Targeted macrophage ibrutinib nano preparation as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and relates to a targeted macrophage ibrutinib nano preparation as well as a preparation method and application thereof. The preparation method of the targeted macrophage ibrutinib nano preparation comprises the following steps: synthesis of mannosylated chitosan and formation of the targeted macrophage ibrutinib nano preparation by cross-linking mannose-modified chitosan and ions of the mannose-modified chitosan. According to the targeted macrophage ibrutinib nano preparation, the in-vivo and in-vitro macrophage targeting property is greatly enhanced, the bioavailability and the macrophage absorption efficiency are greatly improved, and meanwhile, the drug use dosage and toxic and side effects are reduced; the traditional Chinese medicine composition has the effects of treating lung cancer, silicosis, idiopathic pulmonary fibrosis and liver cancer; the ibrutinib is delivered to macrophages in a targeted manner to regulate and secrete inflammatory cytokines and / or fibrosis factors, so that the effect of regulating and controlling lung chronic diseases and liver cancer progression is achieved, and the ibrutinib has the function of delivering ibrutinib to macrophages in an in-vivo and in-vitro targeted manner.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a macrophage-targeted ibrutinib nanoformulation and a preparation method and application thereof. Background Art

[0002] Lung cancer is a malignant tumor with extremely high morbidity and mortality worldwide. The vast majority of lung cancers originate from the bronchial mucosal epithelium, so it is also called bronchial lung cancer. Among all types of lung cancer, non-small cell lung cancer (NSCLC) accounts for more than 80%. In the past 50 years, especially in industrially developed countries, the incidence and mortality of lung cancer have shown a rapid upward trend. Among male patients who die from cancer, lung cancer has become the leading cause of death and ranks first in cancer deaths worldwide. At present, the treatment of lung cancer mainly relies on radiotherapy and chemotherapy, but many patients will develop primary or secondary drug resistance. With the development of science and technology and the deepening of research, the treatment concepts and plans of lung cancer are constantly innovating, especially in the fields of immunotherapy and targeted therapy. In 2020, there are an estimated 2.2 million new cases of lung cancer and 1.8 million related deaths worldwide. These data not only highlight the huge threat of lung cancer to global health, but also emphasize the urgency of researching and improving treatment strategies. Therefore, it is particularly important to find new potential targets for the treatment of lung cancer.

[0003] Ibrutinib is a targeted anticancer drug approved by the U.S. Food and Drug Administration (FDA) in 2013. It is the first oral irreversible inhibitor of Bruton's tyrosine kinase (BTK) for the treatment of mantle cell lymphoma (MCL). It has been widely used in clinical practice and has achieved good therapeutic effects. BTK is a tyrosine kinase that plays a key role in the B cell receptor (BCR) signaling pathway and is essential for the proliferation, survival and signal transduction of B cells. Ibrutinib inhibits the activity of BTK by forming a covalent bond with the cysteine ​​residue (Cys481) in the active site of BTK, thereby preventing the phosphorylation of downstream substrates (such as PLC-γ) and affecting the proliferation and survival of malignant B cells. Although ibrutinib has been successful in the treatment of B cell malignancies, drug resistance remains a challenge. Certain mutations in the BTK protein, especially the mutation of cysteine ​​at position 481 to serine (C481S), can lead to a significant decrease in the activity of ibrutinib, thereby causing drug resistance. However, compared with other solid tumors, the effect of ibrutinib in the treatment of lung cancer is not significant, which shows the specificity of ibrutinib's target and BTK in lung cancer. It may be that low solubility and easy off-target properties limit its effect in the treatment of lung cancer. Summary of the invention

[0004] In view of the deficiencies of the above-mentioned prior art, the present invention provides a macrophage-targeted ibrutinib nanoformulation and a preparation method and application thereof. Compared with simple ibrutinib treatment, the chitosan nanoformulation targeted by the present invention reverses chronic lung diseases by targeting lung macrophages. It is also found that the chitosan nanoformulation targeted by the present invention can inhibit the secretion of inflammatory factors of liver cancer cells in vitro. The chitosan nanoformulation targeted by the present invention can better improve the bioavailability of ibrutinib and improve its therapeutic effect. The specific technical scheme is as follows:

