Small nucleic acid medicine for treating rheumatoid arthritis

Abstract

The invention discloses a small nucleic acid medicine for treating rheumatoid arthritis, and belongs to the technical field of molecular biomedicine. Experimental research finds that compared with an RA group, after the miR-222-3p antiagomir is injected, the joint swelling degree of rats is obviously relieved, arthritis is effectively controlled, cartilage injury is obviously repaired, cartilage matrix synthetic protein expression is obviously increased, matrix degradation protein-matrix metalloproteinase expression is obviously weakened, bone mass and bone mineral density are obviously increased, and the effect of treating osteoarthritis is obviously improved. The bone injury is obviously recovered, the synovial hyperplasia phenomenon is obviously relieved, the inflammatory cell infiltration is reduced, and the joint synovial structure is also obviously improved. Namely, it is found for the first time that the miR-222-3p inhibitor can obviously improve inflammatory response and cartilage destruction of CIA rat arthritis, and has a remarkable treatment effect on rat rheumatoid arthritis, and the miR-222-3p inhibitor has great significance in research and treatment of bone-related diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biomedicine, and in particular relates to a novel small molecule nucleic acid therapeutic drug for osteoarthritis. Background Art

[0002] Rheumatoid arthritis (RA), also known as rheumatoid, is a chronic, progressive autoimmune disease. It is a systemic immune disease characterized by erosion of articular cartilage, caused by the immune system mistakenly attacking its own tissues, especially the synovium and cartilage of the joints. The lesions can affect all joints containing synovium, with the hands and feet being the most common. Its pathological characteristics are synovial hyperplasia and outward growth. The hyperplastic inflammatory tissue (vascular granuloma) destroys the joints and peri-articular tissues, causing joint deformities and dysfunction. It is reported that the global incidence rate is 1% to 2%, with the peak age of 30 to 50 years old. In my country, the prevalence of RA is about 0.2-0.4%, and many patients are suffering from RA. Therefore, exploring effective treatment methods is an urgent problem to be solved.

[0003] MicroRNA (miRNA) is a class of endogenous small RNAs with a length of about 20-24 nucleotides, which have a variety of important regulatory effects in cells. Studies have found that miRNA regulates one-third of human genes. The location of miRNA is highly conserved in different species. MiRNA is not only conserved in gene location, but also shows a high degree of homology in sequence. The high conservation of miRNA is closely related to the importance of its function. The complex and sophisticated regulatory mechanism of miRNA makes the entire signaling pathway a promising therapeutic drug (usually in the form of miRNA analogs) or a target for drug therapy (usually in the form of antimiRs) in a variety of pathological processes.

[0004] However, the research, development and application of small molecule nucleic acid drugs for the treatment of osteoarthritis are still very limited. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a small nucleic acid drug for the treatment of rheumatoid arthritis. The experimental study of the present invention found that compared with the RA group, after the injection of miR-222-3p antagomir, the degree of joint swelling in rats was significantly reduced, arthritis was effectively controlled, cartilage damage was significantly repaired, cartilage matrix synthesis protein expression was significantly increased, matrix degradation protein-matrix metalloproteinase expression was significantly weakened, bone mass and bone density were significantly increased, bone damage was significantly restored, synovial hyperplasia was significantly reduced, inflammatory cell infiltration was reduced, and joint synovial structure was also significantly improved. That is, the present invention first discovered that miR-222-3p inhibitors can significantly improve the inflammatory response and cartilage destruction of arthritis in CIA rats, and have a significant therapeutic effect on rat rheumatoid arthritis, which is of great significance in the research and treatment of bone-related diseases.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] One of the purposes of the present invention is to provide a use of a miR-222-3p inhibitor / antagonist in the preparation of a drug for alleviating bone inflammation.

[0008] The second purpose of the present invention is to provide an application of a miR-222-3p inhibitor / antagonist in the preparation of osteochondrocyte growth promoting drugs.

[0009] The third object of the present invention is to provide a use of a miR-222-3p inhibitor / antagonist in the preparation of a drug for increasing bone mass and / or bone density.

[0010] A fourth object of the present invention is to provide an application of a miR-222-3p inhibitor / antagonist in the preparation of a drug for improving synovial structure.

[0011] The fifth object of the present invention is to provide a use of a miR-222-3p inhibitor / antagonist in the preparation of arthritis treatment drugs.

[0012] Furthermore, the arthritis includes rheumatoid arthritis.

[0013] The sixth object of the present invention is to provide a small nucleic acid drug, which includes the miR-222-3p inhibitor / antagonist in the application.

[0014] Furthermore, the miR-222-3p inhibitor / antagonist is selected from at least one of miR-222-3p antagomir and miR-222-3p antisense strand.

