A RNAkines combination and screening method and application thereof

Abstract

The present invention discloses an RNAkines combination, characterized in that it comprises: miR-300, miR-487b, and miR-541; the nucleic acid sequence of the miR-300 is shown in SEQ ID NO.1; the nucleic acid sequence of the miR-487b is shown in SEQ ID NO.2; and the nucleic acid sequence of the miR-541 is shown in SEQ ID NO.3. Experiments conducted on mice based on the RNAkines combination of the present invention show that the RNAkines combination has the effects of anti-aging, improving exercise ability, and improving aging-related secretion in mice.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an RNAkines combination and a screening method and application thereof. Background Art

[0002] Aging is a complex biological process involving the regulation of multiple genes and molecular pathways. The aging process is not only caused by the accumulation of numerous mutations that hinder the normal function of normal genes; it may also be caused by age-related changes in epigenetic levels. In recent years, more and more reports have focused on the relationship between epigenetic changes and aging, revealing a series of biological processes closely related to aging, such as post-transcriptional regulation, including microRNA (miRNA), which plays an important role in the aging process. MiRNA is a class of short non-coding single-stranded RNAs with a length of about 22 nt. It regulates gene expression by binding to the 3' untranslated region (UTR) of the target mRNA, inhibiting its translation or promoting its degradation. During the aging process, the expression profile of miRNA changes significantly, affecting cell function and tissue homeostasis. This suggests that miRNA may have a broad application potential, because it can not only be used to mediate gene silencing, but also play a regulatory role in different biological processes (e.g., cell proliferation, apoptosis, development, and differentiation). More and more evidence shows that changes in miRNA expression are not only related to age-related diseases, but also to changes in aging itself.

[0003] It is worth noting that in addition to playing a role in gene regulation within cells, newly generated miRNAs are also transported out of cells and reach remote tissues and organs through the circulatory system, thereby regulating their genes. This function of mediating inter-organ communication has received increasing attention in recent years. On the one hand, this suggests that miRNA dysregulation caused by aging is a systemic process, and on the other hand, it poses new challenges for the identification of key miRNAs for inter-organ communication in aging. Since this type of miRNA secreted to the extracellular space to mediate communication is strictly regulated and has great commonality with traditional signaling molecules in secretion regulation and function, this type of miRNA is defined as RNAkine, and the relationship between RNAkine and aging is still lacking in research.

[0004] With the development of next-generation sequencing technology, more and more miRNAs related to aging have been identified. For example, miR-29 affects the remodeling of the extracellular matrix and tissue aging by regulating multiple genes (such as MMP2 and COL1A1). At the same time, a large amount of sequencing data related to aging is continuously produced, but there is a lack of effective analysis and processing methods. And there are three questions that need to be studied. The first is whether these miRNAs related to aging are RNAkines, that is, whether they will systemically affect other tissues and organs throughout the body. The second is which miRNAs play a dominant role in the aging process. The third is whether artificial regulation of these dysregulated miRNAs (or RNAkines) can delay aging or even reverse aging. Summary of the invention

[0005] The purpose of the present invention is to provide an RNAkines combination and its screening method and application for anti-aging, improving athletic ability, improving aging-related secretion, etc. The above purpose is achieved through the implementation of the following technical solutions:

[0006] An RNAkines combination, including: miR-300, miR-487b, miR-541;

[0007] The nucleic acid sequence of miR-300 is shown in SEQ ID NO.1;

[0008] The nucleic acid sequence of miR-487b is shown in SEQ ID NO.2;

[0009] The nucleic acid sequence of miR-541 is shown in SEQ ID NO.3.

[0010] The nucleic acids used for the in vivo self-assembly expression of the RNAkines combination include: miR-300 in vivo self-assembly expression sequence, miR-487b in vivo self-assembly expression sequence, and miR-541 in vivo self-assembly expression sequence;

[0011] The miR-300 in vivo self-assembly expression sequence is shown in SEQ ID NO.4;

[0012] The miR-487b in vivo self-assembly expression sequence is shown in SEQ ID NO.5;

[0013] The miR-541 in vivo self-assembly expression sequence is shown in SEQ ID NO.6.

[0014] A vector comprising the above-mentioned RNAkines combination.

[0015] The vector includes at least one of a plasmid vector and an AAV virus vector.

[0016] A kit comprises: at least one of the above-mentioned RNAkines combination, the nucleic acid for in vivo self-assembly expression of the above-mentioned RNAkines combination, or the above-mentioned vector.

