Brucella attenuated live vaccine strain M5lysR21 as well as attenuation method and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a brucella attenuated live vaccine strain M5 delta lysR21 as well as an attenuating method and application thereof, the M5 delta lysR21 is obtained by deleting a lysR21 gene from a brucella melitensis M5 strain, the brucella attenuated live vaccine strain MS delta lysR21 is preserved in China General Microbiological Culture Collection Center, and the preservation number is CGMCC NO. The strain is preserved in CGMCC (China General Microbiological Culture Collection Center) at No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing on November 21, 2024, and has the preservation number of CGMCC NO.32791. The invention finds that the lysR21 gene is related to the virulence of the Brucella, the deletion of the lysR21 gene can weaken the virulence of the Brucella, can significantly reduce the survival ability of the Brucella in cells and in mice, shows higher immunoprotectiveness than a vaccine strain, can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis, and has potential application value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an attenuated live Brucella vaccine strain M5ΔlysR21 and an attenuation method and application thereof. Background Art

[0002] Brucellosis, also known as "brucellosis" for short, is a zoonotic infectious disease caused by Brucella infection. Brucella is a Gram-negative intracellular parasite, with Brucella melitensis, Brucella bovis and Brucella suis being the most common. The clinical manifestations of human infection with Brucella are diverse, including fever, sweating, fatigue, joint and muscle pain, etc. Improper or delayed treatment may turn the disease into a chronic disease, leading to prolonged illness. Brucella infection in livestock may cause testicular or epididymitis in male animals, miscarriage, premature birth or stillbirth in female animals.

[0003] Brucellosis is widely prevalent and distributed throughout the world. According to reports, brucellosis exists in humans and livestock in nearly 170 countries and regions around the world. In recent years, due to factors such as the increase in animal breeding, frequent animal trade and circulation, brucellosis has shown a rebound trend worldwide and is a public health problem facing the world, especially developing countries.

[0004] The prevention and control of brucellosis mainly rely on quarantine, culling and destruction, and vaccination. Vaccination is the most effective way to prevent brucellosis in livestock. The research and development of brucellosis vaccines can be traced back to the early 20th century. With the in-depth understanding of the pathogenic mechanism of brucellosis, the development of vaccines has also evolved from inactivated vaccines, live attenuated vaccines, mutant strain vaccines, and new vaccines. Among them, live attenuated vaccines are long-lasting and highly effective. Most of the vaccines currently used in my country are live attenuated vaccines. However, these existing attenuated vaccines have certain defects, such as high toxicity and serious relapse. In addition, there are no very effective vaccines and treatments for human brucellosis, and there is also a risk of transmission to humans during the process of vaccinating animals.

[0005] Therefore, with the deepening of research on the pathogenic mechanism of Brucella and the development and application of related molecular biology technologies, developing vaccines that can overcome the defects of existing vaccines and are safe and effective for both animals and humans is the key to controlling the epidemic of brucellosis. Summary of the invention

[0006] The purpose of the present invention is to provide a Brucella attenuated live vaccine strain M5ΔlysR21 and its attenuation method and application. The M5ΔlysR21 strain constructed by knocking out the lysR21 gene is less virulenced than the original Brucella M5 strain and can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis.

[0007] The objective of the present invention is achieved through the following technical solutions:

[0008] The present invention provides a Brucella attenuated live vaccine strain M5ΔlysR21, wherein the Brucella attenuated live vaccine strain M5ΔlysR21 is obtained by deleting the lysR21 gene from the Brucella melitensis M5 strain, and the Brucella attenuated live vaccine strain M5ΔlysR21 is deposited in the General Microbiology Center of China National Committee for the Preservation of Microorganisms, with the address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the preservation date is November 21, 2024, the preservation number is CGMCC NO.32791, and the classification name is Brucella melitensis.

[0009] The present invention also provides a method for attenuating Brucella, which comprises the step of knocking out or deleting the lysR21 gene in Brucella, wherein the Brucella is the Brucella melitensis M5 strain.

[0010] Further, the method specifically includes the following steps:

[0011] (1) PCR amplified the upstream and downstream homology arm fragments of the lysR21 gene, and after the amplification, the two fragments were fused by fusion PCR to obtain a fusion fragment;

[0012] (2) Connecting the fusion fragment to the linearized suicide plasmid pKB by homologous recombination to obtain a recombinant plasmid, and obtaining the suicide plasmid pKB-ΔlysR21 after screening and extraction;

[0013] (3) The suicide plasmid pKB-ΔlysR21 was electroporated into Brucella melitensis M5 competent cells, and the M5ΔlysR21 deletion strain was obtained after double screening.

[0014] Further, in step (1), the primer sequences used in the PCR amplification of the upstream and downstream homology arm fragments of the lysR21 gene are as shown in SEQ ID NO.1-4, wherein the primer sequences such as LysR21-UF shown in SEQ ID NO.1 and LysR21-UR shown in SEQ ID NO.2 are used to amplify the upstream homology arm fragment, the primer sequences such as LysR21-DF shown in SEQ ID NO.3 and LysR21-DR shown in SEQ ID NO.4 are used to amplify the downstream homology arm fragment, and the primer set used in the fusion PCR is LysR21-UF shown in SEQ ID NO.1 and LysR21-DR shown in SEQ ID NO.4.

