphorbia helioscopia L. is an annual herbaceous plant of the Euphorbia genus of the Euphorbiaceae family. It tastes pungent and bitter, and is cool in nature. It has the functions of expelling water and reducing swelling, dispersing nodules and killing insects. It is mainly used to treat diseases such as edema, ascites due to liver cirrhosis and bacterial dysentery. At present, diterpenes, triterpenoids, quercetin and 2″-O-galloyl-glucosinolate have been isolated from Euphorbia helioscopia. Among them, 2″-O-galloyl-glucosinolate has also been reported to exist in plants such as persimmon leaves, Euphorbia praecox and red-flowered spatholobi. At present, there are no reports on the use of 2″-O-galloyl-glucosinolate for anti-fibrosis. Summary of the invention

[0005] The present inventors have found that 2″-O-galloyl-glucosidase (structural formula as follows) has an anti-fibrotic effect, and exhibits significant anti-fibrotic effects in a lung epithelial cell-mesenchymal transition model, a human skin fibroblast activation model, a human hepatic stellate cell activation model, and a bleomycin-induced mouse pulmonary fibrosis animal model.

[0006]

[0007] Based on this, the present invention provides the following technical solutions:

[0008] In a first aspect, the present invention provides the use of 2″-O-galloyl-fusinoside in the preparation of anti-fibrosis drugs.

[0009] In a second aspect, the present invention provides a composition comprising 2″-O-galloyl-fusinoside and optionally a pharmaceutically acceptable excipient, and use thereof in the preparation of an anti-fibrosis drug.

[0010] In a third aspect, the present invention provides use of a plant extract comprising 2″-O-galloyl-fusinoside in the preparation of an anti-fibrosis drug.

[0011] Furthermore, the plant may be Rhus chinensis, Diospyros kaki (persimmon leaf), Euphorbia principis, and Glechoma longituba.

[0012] In a fourth aspect, the present invention provides the use of 2″-O-galloylfotoside, a composition comprising 2″-O-galloylfotoside, or a plant extract comprising 2″-O-galloylfotoside in the preparation of a product having one or more of the following effects:

[0013] (a) inhibiting the upregulation of α-smooth muscle actin (α-SMA) and / or fibronectin expression in cells;

[0014] (b) inhibiting the transcriptional upregulation of type I collagen gene (COl1A1), fibronectin gene (FN1) and / or α-smooth muscle actin gene (ACTA2) in cells;

[0015] Furthermore, the up-regulated expression of α-smooth muscle actin (α-SMA) and / or fibronectin, or the transcriptional up-regulation of type I collagen gene (COL1A1), fibronectin gene (FN1) and / or α-smooth muscle actin gene (ACTA2) is induced by TGF-β1 or bleomycin.

[0016] Furthermore, the cells are lung epithelial cells, skin fibroblasts or hepatic stellate cells; further, the skin fibroblasts are human skin fibroblasts, and the hepatic stellate cells are human hepatic stellate cells.

[0017] Furthermore, the product may be a medicine, a reagent, etc.

[0018] The reagents are products used in life science research, clinical diagnosis and medical research. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The figure shows the effect of 2″-O-galloyl-glucosidase on the expression levels of fibroblast markers α-smooth muscle actin (α-SMA) and fibronectin in the TGF-β1-induced lung epithelial-mesenchymal transition model in Example 2. The left figure is the exposure result of the immunoblot analysis of the protein sample, and the right figure is the quantitative statistical figure made after grayscale analysis of the immunoblot results;

[0020] Figure 2 This is a graph showing the effect of 2″-O-galloyl fusinoside on the transcriptional levels of extracellular matrix type I collagen gene (C011A1) and fibronectin gene (FN1) in the TGF-β1-induced lung epithelial cell mesenchymal transition model in Example 2;