[0017] RNAkines combination screening methods, including:

[0018] Step 1) Obtaining miRNA dataset;

[0019] Step 2) screening the miRNA dataset based on time series cluster analysis to select RNAkines closely related to aging to obtain a first RNAkines set;

[0020] Step 3) Screening out RNAkines that mainly affect the aging process in different tissues and organs from the first RNAkines set to obtain a second RNAkines set;

[0021] Step 4) Using the CNN large language model, conserved oligonucleotide motifs in different species are extracted from the second RNAkines set, and the sequences are posted back to the genome through bowtie to screen and obtain RNAkines combinations.

[0022] Optionally, the method of obtaining the miRNA dataset in step 1) includes: collecting miRNA sequencing datasets of various species, age groups, and tissues and organs in public databases, and classifying them according to species, sex, age, and tissue sample source.

[0023] Optionally, step 1) also includes performing quality control on the collected sequencing data set to filter out low-quality sequencing samples.

[0024] Optionally, in the step 3), a LASSO regression model and a support vector machine model are used to screen out RNAkines that mainly affect the aging process in different tissues and organs from the first RNAkines set to obtain a second RNAkines set.

[0025] The use of the above-mentioned RNAkines combination, nucleic acid, vector or kit in the preparation of drugs for anti-aging, improving athletic ability, and improving aging-related secretion.

[0026] The present invention has the following beneficial effects:

[0027] The present invention provides an RNAkines combination. Experiments conducted on mice based on the RNAkines combination show that the RNAkines combination has the effects of resisting aging, improving exercise capacity, and improving aging-related secretions in mice.

[0028] The present invention also proposes a screening method for anti-aging RNAkines combination, which uses machine learning to assist in analyzing the massive data sets generated by second-generation sequencing, and then mines out potential systemic and aging-related miRNAs.

[0029] The present invention utilizes the in vivo self-assembling miRNA system to help us verify the systemic anti-aging and rejuvenation effects of artificially regulating these dysregulated miRNAs in vivo. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 .Anti-aging RNAkines Upset Plot after screening by the above machine learning algorithm. It can be seen that the RNAkines shared by multiple tissues are the most conservative and most widely screened anti-aging RNAkines.

[0032] Figure 2 .The effect of the in vivo self-assembled RNAkines gene circuit in mice; RNAkines is the experimental group and PBS is the control group; Figure 2 A shows the coat condition of mice in each group after short-term administration; Figure 2 B is the aging index score of mice after short-term administration; Figure 2 C is the MVCC index of mice after long-term administration, reflecting the motor ability; Figure 2 D is the survival curve of mice after long-term administration; Figure 2 E is H&E staining and hair follicle counting of mouse epidermis after short-term administration; Figure 2 F is SA-β-gal staining of the main tissues and organs of mice after short-term administration, royal blue indicates senescent tissue cells; Figure 2 G is the Ki-67 immunofluorescence of the main tissues and organs of mice after short-term administration. The blue fluorescence represents the cell nucleus and the red fluorescence represents the proliferation signal, reflecting the tissue rejuvenation effect; Figure 2 H is the aging-related secretory phenotype of mice after short-term administration, normalized by the max-min method. DETAILED DESCRIPTION

[0033] Now, various exemplary embodiments of the present invention are described in detail, and this detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present invention. It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention.

[0034] In addition, for the numerical range in the present invention, it is understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0035] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the invention pertains. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention.

[0036] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0037] Example 1

[0038] Using artificial intelligence models to screen RNAkines for anti-aging includes the following steps:

[0039] Step 1) Collect small RNA sequencing datasets of various species, age groups, and tissues and organs from public databases (such as GEO), and classify them according to species, sex, age, and tissue sample source. Use fastqc to perform quality control on the collected sequencing datasets and filter low-quality sequencing samples. Then remove the batch effects between different sequencing platforms and tissue samples, and integrate all relevant datasets for subsequent analysis.

[0040] Step 2) First, RNAkines closely related to aging are screened out based on mFuzz based on time series clustering screening, that is, different clusters clustered out should increase or decrease with the increase of age, and the first RNAkines set is obtained.

[0041] Step 3) Then, the differentially expressed genes (DEGs) of the generated first RNAkines set data were subjected to algorithms such as LASSO and support vector machine to construct the expression relationship between RNAkines and age, gender and organs, and by combining the miRNA regulatory network, the RNAkines that mainly affect the aging process in different tissues and organs were screened, i.e., p < 0.05, |log2FC| > 1.5; the second RNAkines set was obtained.