[0005] The first object of the present invention is to provide a method for preparing a macrophage-targeted ibrutinib nanoformulation, comprising the following steps:

[0006] (1) dissolving chitosan in acetic acid solution, stirring until fully dissolved, and adjusting the pH value to 4.0-6.0 to obtain solution 1; dissolving D-mannose and sodium cyanoborohydride in water to obtain solution 2;

[0007] (2) Add solution 2 to solution 1 and stir at room temperature for 35 to 60 hours to obtain solution 3;

[0008] (3) dialyzing the solution obtained in step (2) and freeze-drying it, or centrifuging the solution, washing it with distilled water, precipitating it, and then resuspending it with acetic acid and freeze-drying it to obtain mannosylated chitosan;

[0009] (4) dissolving the mannosylated chitosan obtained in step (3) in an acetic acid solution and stirring until fully dissolved, adjusting the pH value to 4.0-6.0, to obtain solution 4; dissolving sulfobutyl-β-cyclodextrin and ibrutinib in water, stirring at 30-50° C. for loading, and filtering to obtain solution 5;

[0010] (5) Slowly adding solution 5 dropwise into solution 4 at a mass ratio of sulfobutyl-β-cyclodextrin to mannosylated chitosan of 0.65-1.25:1, stirring evenly at room temperature, to obtain a macrophage-targeted ibrutinib nanoformulation.

[0011] Furthermore, the molecular weight of the chitosan is 9 kDa to 100 kDa.

[0012] Furthermore, in the step (1), the mass volume ratio of the chitosan to the acetic acid solution is 0.1-0.4 g / 100 ml, and the mass fraction of the acetic acid solution is 0.5-1.5%.

[0013] Furthermore, in the step (1), the mass ratio of D-mannose to sodium cyanoborohydride is (4-5):1; and the mass volume ratio of D-mannose to water is 4-5 g / 100 ml.

[0014] Furthermore, in step (2), the volume ratio of solution 2 to solution 1 is 1:1, and the stirring speed is 100-200 rpm.

[0015] Furthermore, in step (3), the dialysis time is 2 to 6 days; the centrifugal speed is 3000 to 4000 rpm, and the centrifugal time is 10 to 20 min; the precipitate is washed twice with distilled water; the pH of acetic acid is 4 to 5; and the freeze-drying temperature is -100 to -60°C.

[0016] Furthermore, in the step (4), the mass volume ratio of the mannose-modified chitosan to the acetic acid solution is 0.05-0.2 g / 100 ml, and the mass fraction of the acetic acid solution is 0.5-1.5%.

[0017] Furthermore, in the step (4), the mass ratio of sulfobutyl-β-cyclodextrin to ibrutinib is (5-7):1; the mass volume ratio of sulfobutyl-β-cyclodextrin to water is 3-4 g / 100 ml.

[0018] Furthermore, in the steps (1) and (4), the pH is adjusted using sodium hydroxide having a concentration of 0.8 to 1.2 M.

[0019] Furthermore, in step (5), the stirring speed is 100 to 200 rpm, and the stirring time is 20 to 40 min.

[0020] Furthermore, the macrophage-targeted ibrutinib nanoformulation obtained in step (5) is freeze-dried into powder and then stored at 4° C. in the dark for a long term.

[0021] The second object of the present invention is to provide a macrophage-targeted ibrutinib nanoformulation, which is prepared by the above-mentioned method for preparing the macrophage-targeted ibrutinib nanoformulation.

[0022] The third object of the present invention is to provide the use of the above-mentioned macrophage-targeted ibrutinib nanoformulation in the preparation of drugs for treating lung cancer, silicosis, idiopathic pulmonary fibrosis or liver cancer.