[0021] Figure 3 The figure shows the effect of 2″-O-galloyl-glucosidoside on the expression levels of extracellular matrix type I collagen and fibronectin in the TGF-β1-induced human skin fibroblast activation model in Example 3. The left figure is the exposure result of the immunoblot analysis of the protein sample, and the right figure is the quantitative statistical figure made after grayscale analysis of the immunoblot results;

[0022] Figure 4 This is a graph showing the effect of 2″-O-galloyl fusinoside on the transcriptional levels of extracellular matrix type I collagen gene (C011A1) and fibronectin gene (FN1) in the TGF-β1-induced human skin fibroblast activation model in Example 3;

[0023] Figure 5 This is a diagram showing the effect of 2″-O-galloyl-glucosidoside on the expression level of α-smooth muscle actin (a-SMA) in the TGF-β1-induced human hepatic stellate cell activation model in Example 4. The left figure is an exposure result diagram of the protein sample immunoblot analysis, and the right figure is a quantitative statistical diagram made after grayscale analysis of the immunoblot results;

[0024] Figure 6 This is a graph showing the effect of 2″-O-galloyl fusinoside on the transcriptional levels of type I collagen gene (COL1A1) and α-smooth muscle actin gene (ACTA2) in the TGF-β1-induced human hepatic stellate cell activation model in Example 4;

[0025] Figure 7 This is a flow chart of the bleomycin-induced mouse pulmonary fibrosis animal model experiment in Example 5;

[0026] Figure 8 CT images of the lungs of the mice in each group in Example 5;

[0027] Fig. 9 This is a graph showing the effect of 2″-O-galloyl-fondoside on the transcription level of extracellular matrix encoding genes (type I collagen gene (Colla1) and fibronectin gene (Fn1)) in the lungs of mice with bleomycin-induced pulmonary fibrosis in Example 5;

[0028] One-way ANOVA was used to perform statistical analysis on the data. # indicates that P < 0.05 was found between the model group and the normal group, ## indicates that P < 0.01, and ### indicates that P < 0.001; * indicates that P < 0.05 was found between the compound group and the model group, ** indicates that P < 0.01, and *** indicates that P < 0.001. DETAILED DESCRIPTION

[0029] In order to better understand the essence of the present invention, the pharmacological experimental results of 2"-O-galloyl-glucosidoside for treating fibrosis are provided in the form of examples below to illustrate its new use in the pharmaceutical field. At the same time, it must be noted that these examples are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention.

[0030] The following examples take zelacquer as an example, from which 2"-O-galloyl fusinoside is extracted for research, but this does not limit the source of 2"-O-galloyl fusinoside.

[0031] Example 1.2 Preparation of 2-O-galloyl-fosinoside.

[0032] Take the medicinal material of Zeqi (purchased from Shanghai Yanghetang Chinese Medicine Pieces Co., Ltd.), grind it into coarse powder, add 10 times the amount (v / w) of water, reflux and extract for 1 hour, filter the extract, add 8 times the amount (v / w) of water to the residue, reflux and extract for 1 hour, and filter the extract. Combine the two extracts and concentrate to dryness under reduced pressure. Add 1 times the amount (v / w) of water and heat to reflux for 1 hour, and let it stand at room temperature overnight. Filter the precipitate, dissolve it with a small amount of dimethyl sulfoxide, centrifuge at high speed, take the supernatant for C18 reverse phase preparative HPLC separation, 10-50% acetonitrile-water gradient elution, detection wavelength 254nm, collect the 2″-O-galloyl fusinoside chromatographic peak effluent, evaporate to dryness under reduced pressure, and obtain 2″-O-galloyl fusinoside pure product for the following example experiments. Compound 2″-O-galloyl fusinoside 1H-NMR data (deuterated methanol, 600 MHz): 7.64 (1H, d, J = 1.6 Hz), 7.49 (1H, dd, J = 8.5, 1.6 Hz), 7.13 (2H, s), 6.78 (1H, d, J = 8.5 Hz), 6.33 (1H, d, J = 1.4 Hz), 6.16 (1H, d, J = 1.4 Hz), 5.68 (1H, d, J = 7.9 Hz), 5.44 (1H, t, J = 9.9, 7.9 Hz), 3.92 (1H, br d, J = 3.2 Hz), 3.82 (1H, dd, J = 9.9, 3.3 Hz), 3.68 (2H, m), 3.58 (1H, br t, J = 7.9 Hz). ESIMS: m / z 639[M+Na] + , 615[MH] - (Reference: Molecules, 2018, 23, 2167)