[0015] Furthermore, in step (2), the screening method is to transfer the recombinant plasmid into Escherichia coli DH5a competent cells, screen the kanamycin-resistant strains in LB solid culture medium and liquid culture medium containing kanamycin, then perform PCR bacterial liquid identification, and extract the pKB-ΔlysR21 suicide plasmid.

[0016] Furthermore, in step (3), the double screening method is: the suicide plasmid pKB-ΔlysR21 extracted in step (2) is electrotransformed into Brucella competent cells, the product is coated on TSA solid culture medium containing kanamycin, monoclonal bacteria are picked and cultured in TSB liquid culture medium, and then negatively screened in TSA solid culture medium containing 5% sucrose, monoclonal colonies are picked and cultured in TSB liquid culture medium, and the M5ΔlysR21 deletion strain is identified by PCR using inner identification primers and outer identification primers.

[0017] Furthermore, the inner identification primers are InLysR21-F as shown in SEQ ID NO.5 and InLysR21-R as shown in SEQ ID NO.6; the outer identification primers are OutLysR21-F as shown in SEQ ID NO.7 and OutLysR21-R as shown in SEQ ID NO.8.

[0018] The present invention also provides a use of the Brucella attenuated live vaccine strain M5ΔlysR21 or the attenuated Brucella prepared by the Brucella attenuation method in the preparation of a preparation for preventing brucellosis.

[0019] Furthermore, the preparation is a live attenuated Brucella vaccine.

[0020] Beneficial effects:

[0021] (1) The present invention found that the deletion of the lysR21 gene affects the basic phenotype of Brucella, such as the ability to resist oxidative stress and the ability to resist nitrogen stress are significantly reduced.

[0022] (2) The present invention found that the lysR21 gene is related to the virulence of Brucella, and the deletion of the lysR21 gene can weaken the virulence of Brucella. After deletion, it can significantly reduce the survival ability of Brucella in cells and mice, and has potential application value.

[0023] (3) The constructed M5ΔlysR21 gene-deficient strain showed reduced virulence compared with the original Brucella M5 strain and stronger immune protection compared with the M5-90Δ26 vaccine strain, and can be used as a candidate attenuated live vaccine strain for the prevention of animal brucellosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 This is a diagram showing the result of PCR amplification of the target gene fragment in Example 1 of the present invention;

[0026] Figure 2 This is a diagram showing the results of using universal primers M13F(-47) / R(-48) to identify the suicide plasmid pKB-ΔlysR21 in Example 1 of the present invention;

[0027] Figure 3 This is a schematic diagram of the structure of the M5ΔlysR21 deletion strain identified by PCR using inner and outer primers in Example 1 of the present invention;

[0028] Figure 4 The results of PCR identification of the M5ΔlysR21 deletion strain in Example 1 of the present invention are shown in Figure A; wherein, A is the PCR identification of the parent strain M5 and the M5ΔlysR21 deletion strain using the inner identification primers InLysR21-F and InLysR21-R; and B is the PCR identification of the parent strain M5 and the M5ΔlysR21 deletion strain using the outer identification primers OutLysR21-F and OutLysR21-R;

[0029] Figure 5 The Western Blot results of identifying the M5ΔlysR21 deletion strain in Example 1 of the present invention are shown in Figure 1, wherein A is a result of identifying the expression of LysR21, and B is a result of identifying the expression of GroEL;

[0030] Figure 6 It is a graph of the Brucella growth curve measurement in Test Example 1 of the present invention, which shows the growth curve results of the parent strain M5 and the M5ΔlysR21 deletion strain in TSB medium;

[0031] Figure 7 The figure is a result of the tolerance test in Test Example 1 of the present invention; A is the sensitivity of the parent strain M5 and the M5ΔlysR21 deletion strain to H2O2; B is the tolerance of the parent strain M5 and the M5ΔlysR21 deletion strain to SNP; statistical analysis: "ns" indicates that there is no significant difference in the data; "*" indicates that the p value is ≤0.05, and "**" indicates that the p value is ≤0.01 and the data are significantly different;

[0032] Figure 8This is a graph showing the test results of the adhesion and invasion of RAW264.7 cells by the M5 parent strain and the M5ΔlysR21 deletion strain in Experimental Example 2 of the present invention; Statistical analysis: "ns" indicates that there is no significant difference in the data;

[0033] Fig. 9 This is a graph showing the survival test results of the M5 parent strain and the M5ΔlysR21 deletion strain in RAW264.7 cells in Experimental Example 2 of the present invention; Statistical analysis: "ns" indicates that there is no significant difference in the data; "**" indicates that the p value is ≤ 0.01 and the data are significantly different;

[0034] Fig.10 The figure is a result diagram of the pathogenicity of the parent strain M5 and the M5ΔlysR21 deletion strain evaluated in the mouse infection test in Experimental Example 2 of the present invention; wherein, the left figure is the spleen weight and spleen bacterial load results of mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain for 2 weeks; the right figure is the spleen weight and spleen bacterial load results of mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain for 4 weeks; statistical analysis: "ns" indicates that there is no significant difference in the data; "*" indicates that the p value is ≤0.05, "**" indicates that the p value is ≤0.01, and "***" indicates that the p value is ≤0.001, and the data are significantly different;