[0023] The beneficial effects of the present invention are:

[0024] In the preparation method of the macrophage-targeted ibrutinib nanoformulation of the present invention, the water solubility of the poorly soluble small molecule drug is significantly improved after ibrutinib is dissolved by sulfobutyl-β-cyclodextrin, and the nanoparticles formed by ionic cross-linking of chitosan modified with mannose greatly enhance its macrophage targeting in vivo and in vitro, greatly improve its bioavailability and macrophage absorption efficiency, and reduce the dosage of the drug and toxic and side effects; and the preparation has the effect of treating lung cancer, silicosis, idiopathic pulmonary fibrosis and liver cancer.

[0025] The macrophage-targeted ibrutinib nanoformulation prepared by the present invention can regulate the secretion of inflammatory cytokines and / or the production of fibrosis factors in different chronic lung diseases by targeted delivery of ibrutinib to macrophages, thereby achieving the effect of regulating the progression of chronic lung diseases and liver cancer, and has the function of targeted delivery of ibrutinib to macrophages in vivo and in vitro. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 A flow chart for preparing nanoparticles for delivering ibrutinib to macrophages in the present invention;

[0027] Figure 2 This is a graph showing the efficacy of ibrutinib of the present invention on lung cancer;

[0028] A: Animal modeling pattern diagram; B: Animal weight change diagram; C: Changes in lung function indicators of the two groups of mice; D: Number of lung tumor nodules in the two groups of mice; E: Pathological nodules in the lung tissues of the two groups of mice and the proportion of nodules area;

[0029] Figure 3 This is a localization map of BTK, the target of ibrutinib in lung cancer tissues of the present invention;

[0030] AB: BTK expression level and localization in tumors and adjacent tissues of lung cancer patients; CD: BTK expression level and localization in tumors and adjacent tissues of lung cancer mice; E: BTK expression level in macrophages using single-cell sequencing data from lung cancer patient tissues;

[0031] Figure 4 This is a graph showing the effect of silencing BTK macrophage stable lines on the migration and invasion capabilities of lung cancer cells;

[0032] AB: Effect of silencing macrophage BTK on the migration ability of lung cancer cells; CD: Effect of silencing macrophage BTK on the invasion ability of lung cancer cells;

[0033] Figure 5 This is a characterization diagram of the ibrutinib targeted nanoformulation of the present invention;

[0034] A: Solution state of nanoparticles with different mass ratios; B: Nanoparticle size distribution, encapsulation efficiency and drug loading of targeted nanoparticles; C: Nanoparticle size distribution; D: TEM particle morphology of nanoparticles; E: Infrared spectrum detection data of different components; F: In vitro sustained release detection of nanoparticles;

[0035] Figure 6 This is a diagram showing the effect of the ibrutinib targeted nanoformulation of the present invention on a lung cancer model;

[0036] A: Diagram of the treatment model of the two groups of animals; B: Diagram of weight changes of the two groups of animal models; C: Statistical diagram of lung function test of the two groups of mice; D: Diagram of the number of lung tumor nodules of the two groups of mice; E: Diagram of pathological nodules and nodule area ratio of the lung tissue of the two groups of mice;

[0037] Figure 7 This is a diagram showing the therapeutic effect of the ibrutinib targeted nanoformulation of the present invention on liver cancer cells;

[0038] A: Effects of MSβC and MSβC / IBR on cytokine secretion by SMCC-7721 liver cancer cells; B: Effects of MSβC and MSβC / IBR on cytokine secretion by SK-Hep-1 liver cancer cells. DETAILED DESCRIPTION

[0039] The principles and features of the present invention are described below in conjunction with embodiments. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0040] 1. Ibrutinib is effective in treating lung cancer