[0033] Examples 2 to 5 are provided below to illustrate the effects of 2″-O-galloyl-glucosidase on TGF-β1-induced lung epithelial-mesenchymal transition, activation of skin fibroblasts and hepatic stellate cells, and on the degree of bleomycin-induced lung fibrosis in mice and the transcription level of genes encoding lung extracellular matrix.

[0034] Example 2. Evaluation of the drug activity of 2″-O-galloyl-fusinoside in the TGF-β1-induced lung epithelial cell-mesenchymal transition model

[0035] TGF-β1 can induce the transformation of epithelial cells into fibroblast-like cells and activate fibroblast-like cells to secrete a large amount of extracellular matrix. Therefore, the TGF-β1-induced epithelial-mesenchymal transformation model is one of the commonly used in vitro models in fibrosis research. α-Smooth muscle actin (α-SMA) and fibronectin are both markers of fibroblasts, which are used to characterize the severity of fibrosis.

[0036] (1) The experiment used normal human lung epithelial cells (Beas-2b, purchased from the American Type Culture Collection) and was divided into five groups, including a normal group, a model group, and a 2″-O-galloyl-fondoside-treated group (referred to as the compound group, in which the drug solution was prepared by diluting serum-free DMEM medium, and the drug concentrations were 100 μM, 50 μM, and 25 μM, respectively). Beas-2b cells (2×10 5 Cells were seeded in 12-well plates (10 cells / well). After the cells adhered, they were cultured with serum-free DMEM medium and starved for 12 hours.

[0037] (2) The drug-treated group was pre-incubated with the above-mentioned different concentrations of 2"-O-galloyl-glucosidoside solution for 30 minutes, and the cells in the other groups were added with an equal volume of serum-free DMEM medium. TGF-β1 was diluted with serum-free DMEM medium to a final concentration of 10 ng / mL and added to the corresponding wells of the model group and drug-treated group cells for stimulation for 24 hours to construct the lung epithelial cell-mesenchymal transition model. The normal group cells were added with an equal volume of serum-free DMEM medium.

[0038] (3) Cell samples from each group were collected to study the expression levels of α-smooth muscle actin (α-SMA) and fibronectin. The specific operations included: using SDS solution to lyse the cells, extracting proteins, and quantifying proteins using the BCA method. Protein samples (10 μL / lane) were separated by 7.5% SDS-PAGE gel and then transferred to a nitrocellulose membrane. The membrane was blocked with 5% skim milk at room temperature for 1 hour, incubated with primary antibody at 4°C overnight, and then incubated with secondary antibody at room temperature for 1 hour after washing. Exposure was performed using ECL Prime Western Blotting Detection Reagent. Grayscale analysis was performed using ImageJ software. Results are shown in Figure 1 .

[0039] The above cell samples were taken to study the transcription level of extracellular matrix encoding genes (type I collagen gene (COl1A1) and fibronectin gene (FN1)), and the specific operations included: homogenizing the cells and extracting RNA from the cell samples using RNA simple total RNA extraction kit. The RNA content was detected using Nano Drop spectrophotometer. The RNA was reverse transcribed into cDNA using HifairTM II 1stStrand cDNA Synthesis SuperMix for qPCR kit. A sample-primer-SYBR Green reaction system was prepared, and the extracellular matrix encoding genes (type I collagen gene (COl1A1) (forward primer sequence is GAGGGCCAAGACGAAGACATC (SEQ ID NO: 1), and the reverse primer sequence is CAGATCACGTCATCGCACAAC (SEQ ID NO: 2)) and fibronectin gene (FN1) (forward primer sequence is CGGTGGCTGTCAGTCAAAG (SEQ ID NO: 3), and the reverse primer sequence is AAACCTCGGCTTCCTCCATAA (SEQ ID NO: 4)) were amplified using a qPCR instrument. Relative quantitative analysis was performed using the ΔΔCt value method. The results are shown in FIG. Figure 2 .