[0035] Fig.11 The mouse infection experiment in Experimental Example 2 of the present invention evaluates the liver lesions of the M5 parent strain and the M5ΔlysR21 deletion strain; wherein, Figure A shows the histopathological changes in the liver of mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain for 2 weeks; Figure B shows the histopathological changes in the liver of mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain for 4 weeks; the arrows in the figure indicate the liver granulomas formed by Brucella infection;

[0036] Fig.12 This is a diagram showing the humoral immunity of mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain in Experimental Example 2 of the present invention;

[0037] Fig.13 It is a graph showing the results of the immune protection test of M5ΔlysR21 as a vaccine in Experimental Example 2 of the present invention; wherein, Figure A shows the results of the spleen bacterial load and spleen weight 30 days after mice were immunized with the deletion strain M5ΔlysR21 and the vaccine strain M5-90Δ26, and 2 weeks after M5 challenge; Figure B shows the results of the spleen bacterial load and spleen weight 45 days after mice were immunized with the deletion strain M5βlysR21 and the vaccine strain M5-90Δ26, and 2 weeks after M5 challenge; Statistical analysis: "ns" indicates that there is no significant difference in the data; "*" indicates that the p value is ≤0.05, and "***" indicates that the p value is ≤0.001, and the data are significantly different;

[0038] Fig.14Figure 2 shows the liver lesions of mice after immune protection by M5ΔlysR21 as a vaccine in Experimental Example 2 of the present invention; Figure A shows the histopathological changes of the liver 30 days after mice were immunized with the deletion strain M5ΔlysR21 and the vaccine strain M5-90Δ26, and 2 weeks after M5 infection; Figure B shows the histopathological changes of the liver 45 days after mice were immunized with the deletion strain M5ΔlysR21 and the vaccine strain M5-90Δ26, and 2 weeks after M5 infection; the arrows in the figure point to the liver granulomas formed by Brucella infection. DETAILED DESCRIPTION

[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0040] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0041] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0042] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0043] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0044] Unless otherwise specified, the chemical reagents, biochemical reagents and materials used in the present invention can be obtained from commercial sources.

[0045] Example 1

[0046] In Example 1 of the present invention, a lysR21 gene deletion strain M5ΔlysR21 was constructed, and the specific method is as follows:

[0047] (1) Primer design:

[0048] The complete genome sequence of Brucella M28 (from NCBI's GenBank, sequence numbers: NC_017244.1, NC_017245.1) was used as a template to design the required primers. The primer sequences are as follows:

[0049] Primer pair for amplifying the upstream homology arm fragment LysR21-U of the lysR21 gene:

[0050] LysR21-UF (SEQ ID NO. 1):

[0051] GGTACCCGGGGATCCATTCCGGCACGATCTATACC;

[0052] LysR21-UR (SEQ ID NO. 2):

[0053] CGGCGTCTGCGGCCGGTTTTTCCCCTCTCATTGTT;

[0054] Primer pair for amplifying the downstream homology arm fragment LysR21-D of the lysR21 gene:

[0055] LysR21-DF (SEQ ID NO. 3):

[0056] TGAGAGGGGAAAAACCGGCCGCAGACGCCGGAATT;

[0057] LysR21-DR (SEQ ID NO.4):

[0058] TGCCTGCAGGTCGACATGCTCAACCAGGCAACCGG;

[0059] Internal identification primers:

[0060] InLysR21-F (SEQ ID NO.5): AGCAGCCGGATCTCATTCAG;

[0061] InLysR21-R (SEQ ID NO.6): GGGCCTTCGAGAACAGGAAA;

[0062] Outer identification primers:

[0063] OutLysR21-F(SEQ ID NO.7):TTTTCATCGCAATCGGCCAC;

[0064] OutLysR21-R (SEQ ID NO. 8): AGACGGCTCATATGACAGCG.

[0065] (2) Amplification and fusion of target genes:

[0066] Using the genome of Brucella melitensis M5 as a template, the upstream homology arm fragment LysR21-U and the downstream homology arm fragment LysR21-D of the lysR21 gene were PCR amplified using the primer pairs LysR21-UF / UR and LysR21-DF / DR, respectively. The PCR amplification system was 50 μL, including 1 μL DNA template (100 ng / μL), 2 μL each of the upstream primer (10 pmol / μL) and the downstream primer (10 pmolμL), 25 μL of 2×PrimeSTAR Max Premix (Takara), and deionized water was added to 50 μL; the PCR reaction conditions were 98°C pre-denaturation for 2 min, 98°C for 10 sec, 55°C for 15 sec, 72°C for 30 sec, 35 cycles, and finally extension at 72°C for 10 min. The PCR product was subjected to 1% agarose gel electrophoresis, and the results were as follows: Figure 1 As shown. Figure 1 It can be seen that the amplified LysR21-U and LysR21-D fragments are about 750 bp in size, which is consistent with the expected results.