[0015] Furthermore, the sequence of the miR-222-3p is shown in SEQ ID NO.1.

[0016] Furthermore, the miR-222-3p inhibitor / antagonist is miR-222-3p antagomir.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] Compared with the RA group, after injection of the drug of the present invention, the degree of joint swelling in rats was significantly reduced, arthritis was effectively controlled, cartilage damage was significantly repaired, the expression of cartilage matrix synthesis protein was significantly increased, the expression of matrix degradation protein-matrix metalloproteinase was significantly weakened, bone mass and bone density were significantly increased, bone damage was significantly restored, synovial hyperplasia was significantly reduced, inflammatory cell infiltration was reduced, and joint synovial structure was also significantly improved. That is, the drug of the present invention can significantly improve the inflammatory response and cartilage destruction of arthritis in CIA rats, and has a significant therapeutic effect on rat rheumatoid arthritis. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the establishment and drug administration of a rat rheumatoid arthritis model in Example 1 of the present invention;

[0020] Figure 2 Schematic diagram of the basic structure of miR-222-3p antagomir in Example 1 of the present invention;

[0021] Figure 3 The ankle joint appearance of each group of rats in Example 1 of the present invention is recorded;

[0022] Figure 4 The thickness of the paws of rats in each group measured by a vernier caliper in Example 1 of the present invention;

[0023] Figure 5 The weight changes of rats in each group in Example 1 of the present invention are shown below;

[0024] Figure 6 The OARSI arthritis score results of rats in each group in Example 1 of the present invention;

[0025] Figure 7 The results of safranin fast green staining of the knee joints and ankle joints of the rats in each group in Example 1 of the present invention are shown;

[0026] Figure 8 The results of CollagenⅡ immunohistochemical staining of the knee joints of rats in each group in Example 1 of the present invention;

[0027] Fig. 9 The immunohistochemical staining results of MMP13 in the knee joints of rats in each group in Example 1 of the present invention are shown;

[0028] Fig.10The analysis results of the bone mineralization density of the subchondral cancellous bone and subchondral hard bone plate of each group of rats in Example 1 of the present invention;

[0029] Fig.11 The following are the HE staining results of the knee joints of rats in each group in Example 1 of the present invention.

[0030] Fig.12 The expression of inflammatory factors in the peripheral blood of rats in each group in Example 1 of the present invention. DETAILED DESCRIPTION

[0031] The following examples will further illustrate the specific steps and features of the invention, which are only used for illustration and are not intended to limit the present invention. The methods used in the present invention are conventional methods in the art unless otherwise specified. The reagents and materials involved in the present invention are commercially available unless otherwise specified.

[0032] The present invention is further described in detail below with reference to the embodiments and drawings:

[0033] Example 1

[0034] 1. Experimental Methods

[0035] ①Establishment of rat rheumatoid arthritis model:

[0036] Construction of the classic CIA rat model of rheumatoid arthritis: 7-week-old male Wistar rats were selected, and type II collagen and complete adjuvant were injected intradermally into the left hind toe of the rats for primary immunization on day 0. Type II collagen and incomplete adjuvant were injected subcutaneously at the base of the tail for booster immunization on day 21. CIA rats were scored for arthritis on day 28, and the CIA rats with successful modeling were randomly divided into groups. MiR-222-3p antagomir was injected into the tail vein once a week starting on day 28. After 4 consecutive weeks of administration, samples were collected on day 56. The schematic diagram of the whole process is shown in the figure. Figure 1 shown.

[0037] The miR-222-3p antagomir is synthesized by Guangzhou Ruibo Company, and its trade name is: miR30000891, micrOFFTM rno-miR-222-3p antagomir, and its sequence is the reverse complementary sequence of the target miRNA, and all nucleosides are 2'OMe modified RNA, and thiophosphate modification is performed on the two phosphodiester bonds at the 5' end and the four phosphodiester bonds at the 3' end, and there is also a cholesterol modification at the 3' end. The sequence of the target miRNA, i.e. miR-222-3p, is AGCUACAUCUGGCUACUGGGU (SEQ ID NO.1), and the basic structure of the miR-222-3p antagomir is as follows Figure 2Note: In WIPOST.26, uracil in RNA is represented by "T" instead of "U", so in the sequence table, "U" in SEQ ID NO.1 is "T".

[0038] ② Evaluation of materials

[0039] Four weeks after modeling, the rats were killed and knee joint samples were collected for body weight, paw thickness and International Society for the Study of Osteoarthritis score. Micro-CT was used to evaluate the bone mineralization density of subchondral cancellous bone and subchondral sclerite. Hematoxylin-eosin staining, safranin O staining and immunohistochemistry staining were used to observe the changes in joint morphology and cartilage matrix expression. ELISA was used to detect the expressions of pro-inflammatory factors IL-1β, IL-6 and TNFα in the peripheral blood serum of rats in each group.