[0040] Experimental results:

[0041] like Figure 1 As shown in the figure, compared with the cells in the normal group, the expression levels of α-smooth muscle actin and fibronectin in the cells of the model group were increased, indicating that the cells in the model group were more transformed into fibroblast-like cells. The expression levels of α-smooth muscle actin and fibronectin in the cells of the 2″-O-galloyl succinoside administration group were lower than those in the model group, indicating that 2″-O-galloyl succinoside can inhibit the transformation of lung epithelial cells into fibroblast-like cells.

[0042] like Figure 2 As shown, compared with the cells in the normal group, the transcription levels of the genes encoding type I collagen (COl1A1) and fibronectin (FN1) in the cells of the model group were increased, indicating that the cells in the model group expressed excessive extracellular matrix. Compared with the cells in the model group, the transcription levels of the type I collagen gene (COl1A1) and fibronectin gene (FN1) in the 2″-O-galloyl succinoside-treated group were decreased, indicating that 2″-O-galloyl succinoside can inhibit the transcription of extracellular matrix encoding genes in the TGF-β1-induced lung epithelial cell-mesenchymal transition model.

[0043] Example 3. Evaluation of the drug activity of 2″-O-galloyl-fusinoside on TGF-β1-induced human skin fibroblast activation model

[0044] (1) Human skin fibroblasts (BJ, purchased from the American Type Culture Collection) were used in the experiment and divided into five groups, including a normal group, a model group, and a 2"-O-galloyl-fusinoside-administered group (referred to as the compound group, in which the drug solution was prepared by diluting the DMEM medium containing 0.5% serum, and the drug concentrations were 100 μM, 50 μM, and 25 μM, respectively). BJ cells (2×10 5 Cells were seeded in 12-well plates (10 cells / well). After the cells adhered to the wall, they were cultured with DMEM medium containing 0.5% serum and starved for 24 hours.

[0045] (2) The drug-treated groups were pre-incubated with the above-mentioned different concentrations of 2″-O-galloyl-glucosidoside solution for 30 minutes, and the cells in the other groups were added with an equal volume of DMEM medium containing 0.5% serum. TGF-β1 was diluted with DMEM medium containing 0.5% serum to a final concentration of 25 ng / mL, and added to the corresponding wells of the model group and drug-treated group cells for stimulation for 24 hours to construct a human skin fibroblast activation model. The normal group cells were added with an equal volume of DMEM medium containing 0.5% serum.

[0046] (3) Cell samples from each group were collected to study the expression levels of extracellular matrix type I collagen and fibronectin. The specific operations included: homogenizing the cells, lysing the cells with SDS solution, extracting proteins, and quantifying the proteins using the BCA method. The protein samples (10 μL / lane) were separated by 7.5% SDS-PAGE gel and then transferred to a nitrocellulose membrane. The membrane was blocked with 5% skim milk at room temperature for 1 hour, incubated with the primary antibody at 4°C overnight, and then washed and incubated with the secondary antibody at room temperature for 1 hour. Exposure was performed using ECL Prime Western Blotting Detection Reagent. Grayscale analysis was performed using ImageJ software. The results are shown in Figure 3 .