[0067] Then, the target gene fragment was recovered by Tiangen agarose gel recovery kit, and the LysR21-U and LysR21-D recovered from gel were used as templates, LysR21-UF / DR were used as primers, and Over1ap-PCR was used to fuse the upstream and downstream fragments. In the 50 μL PCR amplification reaction system, 1 μL of LysR21-U (10-20 ng / μL) and LysR21-D (10-20 ng / μL) recovered from gel were added, 2 μL of upstream primer LysR21-UF (10 pmol / μL) and downstream primer LysR21-DR (10 pmol / μL) were added, and 2× PrimeSTAR MaxPremix (Takara) 25 μL, deionized water to 50 μL; PCR reaction conditions are 98℃ pre-denaturation for 2 min, 98℃ for 10 sec, 55℃ for 15 sec, 72℃ for 1 min, 35 cycles, and finally 72℃ extension for 10 min. PCR products were subjected to 1% agarose gel electrophoresis. The results are as follows: Figure 1 As shown, the upstream and downstream fusion fragment LysR21-UD is approximately 1500 bp, which is consistent with the expected size.

[0068] (3) Construction of suicide plasmid:

[0069] The fusion gene fragment LysR21-UD and the linearized plasmid pKB were connected using a homologous recombination kit (Novagen), and the connected fusion product was transformed into Escherichia coli DH5α competent cells, screened in LB solid medium and liquid medium containing 50μg / mL kanamycin, and PCR bacterial liquid identification was performed using universal primers M13F(-47) / R(-48). The PCR reaction system was 20μL, including 1μL bacterial liquid, 1μL of upstream and downstream primers, 10μL of 2×Taq Master Mix (Novagen), and 7μL of deionized water. The PCR reaction conditions were 95℃ pre-denaturation for 2min, 95℃15sec, 60℃15sec, 72℃1min, 35 cycles, and finally 72℃ extension for 10min.

[0070] Figure 2 The PCR identification results showed that the target fragment size was about 1500bp, which was consistent with the expected result. The correctly identified bacterial solution was expanded in LB liquid medium with kanamycin resistance, and the suicide plasmid was extracted using a small extraction kit (Tiangen), named pKB-ΔlysR21, and the correctly sequenced plasmid was saved for later use.

[0071] (4) Construction of gene-deficient strains:

[0072] Brucella melitensis M5 was purchased from the National Veterinary Microbiological Culture Collection Center. Brucella M5 was cultured in TSB until the early logarithmic growth period (OD 600=0.6~0.8). After placing the bacterial solution on ice for 15~30 minutes, centrifuge at 4℃, 8000×g for 5 minutes to collect the bacterial precipitate. Wash the bacteria twice with pre-cooled sterile deionized water, transfer to a new centrifuge tube during the second wash, centrifuge and discard the supernatant. Add pre-cooled sterile 10% glycerol water to resuspend the bacterial precipitate and divide into 90μL / tube. Add 10μL of recombinant plasmid (2μgpKB-ΔlysR21 plasmid) to the prepared M5 competent cells, mix gently, and ice bath for 10 minutes. Add 100μL of the mixture to the pre-cooled disposable electroporation cup, and electrotransfer the plasmid into the competent cells at 2.4kV, 400Ω. Slowly add 800μL of 37℃ preheated TSB to the electroporation cup and mix by pipetting. Add 900 μL of the mixture to a sterile 2 mL EP tube and mark it. Incubate at 37°C, 220 rpm for 6-8 hours. Centrifuge the bacterial solution at 8000 rpm for 5 minutes, discard 800 μL of supernatant, resuspend and spread all on TSA solid culture medium containing kanamycin, and culture at 37°C and 5% CO2 for 3-5 days. Pick a single colony and culture it in TSB liquid culture medium at 37°C and shake for 2-3 days. After gradient dilution, take 100 μL of the bacterial solution and spread it on TSA solid culture medium containing 5% sucrose for the second round of screening. Use InLysR21-F / R and OutLysR21-F / R as the inner and outer identification primers, respectively, to perform PCR bacterial solution identification. The PCR reaction system and reaction conditions are the same as those described in step (3). The schematic diagram of PCR identification is shown below. Figure 3 shown.

[0073] Depend on Figure 3 It can be seen that when the bacterial liquid was identified by PCR using the inner identification primers InLysR21-F / R, the M5 fragment size of the parental strain was 435bp, and the deletion strain should not have this band; when the bacterial liquid was identified by PCR using the outer primers OutLysR21-F / R, the M5 band size of the parental strain was 1273bp, and the deletion strain had a band size of 367bp due to the deletion of 906bp.

[0074] Figure 4 The PCR identification results showed that the band size of the parent strain M5 was about 435bp when the inner primers were used for PCR identification, and no obvious band amplification was found in the deletion strain M5ΔlysR21. The band size of the parent strain M5 was about 1273bp when the outer primers were used for PCR identification, and the band size of the deletion strain M5ΔlysR21 was about 435bp, and the identification results were consistent with the expected results.

[0075] (5) Western Blot identification of deletion strains:

[0076] TSB was used to culture Brucella melitensis M5 and M5ΔlysR2 for 1 to 48 h, 1.4 mL of each culture was taken into a 1.5 mL EP tube, and the tubes were centrifuged at 10,000 rpm for 5 min. The supernatant was discarded, and 1 mL of PBS was added to resuspend the bacterial pellet. The tubes were centrifuged at 10,000 rpm for 5 min, the supernatant was discarded, and 80 μL of sterile deionized water was added to resuspend the bacterial pellet. The tubes were transferred to new 1.5 mL EP tubes, 20 μL of 5× SDS protein loading buffer was added, and the tubes were centrifuged at 100°C for 10 min and 8,000 rpm for 5 min. The supernatant was taken and set aside.