[0040] 2. Results:

[0041] ① Observe the appearance of the rats' soles. When the model was successfully established on the 28th day, the soles of the rats in the RA group and the treatment group showed significant swelling compared with the normal group. After four weeks of continuous medication, the swelling of the soles of the rats in the treatment group was significantly reduced, while the swelling of the soles of the rats in the RA group gradually increased ( Figure 3 ); The thickness of the rats' soles was measured with a vernier caliper. The results showed that the soles of the rats in the RA group gradually thickened, while the soles of the rats in the treatment group began to thin at the second administration ( Figure 4 ). By recording the weight of the rats, it was found that the weight of the rats in the RA group was significantly reduced, and the weight of the rats in the treatment group began to increase after two doses of medication ( Figure 5 The arthritis scores in the treatment group were significantly reduced, while those in the RA group gradually increased, indicating that the arthritis in the treatment group was effectively controlled ( Figure 6 ).

[0042] ② The knee and ankle joints of rats were collected, decalcified, paraffin-embedded, and sectioned and stained. The red colored area represents the cartilage matrix. The results of safranin O staining of the knee and ankle joints showed that the articular surface cartilage of the RA group was lost and the edges were uneven; the articular cartilage damage in the treatment group was repaired ( Figure 7 ).

[0043] ③The results of knee joint cartilage immunohistochemistry showed that the expression of cartilage matrix synthesis protein CollagenⅡ protein increased significantly after treatment ( Figure 8 ), while the expression of matrix metalloproteinase MMP13, a matrix degradation protein, was significantly reduced ( Fig. 9 ).

[0044] ④Micro-CT analysis showed that the RA group had obvious bone destruction in the joints and decreased bone density ( Fig.10); Bone volume fraction BV / TV can directly reflect the changes in bone mass. The results of BV / TV showed that the bone mass in the RA group was significantly reduced, and the bone mass recovered to a certain extent after drug treatment ( Fig.10 ).

[0045] ⑤ The results of HE staining of the rat knee joints showed that in the model group, obvious synovial cell hyperplasia was observed in the knee joints, accompanied by a large number of inflammatory cell infiltration, disordered synovial structure, increased number of blood vessels, and increased collagen fibers. In the miR-222-3pantagomir-treated group, synovial hyperplasia was significantly alleviated, inflammatory cell infiltration was reduced, and the synovial structure of the rat joints was significantly improved ( Fig.11 ).

[0046] ⑥ELISA was used to detect the levels of pro-inflammatory factors IL-1β, IL-6, and TNFα in the peripheral blood of rats in each group. The results showed that the levels of pro-inflammatory factors IL-1β, IL-6, and TNFα in the peripheral blood of rats in the CIA group were significantly increased. After drug treatment, the levels of pro-inflammatory factors IL-1β, IL-6, and TNF-α in the peripheral blood of rats in the CIA+miR-222-3p antagomir group were reduced. This indicates that miR-222-3p antagomir can reduce the inflammatory response in CIA rats ( Fig.12 ).

[0047] In summary, miR-222-3p inhibitor can improve the inflammatory response and cartilage destruction in the joints of CIA rats and has a therapeutic effect on rheumatoid arthritis in rats.

[0048] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of miR-222-3p inhibitors / antagonists in the preparation of drugs for alleviating bone inflammation.

2. Application of miR-222-3p inhibitors / antagonists in the preparation of osteochondrocyte growth-promoting drugs.

3. Application of miR-222-3p inhibitors / antagonists in the preparation of drugs for increasing bone mass and / or bone density.

4. Application of miR-222-3p inhibitors / antagonists in the preparation of drugs for improving synovial structure.

5. Application of miR-222-3p inhibitors / antagonists in the preparation of drugs for the treatment of arthritis.

6. The use according to claim 5, characterized in that: The arthritis includes rheumatoid arthritis.

7. A small nucleic acid drug, characterized in that: The small nucleic acid drug includes the miR-222-3p inhibitor / antagonist in any one of claims 1 to 6.

8. The small nucleic acid drug according to claim 7, characterized in that: The miR-222-3p inhibitor / antagonist is selected from at least one of miR-222-3p antagomir and miR-222-3p antisense strand.

9. The small nucleic acid drug according to claim 8, characterized in that: The sequence of the miR-222-3p is shown in SEQ ID NO.

1.

10. The small nucleic acid drug according to claim 9, characterized in that: The miR-222-3p inhibitor / antagonist is a miR-222-3p antagomir.

Images