[0041] Inject 1 × 10 5 / 100μl of mouse lung cancer cells (Lewis, purchased from the cell bank of the Chinese Academy of Sciences in Shanghai) were used to establish a model of C57BL / 6 orthotopic lung cancer mice. After tumor formation on the seventh day, ibrutinib was intraperitoneally injected once a day at a dose of 25mg / kg for one month. During this period, the lung function of the mice was evaluated, and the lung tissues of the mice were collected after the treatment for pathological analysis. Figure 2 A is a schematic diagram of the ibrutinib treatment of lung cancer mouse model. Seven days after the Lewis cells were injected via the tail vein, ibrutinib was injected intraperitoneally (25 mg / kg) for treatment, and the mice were euthanized three weeks later. Figure 2 B is a line graph of the weight changes of mice during the period of ibrutinib treatment of lung cancer mice. The results show that after ibrutinib treatment, the weight of mice decreased compared with the control group. At the same time, the lung function of mice was tested before euthanasia. Figure 2 C The results showed that the levels of benign indicators reflecting the lung function of mice (EF50, TV, MV) increased significantly, while the PENH lung function indicators decreased significantly. Figure 2 DE results showed that the number of tumors and pathological results in the collected mouse lung tissues were compared with the control group. The size and number of lung tumors in the ibrutinib-treated group were significantly reduced. The above results show that ibrutinib can effectively treat in situ lung cancer.

[0042] 2. Cellular localization experiment of BTK, the target of ibrutinib

[0043] By performing immunofluorescence localization on lung cancer tissue samples from humans and mice, double labeling of BTK and macrophage makers (CD68, F4 / 80) revealed that the cell localization of BTK, the target of ibrutinib, is on macrophages. At the same time, analysis of single-cell sequencing results from lung cancer patients showed that BTK is mainly expressed in macrophages. Figure 3 A- Figure 3 B: Using lung tissue from lung cancer patients, double-labeled immunofluorescence detection of BTK and macrophage maker CD68 was performed. The results showed that BTK was positively expressed in the patient's tumor site and specifically localized in macrophages. In non-tumor sites, BTK was expressed in non-macrophages. Figure 3 C- Figure 3 D: Immunofluorescence was used to detect the expression level and localization of BTK in tumor and adjacent tissues of lung cancer mice. The results were consistent with those of human tissue specimens, indicating that BTK was expressed in macrophages at the tumor site. Figure 3 E: To further clarify the expression and localization of BTK in lung cancer patients, single-cell sequencing data of lung cancer patients were used for analysis. The results showed that BTK was mainly enriched in macrophages of lung cancer patients, and was divided into high-BTK-expressing macrophage cell populations and low-BTK-expressing macrophage cell populations.

[0044] 3. Construction of BTK-silencing macrophage cell line

[0045] The siRNA sequences purchased from Jima Biotechnology were transfected into macrophages, and the BTK expression levels were detected by RT-PCR and WB. The siRNA sequences with the highest silencing efficiency were screened and designed into shRNA sequences. The sequence information is as follows: Forward: 5'-GATCGCTACATTCCTAGT AACTATGTTCAAGAGACATAGTTACTAGGAATGTAGCTTTTTTGGTAC C-3'(1), Reverse: 5'-AATTGGTACCAAAAAAGCTACATTCCTAGTAAC TATGTCTCTTGAACATAGTTACTAGGAATGTAGC-3'(2), and plvx-sh The three plasmids RNA2, pMD.2G, and psPAX2 were co-transfected into 293T cells using lipo2000. After 48 hours, the cell supernatant was collected and centrifuged at 1000 rpm. The supernatant was filtered through a 0.45 μm filter to obtain the lentiviral supernatant. The supernatant was then used to culture macrophages. The macrophages were derived from THP-1 and PBMC. The macrophages were continued to be cultured in a medium containing puromycin at a final concentration of 5 μg / ml. The untransfected macrophages were killed by passaging until 80% of the cells had green fluorescence as observed under an inverted fluorescence microscope, indicating that the cell line with stable BTK silencing was completed. The silencing efficiency was verified by WB and PCR.

[0046] 4. Silencing macrophage BTK inhibits lung cancer cell migration and invasion

[0047] (1) Cell culture conditions

[0048] A549 and H1975 cells and BTK-silenced macrophage stable lines were cultured in RPMI-1640 medium containing 10% fetal bovine serum in a 37°C, 5% CO2 incubator.