[0077] Take 10μL protein sample and add it to the SDS-PAGE channel, concentrate gel 80V 30min, separation gel 120V 60min, pre-cool the transfer solution at 4℃ in advance, soak the NC membrane, and place the asbestos mesh-filter paper-gel-NC membrane-filter paper-asbestos mesh in the transfer solution with the black side of the transfer clip facing down. Clamp the transfer clip, pay attention to the NC membrane and the glue to fit, and remove bubbles. Adjust the black interface of the transfer clip to the negative pole of the transfer tank, and the white side to the positive pole of the transfer tank. After filling with transfer solution, transfer the membrane with a constant current of 200mA for 90min, and fill the periphery of the transfer tank with ice cubes.

[0078] After the transfer is completed, take out the membrane and observe that the protein marker is completely transferred from the gel to the membrane. Use PBST to quickly wash off the transfer solution remaining on the membrane. Soak the NC membrane in 5% skim milk, shake slowly, and incubate at room temperature for 1 hour. After blocking, wash off the excess milk with 1×PBST buffer, wash the membrane for 5 minutes each time, for a total of 3 times. Use Anti-LysR21 as the primary antibody, then soak the membrane in the primary antibody and incubate it on a shaker in a 4°C refrigerator overnight. After incubation with the primary antibody, add 1×PBST buffer and place it on a shaker for 5 minutes, for a total of 3 times. Incubate with the secondary antibody and shake slowly at room temperature for 1 hour. After the secondary antibody incubation is completed, wash with 1×PBST for 5 minutes, for a total of 3 times. After washing the membrane, apply the luminescent liquid to the membrane, expose it through a chemiluminescence imager, and save the picture.

[0079] Use antibody stripping solution to strip the antibody, wash with 1×PBST for 5min, 3 times in total. Block with 5% skim milk at room temperature for 1h, wash with 1×PBST for 5min, 3 times in total. Use Anti-GroEL as the primary antibody, then soak the membrane in the primary antibody and incubate overnight on a shaker in a 4°C refrigerator. After incubation with the primary antibody, add 1×PBST buffer and shake on a shaker for 5min, 3 times in total. Incubate with the secondary antibody and shake slowly at room temperature for 1h. After the secondary antibody incubation is completed, wash with 1×PBST for 5min, 3 times in total. Apply the luminescent solution to the membrane, expose it with a chemiluminescent imager, and save the image.

[0080] Figure 5Western Blot results showed that the parent strain M5 expressed the target protein LysR21 at about 35 kDa, while the deletion strain M5ΔlysR21 did not express the target protein. The above results all indicate that the M5ΔlysR21 strain was successfully constructed.

[0081] The lysR21 gene-deficient strain M5ΔlysR21 finally produced is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is November 21, 2024, and the deposit number is CGMCC NO.32791.

[0082] Test Example 1

[0083] This test example 1 verifies the basic phenotypes of the Brucella M5ΔlysR21 strain and the Brucella M5 parent strain prepared in Example 1 of the present invention, and the specific method is as follows:

[0084] (1) Growth curve determination:

[0085] Brucella M5 parent strain and lysR21 gene deletion strain M5ΔlysR21 were cultured in vitro to the logarithmic growth phase and the OD 600 The value was set to 1.0, and the bacterial solution was inoculated into TSB liquid medium at a ratio of 1:10. The culture was carried out at 37°C and 220 rpm. 100 μL of the bacterial solution was taken every 6 h to measure the OD 600 The bacterial growth curve was drawn according to the value. The results are shown in Figure 6 .

[0086] like Figure 6 As shown, in TSB medium, the growth rate of M5ΔlysR21 was consistent with that of the parent strain, indicating that the deletion of the lysR21 gene did not affect the growth ability of Brucella in TSB.

[0087] (2) Tolerance test

[0088] The overnight cultured Brucella M5 parent strain and M5ΔlysR21 deletion strain were adjusted to OD 600 =1.0, dilute the bacterial solution with PBS 10-fold gradient to 5×10 5 CFU / mL, the obtained bacterial solution was subjected to the following experiments:

[0089] A. Hydrogen peroxide tolerance test: Use sterile PBS to dilute H2O2 to working concentrations of 2mM, 4mM and 8mM. In a 1.5mL EP tube, take 50μL of H2O2 solution and mix it with 50μL of diluted bacterial solution (at this time, the final concentrations of H2O2 solution are 1mM, 2mM and 4mM, respectively). Incubate at 37℃ and 220rpm for 1h, and set up a PBS control group. After the incubation, add 900μL of sterile PBS and mix well to terminate the reaction. Dilute it 10 times and take 100μL of the suspension to spread on TSA solid culture medium. Culture at 37℃ for 3-5 days, count the bacterial CFU, and calculate the bacterial survival rate. Three replicates are set for each group of experiments for each strain. The results are as follows: Figure 7 As shown in A. (Bacterial survival rate = bacterial CFU of the treatment group / bacterial CFU of the PBS control group × 100%).

[0090] B. Prepare TSA medium containing sodium nitroprusside (SNP) with a final concentration of 0.5 mM SNP. Adjust the above-transferred bacterial solution to OD 600 =1.0, and the bacterial solution was diluted 10-fold with sterile PBS to a concentration of 5×10 9 CFU / mL, 5×10 8 CFU / mL, 5×10 7 CFU / mL, 5×10 6 CFU / mL, 5×10 5 CFU / m and 5×10 4 CFU / mL, take 2μL of the diluted culture medium and add it to 0.5mM SNPTSA culture medium, culture it in a 37℃ incubator for 5-6 days, and use TSA without SNP as the control group to observe the morphology, size and number of colonies. The results are as follows Figure 7 As shown in B.