[0042] Step 4) The CNN large language model is then used to extract the conserved oligonucleotide motifs in different species of the second RNAkines set, and the motifs are posted back to the genome through bowtie to screen out the evolutionarily conserved RNAkines combination that is closely related to aging. The final RNAkines combination includes miR-300, miR-487b and miR-541, and their sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

[0043] sequence name sequence miR-300 TATGCAAGGGCAAGCTCTCTTC miR-487b AATCGTACAGGGTCATCCACTT miR-541 AAGGGATTCTGATGTTGGTCACACT

[0044] Finally, the ROC curve was used to evaluate the evaluation efficiency of key RNAkines for aging and lifespan, and the Spearman test was used to analyze the correlation between key RNAkines and lifespan. After testing, the RNAkines combination of the present invention has a strong correlation with aging and lifespan.

[0045] Example 2

[0046] In this embodiment, the in vivo self-assembling RNAkines gene loop is constructed, including the following steps:

[0047] Using the improved pcDNA6.2 vector, the vector promoter was replaced from U6 to CMV promoter. The desired anti-aging RNAkines combination was cloned into the MCS region, and the expression and secretion of exogenous anti-aging RNAkines were mediated by the miR-155 backbone. Specifically, the sense strand and antisense strand of RNAkines were cloned into the sense strand and antisense strand on both sides of the miR-155 backbone loop sequence, and the 9-10 nucleic acid of the antisense strand of RNAkines was deleted to ensure that only the sense strand would be cut and matured.

[0048]

[0049]

[0050] In the present invention, an AAV8 vector (adeno-associated virus 8) is constructed as a vector for the above-mentioned RNAkines. The AAV8 vector is a non-pathogenic single-stranded DNA virus belonging to a virus family that depends on a helper virus. The genome of AAV8 contains a single-stranded DNA of approximately 4.7 kb in size, surrounded by two reverse complementary short terminal repeat sequences (ITR). These ITR sequences play a key role in the gene introduction process of AAV8 and can bind to the chromosomes of host cells, thereby achieving the integration of the AAV8 genome. AAV8 vectors have a wide range of applications in gene therapy. Due to its wide range of infection ability and good safety, AAV8 can infect many types of cells, including hepatocytes, cardiomyocytes, and neurons. In addition, AAV8 exhibits low immunogenicity and cytotoxicity in vivo, making it an ideal choice for gene therapy. In this embodiment, an AAV8 vector for delivering the above-mentioned RNAkines in vivo self-assembly expression motif is constructed, and the miR-300 in vivo self-assembly expression motif, the miR-487b in vivo self-assembly expression motif and the miR-300 in vivo self-assembly expression motif are connected in series (as shown in SEQ ID NO.7) to form the RNAkines core component, which is delivered by the above-mentioned AAV8 vector.

[0051] Test example

[0052] 1. In vivo self-assembly of anti-aging RNAkines extends the lifespan of mice

[0053] The effect of the patented RNAkines combination on extending the lifespan of mice was verified in a natural aging mouse model at 18 months of age. 11 After the core components of RNAkines delivered by AAV8 (i.e., the serially expressed miR-300 self-assembly expression motif, miR-487b self-assembly expression motif, and miR-300 self-assembly expression motif) were injected into the tail vein of GC / mouse, the mice were continuously raised in the SPF barrier facility, the survival period of the mice was recorded, and the survival curve was drawn. The results showed that in naturally aged mice (such as those given AAV8 delivery-mediated long-term expression and secretion of RNAkines), the long-term expression of RNAkines was significantly reduced. Figure 2 (D) The survival curve of mice after long-term administration.

[0054] 2. In vivo self-assembled anti-aging RNAkines improve the motor ability of mice

[0055] The effect of the patented RNAkines combination on the exercise capacity of mice was verified in a natural aging mouse model. After administering the RNAkines core components delivered by AAV8 (i.e., the tandemly expressed miR-300 in vivo self-assembly expression motif, miR-487b in vivo self-assembly expression motif, and miR-300 in vivo self-assembly expression motif), the mice were kept in an SPF barrier facility until 22 months of age. It has been previously reported that mice began to develop spontaneous sarcopenia at 21 months of age, and the maximum voluntary load test was ( MVCC ) It can comprehensively reflect the limb strength and motor coordination of mice. The MVCC results showed that the motor ability of 22-month-old mice was significantly improved. Figure 2 C).