[0047] The cell samples of each group were taken to study the transcription level of extracellular matrix type I collagen gene (COL1A1) and fibronectin gene (FN1). The specific operations included: RNA simple total RNA extraction kit was used to extract RNA from the cell samples. The RNA content was detected using a Nano Drop spectrophotometer. The RNA was reverse transcribed into cDNA using the HifairTMII 1st Strand cDNASynthesis SuperMix for qPCR kit. A sample-primer-SYBR Green reaction system was prepared, and the coding gene of type I collagen (COL1A1) (forward primer sequence is GAGGGCCAAGACGAAGACATC (SEQ ID NO: 1), and the reverse primer sequence is CAGATCACGTCATCGCACAAC (SEQ ID NO: 2)) and the coding gene of fibronectin (FN1) (forward primer sequence is CGGTGGCTGTCAGTCAAAG (SEQ ID NO: 3), and the reverse primer sequence is AAACCTCGGCTTCCTCCATAA (SEQ ID NO: 4)) were amplified using a qPCR instrument. Relative quantitative analysis was performed using the ΔΔCt value method. The results are shown in FIG. Figure 4 .

[0048] Experimental results:

[0049] like Figure 3As shown in the figure, compared with the cells in the normal group, the expression levels of type I collagen and fibronectin in the cells of the model group were increased, indicating that more fibroblasts in the model group were activated and expressed a large amount of extracellular matrix. Compared with the cells in the model group, the expression levels of type I collagen and fibronectin in the cells of the 2″-O-galloyl-foncilin-treated group were reduced, indicating that the administration of 2″-O-galloyl-foncilin-treated group can inhibit the activation of skin fibroblasts and reduce the expression of type I collagen and fibronectin in the extracellular matrix.

[0050] like Figure 4 As shown in the figure, compared with the cells in the normal group, the transcription levels of type I collagen and fibronectin encoding genes in the model group cells were increased, indicating that the cells in the model group expressed excessive extracellular matrix. Compared with the cells in the model group, the transcription levels of type I collagen and fibronectin in the 2″-O-galloyl succinoside administration group were decreased, indicating that the administration of 2″-O-galloyl succinoside can inhibit the transcription of type I collagen gene (COL1A1) and fibronectin gene (FN1) in the TGF-β1-induced skin fibroblast activation model.

[0051] Example 4. Evaluation of the drug activity of 2″-O-galloyl-fusinoside on TGF-β1-induced human hepatic stellate cell activation model

[0052] (1) The experiment used human hepatic stellate cells (LX-2, purchased from the American Type Culture Collection) and was divided into five groups, including a normal group, a model group, and a 2″-O-galloyl-fosinoside-administered group (referred to as the compound group, in which the drug solution was prepared by diluting the DMEM medium containing 0.5% serum, and the drug concentrations were 100 μM, 50 μM, and 25 μM, respectively). LX-2 cells (5×10 4 Cells were seeded in 12-well plates (10 cells / well). After the cells adhered to the wall, they were cultured with DMEM medium containing 0.5% serum and starved for 12 hours.

[0053] (2) The drug-treated groups were pre-incubated with the above-mentioned different concentrations of 2″-O-galloyl-glucosidoside solution for 30 minutes, and the cells in the other groups were added with an equal volume of DMEM medium containing 0.5% serum. TGF-β1 was diluted with DMEM medium containing 0.5% serum to a final concentration of 5 ng / mL, and added to the corresponding wells of the model group and drug-treated group cells for stimulation for 24 hours to construct a human hepatic stellate cell activation model. The normal group cells were added with an equal volume of DMEM medium containing 0.5% serum.

[0054] (3) Cell samples from each group were collected to study the expression level of α-smooth muscle actin (α-SMA). The specific operations included: homogenizing the cells, lysing the cells with SDS solution, extracting proteins, and quantifying the proteins using the BCA method. The protein samples (10 μL / lane) were separated by 7.5% SDS-PAGE gel and then transferred to a nitrocellulose membrane. The membrane was blocked with 5% skim milk at room temperature for 1 hour, incubated with the primary antibody at 4°C overnight, and then incubated with the secondary antibody at room temperature for 1 hour after washing. Exposure was performed using ECL PrimeWestern Blotting Detection Reagent. Grayscale analysis was performed using ImageJ software. The results are shown in Figure 5 .