[0091] Depend on Figure 7 As shown in A and B, there is no significant difference in tolerance between the M5ΔlysR21 strain and the parent strain M5 in H2O2 solution with a final concentration of 1mM, and the M5ΔlysR21 strain has significantly lower tolerance than the parent strain M5 in H2O2 solutions with final concentrations of 2mM and 4mM, indicating that the lysR21 deletion weakens the ability of Brucella to resist oxidative stress; in addition, the M5ΔlysR21 strain has significantly lower tolerance than the parent strain M5 in TSA medium containing 0.5mM SNP, while there is no difference in growth between the deletion strain and the parent strain on TSA plates without SNP, indicating that the lysR21 gene deletion weakens the ability of Brucella to resist nitrogen stress.

[0092] Test Example 2

[0093] This test example 2 evaluates the virulence and immune protection of the Brucella M5ΔlysR21 strain prepared in Example 1 of the present invention, and the specific steps are as follows:

[0094] (1) Brucella M5ΔlysR21 strain adhesion, invasion and intracellular survival assay

[0095] A. Brucella M5ΔlysR21 strain adhesion and invasion cell test:

[0096] The overnight cultured Brucella M5 parent strain and M5ΔlysR21 deletion strain were adjusted to OD 600 =1.0.

[0097] One day in advance, mouse macrophages RAW264.7 were cultured at a rate of 2.5-3×10 5 The cells were inoculated into 24-well cell culture plates at a concentration of 1 mL per well and cultured for 20-24 hours until the cells grew to a monolayer. Macrophages were synchronously infected at a multiplicity of infection (MOI) of 100:1 (bacteria: cells) by centrifugation at 400×g for 5 minutes. After culturing for 1 hour at 37°C and 5% CO2, the infection time was counted as 0. After the cell infection was completed, the cells were washed three times with PBS, 200 μL of 0.25% Triton-X 100 PBS solution was added to each well to lyse the cells, 100 μL of cell lysate was diluted 10 times in a gradient manner and plated, cultured in a 37°C, 5% CO2 incubator for 3-4 days, CFU was counted, and the original CFU of each well was calculated, which was the amount of adherent bacteria at this time; after the cell infection was completed, the cells were washed three times with PBS and treated with gentamicin (100 μg / mL) for 1 hour to kill extracellular bacteria. Wash three times with PBS, add 200 μL of 0.25% Triton-X 100 PBS solution to each well to lyse the cells, take 100 μL of cell lysate and dilute it 10 times, take 100 μL to hang the plate, culture it at 37℃, 5% CO2 environment for 3-4 days, count the bacterial CFU, and calculate the original CFU of each well, which is the amount of invading bacteria. The results are as follows: Figure 8 shown.

[0098] Depend on Figure 8 It can be seen that in the RAW264.7 cell infection group, the ability of the M5ΔlysR21 strain to adhere to RAW264.7 cells and to invade RAW264.7 cells were similar to those of the parental strain M5, indicating that the deletion of the lysR21 gene did not affect the ability of Brucella to adhere to and invade RAW264.7 cells.

[0099] B. Intracellular survival assay:

[0100] The cells were infected according to the infection steps in the Brucella M5ΔlysR21 strain adhesion and invasion cell test. After the cell infection was completed, DMEM containing 100 μg / mL gentamicin was used to culture for 1 h to kill extracellular bacteria. The cells were washed with PBS 3 times. After washing away the extracellular bacteria, the culture medium was replaced with a DMEM solution containing 50 μg / mL gentamicin and 2% FBS to maintain the cells. The cell plate was taken out 1 h, 24 h, 48 h and 72 h after infection, and the cells were washed with PBS 3 times. 200 μL of 0.25% Triton-X 100 PBS solution was added to each well to lyse the cells for 15 min. 100 μL of cell lysate was taken and diluted 10 times in a gradient manner and then hung on the plate. The cells were cultured at 37°C and 5% CO2 for 3-4 days, the CFU was counted, and the original CFU of each well was calculated. The Brucella intracellular survival curve was drawn. The results are shown in FIG. Fig. 9 shown.

[0101] Depend on Fig. 9 It can be seen that the M5ΔlysR21 deletion strain showed the same intracellular bacterial load in the early stage of infection when infecting RAW264.7 cells compared with the parental strain M5. As the infection time extended, the intracellular survival ability of the M5ΔlysR21 deletion strain was significantly weakened. The results indicate that the deletion of the lysR21 gene weakens the ability of Brucella to survive intracellularly.

[0102] (2) Pathogenicity test in mice:

[0103] The overnight cultured Brucella M5 parent strain and M5ΔlysR21 deletion strain were adjusted to OD 600 =1.0. (At this time, the bacterial concentration is about 5×10 9 CFU / mL), and the bacterial solution was diluted to 1×10 7 CFU / mL.