[0049] (2) Cell scratch test

[0050] Cells in logarithmic growth phase were taken and inoculated into 12-well plates, with 5×10 5 cells, and 3 replicates were made for each sample. After 12 hours of culture, the medium was replaced with serum-free medium, and a 10μL pipette tip was used to make a cross-shaped cell scratch on the well plate. A photo was taken immediately under a microscope, and the photo position was recorded, which was the scratch at 0h. After 48 hours of culture, the culture plate was removed, the culture solution was discarded, and the photo was slowly rinsed once with PBS. A blank medium was added, and the position was recorded and photographed at 0h. The scratch width was recorded under a microscope. The scratch position length was measured using Image J software, 48h cell migration distance (mm) = 0h scratch width - 48h scratch width, 48h cell migration rate = (0h scratch width - 48h scratch width) / 0h scratch width × 100%. Silencing BTK significantly inhibited the cell migration rate of A549 and H1975. Figure 4 A- Figure 4 As shown in B, the supernatant of macrophages with BTK silenced significantly inhibited the scratch healing rate of lung cancer cells.

[0051] (3) Transwell

[0052] Lung cancer cells in logarithmic growth phase were digested, centrifuged and washed, and the supernatant was discarded. The cell number was 1×10 5 / ml, then take 200μl and place it in the upper chamber. Use complete culture medium to resuspend the macrophages, and take 500μl of the cell suspension and place it in the lower chamber. After laying the cells, before placing the 24-well plate in the incubator for culture, make sure that there are no bubbles between the contact liquid surface of the upper chamber and the lower chamber. Culture the cells for 48h according to experimental requirements. After removing the chamber, wash with 1×PBS, fix with 4% paraformaldehyde solution (room temperature for 20-30min), then wash twice, and stain with crystal violet stain (room temperature for 20min). Carefully wipe off the cells on the top of the chamber with a cotton swab, and then take a picture under a microscope to count the number of cells. Figure 4 C- Figure 4 As shown in D, co-culture of BTK-silenced macrophages with tumor cells significantly inhibited the migration and invasion of lung cancer cells.

[0053] Example:

[0054] like Figure 1 As shown, a nanoparticle preparation for delivering ibrutinib to macrophages is shown:

[0055] (1) Synthesis of mannosylated chitosan

[0056] Mannosylated chitosan was synthesized by reductive amination method. 0.1 g of chitosan was stirred and dissolved in 100 ml of 1% acetic acid aqueous solution, and the pH value was adjusted to 5.0 with 1 M sodium hydroxide; at the same time, 0.9 g of D-mannose and 0.2 g of sodium cyanoborohydride were dissolved in 100 ml of aqueous solution; the two solutions were mixed, stirred at 150 rpm at room temperature for 36 hours, and dialyzed with a 3.5 kDa dialysis membrane for 5 days (it can also be centrifuged at 3500 rpm for 15 minutes, washed twice with distilled water, and then resuspended in 0.5% acetic acid (pH 4.5)), freeze-dried at -80°C, and detected by Fourier infrared spectroscopy after freeze-drying.

[0057] (2) Synthesis of nanoparticles for macrophage-targeted delivery of ibrutinib

[0058] Drug-loaded nanomaterials were prepared by the ion gel method using chitosan as the cationic phase and sulfobutyl-β-cyclodextrin as the anionic phase. 0.1 g of mannosylated chitosan was dissolved and stirred with 100 ml of 1% acetic acid solution and the pH was adjusted to 4.5 with 1M NaOH; 6 mg of ibrutinib was dissolved in 3.6 g of sulfobutyl-β-cyclodextrin in 100 ml of aqueous solution in advance, heated and stirred at 40°C for loading, and then filtered through a 0.45 μm filter membrane to obtain a transparent solution. The above transparent solution was slowly added to the mannosylated chitosan solution with a needle according to the mass ratio of sulfobutyl-β-cyclodextrin to mannosylated chitosan of 0.65:1, 0.85:1, 1:1, and 1.25:1, respectively, with stirring while adding, and then continuously stirred at room temperature for 30 minutes to obtain nanoparticles, which were centrifuged and freeze-dried for subsequent detection. Figure 5 A shows the solution state after mixing different mass ratios of sulfobutyl-β-cyclodextrin and mannosylated chitosan. The solutions with different ratios were selected for particle size detection. The results Figure 5 BC showed that when the mass ratio of the two was 0.85:1, DLS, PDI and drug loading rate were the best. At the same time, the nanoparticles were detected by TEM electron microscopy to be regular round in shape. The functional groups of different components were analyzed by FT-IR. Figure 5 The results showed that mannose was effectively modified on chitosan and ibrutinib was effectively loaded. The nanomaterials were tested in an in vitro sustained release experiment in a buffer system. Figure 5 The results showed that the nanoparticles had a higher sustained release capacity than the simple cyclodextrin solution.