[0055] The cell samples of each group were taken to study the transcription level of type I collagen gene (COL1A1) and α-smooth muscle actin gene (ACTA2). The specific operations included: RNA was extracted from the cell samples using RNA simple total RNA extraction kit. The RNA content was detected using Nano Drop spectrophotometer. RNA was reverse transcribed into cDNA using HifairTMII 1st Strand cDNASynthesis SuperMix for qPCR kit. A sample-primer-SYBR Green reaction system was prepared, and type I collagen gene (COL1A1) (forward primer sequence was GAGGGCCAAGACGAAGACATC (SEQ ID NO: 1), and reverse primer sequence was CAGATCACGTCATCGCACAAC (SEQ ID NO: 2)) and α-smooth muscle actin gene (ACTA2) (forward primer sequence was AAAAGACAGCTACGTGGGTGA (SEQ ID NO: 5), and reverse primer sequence was GCCATGTTCTATCGGGTACTTC (SEQ ID NO: 6)) were amplified using a qPCR instrument. Relative quantitative analysis was performed using the ΔΔCt value method. The results are shown in FIG. Figure 6 .

[0056] Experimental results:

[0057] like Figure 5 As shown, compared with the cells in the normal group, the expression level of α-smooth muscle actin in the model group cells increased, indicating that more fibroblasts were activated in the model group. Compared with the cells in the model group, the expression level of α-smooth muscle actin in the 2″-O-galloyl-foncitan-treated group cells decreased, indicating that the administration of 2″-O-galloyl-foncitan-treated group can inhibit the activation of hepatic stellate cells.

[0058] like Figure 6As shown in the figure, compared with the cells in the normal group, the transcription levels of genes encoding type I collagen and α-smooth muscle actin in the cells in the model group were increased, indicating that the cells in the model group were activated into myofibroblasts and expressed excessive extracellular matrix. Compared with the cells in the model group, the transcription levels of the above genes in the 2″-O-galloyl succinoside administration group were decreased, indicating that the administration of 2″-O-galloyl succinoside can inhibit the activation of hepatic stellate cells induced by TGF-β1.

[0059] Example 5. Evaluation of the drug activity of 2″-O-galloyl-fusinoside in the bleomycin-induced mouse pulmonary fibrosis model

[0060] (1) Experimental animals were 8-week-old male C57BL / 6 mice purchased from the Shanghai Experimental Animal Center of the Chinese Academy of Sciences (License No.: 2023-0003). The experimental mice were kept in the SPF animal room of the Shanghai Institute of Materia Medica, Chinese Academy of Sciences. The temperature was controlled at 24±2°C, the relative humidity was controlled at 50±10%, the light-dark cycle was 12 hours, and the feed and drinking water were freely available to the animals. Before the start of the experiment, the experimental animals were adaptively raised in the SPF animal room for at least one week and their health status was monitored every day. The random grouping method was used to group them, model them and administer them according to Table 1. After the mice were anesthetized by intraperitoneal injection of Shutai, they were fixed on the operating table, and bleomycin (0.85 mg / kg) was instilled into the bronchus of the mice to establish a pulmonary fibrosis model.

[0061] (2) The drug administration started on the first day after modeling. The mice in the compound group were intragastrically administered with 100 mg / kg of 2″-O-galloyl-phosphoside, and the mice in the nintedanib (purchased from Beijing Wokai Biotechnology Co., Ltd.) group were intragastrically administered with 60 mg / kg of nintedanib, once a day.