[0104] Thirty female BALB / c mice aged 6-8 weeks were divided into M5, M5ΔlysR21 and PBS inoculation groups, with 15 mice in each group. Each mouse was intraperitoneally inoculated with 0.1 mL of bacterial suspension (containing 1×10 6 CFU), and the non-infected group was inoculated with PBS as a negative control. At the 2nd and 4th week after infection, 5 mice were taken from each group and killed by rapid cervical dislocation. The spleen was taken, the degree of spleen swelling was observed, and the spleen weight was weighed; 3mL 0.25% Triton-X 100PBS solution was added to the spleen for grinding, and after 10-fold gradient dilution, 100μL was taken for hanging plate, bacterial CFU was counted, the original bacterial load in each spleen was estimated, and a bar graph was drawn to evaluate the residual virulence of the bacteria. The results are shown in Figure 2. Fig.10 shown.

[0105] Depend on Fig.10It can be seen that 2 weeks after the bacteria were inoculated into mice, the bacterial load and spleen weight of mice infected with M5ΔlysR21 were significantly lower than those of the M5 parental strain; 4 weeks after the bacteria were inoculated into mice, the bacterial load of mice infected with M5ΔlysR21 was significantly lower than that of the M5 parental strain, and there was no significant difference in the spleen weight of mice infected with M5ΔlysR21 compared with the M5 parental strain.

[0106] To further evaluate the pathogenicity of M5 and M5ΔlysR21, the livers of mice were removed and fixed in 4% paraformaldehyde for 24 to 48 h. The livers were then sent to Wuhan Seville Company for tissue section preparation and HE staining to observe the pathological changes in the liver. Fig.11 shown.

[0107] Depend on Fig.11 It can be seen that compared with the M5 inoculation group, mice inoculated with the M5ΔlysR21 deletion strain significantly weakened the formation of liver granulomas induced by Brucella infection; in summary, the experimental results show that the deletion of the lysR21 gene significantly weakened the pathogenicity of the Brucella M5 strain to mice.

[0108] (3) Antibody level determination:

[0109] In order to evaluate the antibody level of M5 and M5ΔlysR21 after infection of mice, the sera of mice infected with the virus for 2 weeks and 4 weeks were taken for ELISA assay. M5 whole bacterial protein was coated on a 96-well plate, 25 μg / well, overnight at 4°C. Washed three times with 1×PBST, 5 minutes each time, blocked with 5% skim milk at room temperature for 2 hours, washed three times with 1×PBST, 5 minutes each time, incubated with primary antibody (200-fold diluted mouse serum), 100 μL / well, incubated at 37°C for 1 hour, washed three times with 1×PBST, 5 minutes each time, incubated with secondary antibody (1:20000 times diluted IgM, IgG, IgG1, IgG2a), 100 μL well, incubated at 37°C for 1 hour, washed three times with 1×PBST, 5 minutes each time, added TMB substrate colorimetric solution 100 μL / well, incubated in dark for 20 minutes, added 100 μL / well stop solution and incubated at OD within 5 minutes. 450 The antibody titer was measured as follows. Fig.12 shown.

[0110] Depend on Fig.12It can be seen that at 2 weeks and 4 weeks of immunization, the M5 and M5ΔlysR21 immunization groups induced higher levels of IgM, IgG, IgG1 and IgG2a antibodies in mice compared with the PBS group. Compared with mice immunized for 2 weeks, the IgM antibody level showed a downward trend in mice immunized for 4 weeks, which is consistent with the results of IgM's participation in the early immune response of Brucella. The IgG and 1gG2a antibody levels remained basically unchanged at 2 weeks and 4 weeks of immunization, and the IgG1 antibody level showed an upward trend. However, whether the mice were immunized for 2 weeks or 4 weeks, the level of IgG2a in their serum was significantly higher than that of IgG1. It can be seen that the IgG2a antibody level dominated its immune response, indicating a bias towards Th1-type immune response.

[0111] (4) Immunoprotective test:

[0112] The Brucella M5ΔlysR21 deletion strain and M5-90Δ26 vaccine strain cultured overnight were adjusted to OD 600 =1.0 (At this time, the bacterial concentration is about 5×10 9 CFU / mL). The bacterial solution was diluted with PBS to about 1×10 6 CFU / mL. Thirty female BALB / c mice aged 6-8 weeks were divided into PBS group, M5ΔlysR21 group and M5-90Δ26 group, with 5 mice in each group. Each mouse was treated with 1×10 5 CFU dose immunization (0.1 mL / mouse), PBS group mice intraperitoneally injected with 0.1 mL PBS, 30 days or 45 days after vaccination, 1×10 5 All mice were challenged with M5 at a dose of 1000 CFU / mouse. Two weeks after the challenge, all mice were quickly killed by dislocating the neck, and the spleens of the mice were taken out to observe the degree of spleen swelling and weigh the spleens. 3 mL of 0.25% Triton-X100 PBS solution was added to the spleens for grinding. After 10-fold gradient dilution, 100 μL was taken for hanging plates to count the bacterial CFU and estimate the original bacterial load of the spleens. The results are shown in Fig.13 shown.

[0113] Depend on Fig.13 It can be seen that 2 weeks after the M5 virus attack, the Brucella load in the spleen of the mice immunized with M5ΔlysR21 and M5-90Δ26 was significantly decreased compared with the PBS vaccination group, and the difference was significant; compared with the M5ΔlysR21 and M5-90Δ26 vaccination groups, the Brucella load in the spleen of the mice immunized with M5ΔlysR21 was lower, and the difference was significant. The spleen weight results showed that compared with the PBS vaccination group, the spleen weight of the mice immunized with M5ΔlysR21 and M5-90Δ26 was significantly decreased, and the difference was significant; while there was no significant difference in the spleen weight of the mice immunized with M5ΔlysR21 and M5-90Δ26.