[0056] 3. Anti-aging and revitalizing effects of in vivo self-assembled anti-aging RNAkines on major organs

[0057] The patented RNAkines combination was verified in a natural aging mouse model to have an anti-aging and rejuvenating effect on various tissues and organs of mice. After a short-term administration of the gene loop to naturally aged mice, tissue sections were taken and related staining was performed. SA-β-gal staining showed a decrease in senescent cells in major organs, while Ki-67 immunofluorescence results showed an increase in rejuvenated cells in major tissues and organs. (e.g. Figure 2 F. Figure 2 G)

[0058] 4. The revitalizing effect of in vivo self-assembled anti-aging RNAkines on hair regeneration

[0059] The role of the patented RNAkines combination in mouse hair regeneration was verified in a naturally aged mouse model. After a short-term administration of the gene loop to naturally aged mice, it was observed that the number and color of the mouse hair were significantly restored. After staining the skin tissue sections, it was found that the number of hair follicles in the mice increased and the Ki-67 proliferation signal was enhanced. (e.g. Figure 2 A, Figure 2 E, Figure 2 G)

[0060] 5. In vivo self-assembled anti-aging RNAkines improve the aging-associated secretory phenotype (SASP) of mice

[0061] The role of the patented RNAkines combination in the mouse aging-associated secretory phenotype (SASP) was verified in a natural aging mouse model. After short-term administration of the gene loop to natural aging mice, the expression level of the core SASP was detected, and it was found that key SASPs such as GDF15, STC1, TIMP1, and TIMP2 were significantly restored (e.g. Figure 2H). The aging index score of mice decreased significantly after short-term administration ( Figure 2 B).

[0062] In summary, the RNAkines combination of the present invention has the effects of anti-aging, improving motor ability, and improving aging-related secretion in mice

[0063] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. An RNAkines combination, characterized in that include: miR-300, miR-487b, miR-541; The nucleic acid sequence of miR-300 is shown in SEQ ID NO.1; The nucleic acid sequence of miR-487b is shown in SEQ ID NO.2; The nucleic acid sequence of miR-541 is shown in SEQ ID NO.

3.

2. A nucleic acid for in vivo self-assembly expression of the RNAkines combination according to claim 1, characterized in that: include: miR-300 in vivo self-assembly expression sequence, miR-487b in vivo self-assembly expression sequence, miR-541 in vivo self-assembly expression sequence; The miR-300 in vivo self-assembly expression sequence is shown in SEQ ID NO.4; The miR-487b in vivo self-assembly expression sequence is shown in SEQ ID NO.5; The miR-541 in vivo self-assembly expression sequence is shown in SEQ ID NO.

6.

3. A carrier, characterized in that The vector comprises the RNAkines combination of claim 1.

4. The carrier according to claim 3, characterized in that The vector includes at least one of a plasmid vector and an AAV virus vector.

5. A kit, characterized in that: include: At least one of the RNAkines combination of claim 1, the nucleic acid of claim 2, or the vector of claim 3 or 4.

6. The method for screening RNAkines combination according to claim 1, characterized in that: include: Step 1) Obtaining miRNA dataset; Step 2) screening the miRNA dataset based on time series cluster analysis to select RNAkines closely related to aging to obtain a first RNAkines set; Step 3) Screening out RNAkines that mainly affect the aging process in different tissues and organs from the first RNAkines set to obtain a second RNAkines set; Step 4) extracting conserved oligonucleotide motifs in different species from the second RNAkines set, and posting them back to the genome to screen and obtain RNAkines combinations.

7. The method for screening the RNAkines combination according to claim 6, characterized in that: The method of obtaining the miRNA dataset in step 1) includes: collecting miRNA sequencing datasets of various species, age groups, and tissues and organs in public databases, and classifying them according to species, sex, age, and tissue sample source.

8. The method for screening the RNAkines combination according to claim 6, characterized in that: The step 1) also includes performing quality control on the collected sequencing data set and filtering low-quality sequencing samples.

9. The method for screening the RNAkines combination according to claim 6, characterized in that: In the step 3), the LASSO regression model and the support vector machine model are used to screen out RNAkines that mainly affect the aging process in different tissues and organs from the first RNAkines set to obtain a second RNAkines set; In the step 4), the conserved oligonucleotide motifs in different species are extracted from the second RNAkines set using the CNN large language model, and are posted back to the genome through bowtie to screen and obtain the RNAkines combination.

10. Use of the RNAkines combination of claim 1, the nucleic acid of claim 2, the vector of claim 3 or 4, or the kit of claim 5 in the preparation of drugs for anti-aging, improving athletic ability, and improving aging-related secretion.

Images