[0062] (3) On day 28, CT was used to image the lungs of mice to characterize the status of pulmonary fibrosis. The results are shown in Figure 8. The mice were euthanized and the lung tissues were collected for homogenization. RNA was extracted from the tissue samples using the RNA simple total RNA extraction kit. The RNA content was detected using a Nano Drop spectrophotometer. RNA was reverse transcribed into cDNA using the HifairTM II 1st Strand cDNA Synthesis SuperMix for qPCR kit. The sample-primer-SYBR Green reaction system was prepared, and the gene encoding type I collagen (Col1a1) (the forward primer sequence was GCTCCTCTTAGGGGCCACT (SEQID NO: 7), and the reverse primer sequence was ATTGGGGACCCTTAGGCCAT (SEQ ID NO: 8)) and the gene encoding fibronectin (Fn1) (the forward primer sequence was ATGTGGACCCCTCCTGATAGT (SEQ ID NO: 9), and the reverse primer sequence was GCCCAGTGATTTCAGCAAAGG (SEQ ID NO: 10)) were amplified using a qPCR instrument. Relative quantitative analysis was performed using the ΔΔCt value method. The results are shown in Figure 2. Fig. 9 .

[0063] Table 1. Grouping and treatment of bleomycin-induced mouse pulmonary fibrosis animal model

[0064]

[0065] Experimental results:

[0066] CT lung imaging results Figure 8 As shown, the color of the lung CT images of mice in the normal group was darker, and the color of the lung CT images of mice in the model group was significantly lighter, indicating that the lung tissue density of mice in the model group increased and pulmonary fibrosis occurred. The color of the lung CT images of mice in the compound group and nintedanib group was significantly darker than that of mice in the model group, indicating that oral administration of 2″-O-galloyl fusinoside and nintedanib can reduce the degree of bleomycin-induced lung fibrosis in mice.

[0067] like Fig. 9 As shown in the figure, compared with the normal group mice, the transcription levels of type I collagen encoding gene (Col1a1) and fibronectin encoding gene (Fn1) in the lung tissue of the model group mice were increased, indicating that the extracellular matrix in the lungs of the model group mice was over-accumulated. Compared with the model group mice, the transcription levels of type I collagen and fibronectin in the lung tissues of the compound group and nintedanib group mice were decreased, indicating that oral administration of 2"-O-galloyl fusinoside can improve the excessive accumulation of extracellular matrix in the lungs.

Claims

Application of 1.2″-O-galloyl-fosinoside in the preparation of anti-fibrosis drugs.

2. Use of a composition comprising 2″-O-galloyl-fosinoside and optionally a pharmaceutically acceptable excipient in the preparation of an anti-fibrosis drug.

3. Use of a plant extract containing 2″-O-galloyl-fusinoside in the preparation of anti-fibrosis drugs.

4. The use according to claim 3, characterized in that: The plants are one or more selected from the group consisting of Rhizoma Cibotii, Diospyros kaki, Euphorbia principis, and Herba Lysimachiae.

5. Use of 2″-O-galloylfotoside, a composition containing 2″-O-galloylfotoside, or a plant extract containing 2″-O-galloylfotoside in the preparation of a product having one or more of the following effects: (a) inhibiting the upregulation of α-smooth muscle actin and / or fibronectin expression in cells; (b) Inhibiting the upregulation of type I collagen gene, fibronectin gene and / or α-smooth muscle actin gene transcription in cells.

6. The use according to claim 5, characterized in that: The up-regulation of α-smooth muscle actin and / or fibronectin expression, or the up-regulation of type I collagen gene, fibronectin gene and / or α-smooth muscle actin gene transcription is induced by TGF-β1 or bleomycin.

7. The use according to claim 5, characterized in that: The cells are lung epithelial cells, skin fibroblasts or hepatic stellate cells.

8. The use according to claim 7, characterized in that: The skin fibroblasts are human skin fibroblasts; and / or the hepatic stellate cells are human hepatic stellate cells.

9. The use according to claim 5, characterized in that: The product is a medicine or a reagent.

Images