[0059] Targeted delivery of ibrutinib for lung cancer

[0060] (1) Tracer detection in mice

[0061] The lung targeting of nanoparticle preparations was preliminarily studied using non-invasive near-infrared optical imaging technology. DiR was used to replace IBR and was encapsulated by MCS / sulfobutyl-β-cyclodextrin NPs. Then 50μl of the nanosuspension was dripped into the mouse lungs by nose drops, and non-invasive near-infrared optical imaging was performed 1 hour later. The mice were then killed and the heart, lungs, liver, stomach, spleen and kidneys were taken for in vitro fluorescence imaging. Ex / Em was 750 / 790nm.

[0062] (2) Ibrutinib targeted nanoparticle formulation is effective in treating lung cancer

[0063] Inject 1 × 10 5 / 100μl of mouse lung cancer cells were used to establish C57BL / 6 orthotopic lung cancer mice. After tumor formation on the seventh day, ibrutinib targeted nanoformulation was administered by nasal injection, with a dose of 50μl / time, once a day, for one month. During this period, the lung function of the mice was evaluated, and the lung tissues of the mice were collected after the treatment for pathological analysis. Figure 6 A is a schematic diagram of the modeling of lung cancer mice treated with ibrutinib targeted nanoformulation. Nasal injection of ibrutinib targeted nanoformulation was started 7 days after Lewis cells were injected through the tail vein, and the mice were euthanized three weeks later. Figure 6 B is a line graph of the weight changes of mice during the treatment period of lung cancer mice with ibrutinib targeted nanoformulation. The results show that after treatment with ibrutinib targeted nanoformulation, the weight of mice decreased compared with the control group. At the same time, the lung function of mice was tested before euthanasia. Figure 6 C The results showed that the levels of benign indicators reflecting the lung function of mice (EF50, TV, MV) increased significantly, while the PENH lung function indicators decreased significantly. Figure 2 DE results showed that the number of tumors and pathological results in the collected mouse lung tissues were compared with the control group. The size and number of lung tumors in the mice treated with ibrutinib targeted nanoformulation were significantly reduced. The above results show that ibrutinib targeted nanoformulation can effectively treat in situ lung cancer.

[0064] The results showed that compared with the control group, the lung function of mice treated with ibrutinib targeted nanoformulation was improved and the size of lung tumors was reduced.

[0065] The present invention found that ibrutinib inhibits the migration and invasion of lung cancer by acting on tumor-associated macrophages. The cell localization and function of the BTK gene, the target of ibrutinib, have not been reported in lung cancer. The present invention found that BTK is mainly located in tumor-associated macrophages and promotes the migration and invasion of lung cancer cells by activating the MAPK signaling pathway. The present invention found that the delivery of ibrutinib to macrophages is achieved by mannose-modified chitosan, which can significantly enhance the therapeutic effect of ibrutinib and reduce its toxic side effects.

[0066] (3) Ibrutinib targeted nanoparticle formulation effectively inhibits the secretion of inflammatory factors in liver cancer cells

[0067] MSβC and MSβC / IBR were dissolved in serum-free medium, co-cultured with SMMC-7721 and SK-Hep1 liver cancer cell lines for 24 hours, and then the cells were collected and lysed by adding TRIzol. RNA was extracted according to the RNA extraction procedure, and the concentration was detected by spectrophotometer. After reverse transcription of RNA into cDNA, the Ct values ​​of different inflammatory factors were detected by RT-PCR rapid detection kit, and the changes of inflammatory factor indicators were statistically analyzed. Results Figure 7 AB showed that after MSβC / IBR treatment, the expression levels of CCL2, CCL5, TNF-α, TGF-β, IL-1α, IL-1β and IL-6 inflammatory chemokines in SMMC-7721 and SK-Hep1 liver cancer cells could be significantly reduced compared with the control group, indicating that ibrutinib targeted nanoparticle preparation can effectively inhibit the secretion of inflammatory factors in liver cancer cells, thereby treating liver cancer.