[0114] To further evaluate the immune protection of the M5ΔlysR21 and M5-90Δ26 vaccine strains, the livers of mice challenged with M5 for 2 weeks were removed 30 and 45 days after immunization, respectively. They were fixed in 4% paraformaldehyde for 24 to 48 hours and then sent to Wuhan Seville Company for tissue section preparation and HE staining to observe the pathological changes of the liver. The results are as follows: Fig.14 shown.

[0115] Depend on Fig.14 It can be seen that in the 30-day vaccination group, compared with the PBS vaccination group, the formation of liver granulomas induced by Brucella infection was significantly reduced in mice vaccinated with M5ΔlysR21 and M5-90Δ26 vaccine strains; almost no granulomas were seen in M5ΔlysR21, and scattered small granulomas were seen in individual locations of M5-90Δ26. In the 45-day vaccination group, no obvious granuloma formation was observed in the livers of mice vaccinated with M5ΔlysR21 and M5-90Δ26 vaccine strains.

[0116] In summary, the present invention constructs the M5ΔlysR21 strain by deleting the lysR21 gene. Compared with the original Brucella M5 strain, the virulence of the M5ΔlysR21 strain is weakened, and its survival ability in cells and mice is significantly reduced. Compared with the M5-90Δ26 vaccine, it has stronger immune protection and can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis.

[0117] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A Brucella attenuated live vaccine strain M5ΔlysR21, characterized in that: The Brucella live attenuated vaccine strain M5ΔlysR21 is obtained by deleting the lysR21 gene from the Brucella melitensis M5 strain. The Brucella live attenuated vaccine strain M5ΔlysR21 is deposited in the General Microbiology Center of the China Culture Collection Administration, with the address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The preservation date is November 21, 2024, and the preservation number is CGMCC NO.32791.

2. A method for attenuating Brucella, characterized in that: The method comprises the step of knocking out or deleting the lysR21 gene in Brucella, and the Brucella is Brucella melitensis M5 strain.

3. The Brucella attenuation method as claimed in claim 2, characterized in that: The specific steps include: (1) PCR amplified the upstream and downstream homology arm fragments of the lysR21 gene, and after the amplification, the two fragments were fused by fusion PCR to obtain a fusion fragment; (2) Connecting the fusion fragment to the linearized suicide plasmid pKB by homologous recombination to obtain a recombinant plasmid, and obtaining the suicide plasmid pKB-ΔlysR21 after screening and extraction; (3) The suicide plasmid pKB-ΔkysR21 was electroporated into Brucella melitensis M5 competent cells, and the M5ΔlysR21 deletion strain was obtained after double screening.

4. The Brucella attenuation method as claimed in claim 3, characterized in that: In step (1), the primer sequences used in the PCR amplification of the upstream and downstream homology arm fragments of the lysR21 gene are as shown in SEQ ID NO.14, wherein the primer sequences such as LysR21-UF shown in SEQ ID NO.1 and LysR21-UR shown in SEQ ID NO.2 are used to amplify the upstream homology arm fragment, the primer sequences such as LysR21-DF shown in SEQ ID NO.3 and LysR21-DR shown in SEQ ID NO.4 are used to amplify the downstream homology arm fragment, and the primer set used in the fusion PCR is LysR21-UF shown in SEQ ID NO.1 and LysR21-DR shown in SEQID NO.

4.

5. The Brucella attenuation method as claimed in claim 3, characterized in that: In step (2), the screening method is to transfer the recombinant plasmid into Escherichia coli DH5a competent cells, screen the kanamycin-resistant strains in LB solid medium and liquid medium containing kanamycin, then perform PCR bacterial liquid identification, and extract the pKB-ΔlysR21 suicide plasmid.

6. The Brucella attenuation method according to claim 3, characterized in that: In step (3), the double screening method is: the suicide plasmid pKB-ΔlysR21 extracted in step (2) is electrotransformed into Brucella competent cells, the product is coated on TSA solid culture medium containing kanamycin, monoclonal bacteria are picked and cultured in TSB liquid culture medium, and then negatively screened in TSA solid culture medium containing 5% sucrose, monoclonal colonies are picked and cultured in TSB liquid culture medium, and the M5ΔlysR21 deletion strain is identified by PCR bacterial liquid using inner identification primers and outer identification primers.

7. The Brucella attenuation method according to claim 6, characterized in that: The inner identification primers are InLysR21-F as shown in SEQ ID NO.5 and InLysR21-R as shown in SEQ ID NO.6; the outer identification primers are OutLysR21-F as shown in SEQ ID NO.7 and OutLysR21-R as shown in SEQ ID NO.

8.

8. Use of the attenuated live Brucella vaccine strain M5ΔlysR21 according to claim 1 or the attenuated Brucella obtained by the Brucella attenuation method according to any one of claims 2 to 7 in the preparation of a preparation for preventing brucellosis.

9. The use according to claim 8, characterized in that The preparation is a live attenuated Brucella vaccine.

Images