[0068] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for preparing a macrophage-targeted ibrutinib nanoformulation, characterized in that: The steps include: (1) dissolving chitosan in acetic acid solution, stirring until fully dissolved, and adjusting the pH value to 4.0-6.0 to obtain solution 1; dissolving D-mannose and sodium cyanoborohydride in water to obtain solution 2; (2) Add solution 2 to solution 1 and stir at room temperature for 35 to 60 hours to obtain solution 3; (3) dialyzing the solution obtained in step (2) and freeze-drying it, or centrifuging the solution, washing it with distilled water, precipitating it, and then resuspending it with acetic acid and freeze-drying it to obtain mannosylated chitosan; (4) dissolving the mannosylated chitosan obtained in step (3) in an acetic acid solution and stirring until fully dissolved, adjusting the pH value to 4.0-6.0, to obtain solution 4; dissolving sulfobutyl-β-cyclodextrin and ibrutinib in water, stirring at 30-50° C. for loading, and filtering to obtain solution 5; (5) Slowly adding solution 5 dropwise into solution 4 at a mass ratio of sulfobutyl-β-cyclodextrin to mannosylated chitosan of 0.65-1.25:1, stirring evenly at room temperature, to obtain a macrophage-targeted ibrutinib nanoformulation.

2. The method for preparing the macrophage-targeted ibrutinib nanoformulation according to claim 1, characterized in that: In the step (1), the mass volume ratio of the chitosan to the acetic acid solution is 0.1-0.4 g / 100 ml, and the mass fraction of the acetic acid solution is 0.5-1.5%.

3. The method for preparing the macrophage-targeted ibrutinib nanoformulation according to claim 2, characterized in that: In the step (1), the mass ratio of D-mannose to sodium cyanoborohydride is (4-5):1; the mass volume ratio of D-mannose to water is 4-5 g / 100 ml.

4. The method for preparing the macrophage-targeted ibrutinib nanoformulation according to claim 1, characterized in that: In the step (2), the volume ratio of solution 2 to solution 1 is 1:1, and the stirring speed is 100-200 rpm.

5. The method for preparing the macrophage-targeted ibrutinib nanoformulation according to claim 1, characterized in that: In the step (3), the dialysis time is 2 to 6 days; the centrifugal speed is 3000 to 4000 rpm, and the centrifugal time is 10 to 20 min; the precipitate is washed twice with distilled water; the pH of acetic acid is 4 to 5; and the freeze-drying temperature is -100 to -60°C.

6. The method for preparing the macrophage-targeted ibrutinib nanoformulation according to claim 1, characterized in that: In the step (4), the mass volume ratio of mannose-modified chitosan to acetic acid solution is 0.05-0.2 g / 100 ml, and the mass fraction of the acetic acid solution is 0.5-1.5%.

7. The method for preparing the macrophage-targeted ibrutinib nanoformulation according to claim 1, characterized in that: In the step (4), the mass ratio of sulfobutyl-β-cyclodextrin to ibrutinib is (5-7):1; the mass volume ratio of sulfobutyl-β-cyclodextrin to water is 3-4 g / 100 ml.

8. The method for preparing the macrophage-targeted ibrutinib nanoformulation according to claim 1, characterized in that: In the step (5), the stirring speed is 100 to 200 rpm, and the stirring time is 20 to 40 min.

9. A macrophage-targeted ibrutinib nanoformulation, characterized in that: The ibrutinib nanoparticle preparation targeted to macrophages is prepared by the method for preparing the ibrutinib nanoparticle preparation targeted to macrophages according to any one of claims 1 to 8.

10. Use of the macrophage-targeted ibrutinib nanoformulation according to claim 9 in the preparation of drugs for treating lung cancer, silicosis, idiopathic pulmonary fibrosis or liver cancer.

Images