Tumor intervention target and application thereof

Abstract

The invention discloses a tumor intervention target and application thereof, the tumor intervention target is a C9ORF50 gene, and the gene sequence of the C9ORF50 gene is as shown in SEQ ID NO. 1. According to the invention, it is found for the first time that down-regulation of C9ORF50 gene expression is used for treating colorectal cancer, liver cancer, pancreatic cancer, breast cancer and melanoma, and the C9ORF50 gene expression has the advantages of targeting, good treatment effect and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a tumor intervention target and application thereof. Background Art

[0002] Colorectal cancer is the third most common cancer in the world and one of the most lethal cancers. At present, surgery and chemotherapy are still the main treatments for colorectal cancer. However, due to the limitations of surgical treatment and the drug resistance of chemotherapy, most cancer patients face problems such as tumor recurrence, which is a major challenge facing clinical treatment.

[0003] In recent years, targeted therapy for functional molecules specifically expressed by tumors and tumor immunotherapy that regulates the body's anti-tumor immune response have made great progress in the field of precision medicine. However, there are currently very limited targeted therapeutic drugs for colorectal cancer (antibodies to epidermal growth factor receptor, vascular endothelial growth factor receptor, and human epidermal growth factor 2 receptor), and there is a shortage of available targeted drugs; at the same time, there are few means to regulate the body's anti-tumor immune response to colorectal cancer, and classic tumor immunotherapy such as checkpoint blockade therapy (anti-PD-1 or anti-PD-L1) can only benefit a very small number of patients, which seriously restricts the treatment of colorectal cancer patients. Therefore, providing a new tumor treatment target is an urgent problem to be solved in the treatment of colorectal cancer patients.

[0004] C9ORF50 (1700001o22Rik) is a protein-coding gene. Methylation modification of the C9ORF50 gene can be used as a diagnostic marker for esophageal cancer, gastric cancer and colorectal cancer. However, the research on the C9ORF50 gene in the prior art is still very scarce, and its role in tumors such as colorectal cancer is not well understood, and the relationship between the expression level of the C9ORF50 gene and the occurrence and development of tumors has not been reported. Therefore, this field still needs to further clarify the relationship between the C9ORF50 gene and colorectal cancer, and on this basis, find drugs that can affect the expression of C9ORF50, so as to achieve the purpose of treating colorectal cancer. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide an action target of an anti-tumor drug and its use.

[0006] In order to solve the above technical problems, the present invention provides a tumor intervention target, wherein the tumor intervention target is the C9ORF50 gene, and the gene sequence of the C9ORF50 gene is shown in SEQ ID NO.1.

[0007] Based on a general technical concept, the present invention also provides an application of the tumor intervention target in the preparation of a detection kit for detecting the prognosis of tumor patients. The tumor includes colorectal cancer, liver cancer, pancreatic cancer, breast cancer or melanoma.

[0008] The above application further detects the prognosis of tumor patients by detecting the expression level of C9ORF50 gene. When the expression level of C9ORF50 is higher than the normal value, the prognosis of the tumor patient is poor and the future survival rate is low; when the expression level of C9ORF50 is lower than the normal value, the prognosis of the tumor patient is good and the future survival rate is high.

[0009] Based on a general technical concept, the present invention also provides an application of the tumor intervention target in the preparation of anti-tumor drugs.

[0010] The above application, further, the method of application includes: inhibiting tumor growth by knocking out the C9ORF50 gene.

[0011] The above application, further, the method of the application includes: inhibiting the growth of colorectal cancer by knocking out the C9ORF50 gene, and the sgRNA sequence targeted for knocking out C9ORF50 includes human sgRNA1 and human sgRNA2;

[0012] The gene sequence of human sgRNA1 is shown in SEQ ID NO.3;

[0013] The gene sequence of human sgRNA2 is shown in SEQ ID NO.4.

[0014] The above application, further, the application method includes: inhibiting the expression of C9ORF50mRNA in cells by siRNA, thereby enhancing the body's tumor immune response to cells.

[0015] In the above application, further, the siRNA is one of siC9ORF50-1, siC9ORF50-2, and siC9ORF50-3;

[0016] The gene sequence of the siC9ORF50-1 is shown in SEQ ID NO.5 and SEQ ID NO.6;

[0017] The gene sequence of the siC9ORF50-2 is shown in SEQ ID NO.7 and SEQ ID NO.8;

[0018] The gene sequence of the siC9ORF50-3 is shown in SEQ ID NO.9 and SEQ ID NO.10.

[0019] In the above application, further, the 5' end of the siC9ORF50-1, siC9ORF50-2, and siC9ORF50-3 is modified with cholesterol.

[0020] Based on a general technical concept, the present invention provides an application of a C9ORF50 gene in the preparation of a drug for regulating the body's immunity to tumors.

[0021] The above application further promotes the remodeling of the tumor immune microenvironment and enhances the body's immune response to tumors by knocking out the C9ORF50 gene.

[0022] Compared with the prior art, the advantages of the present invention are:

[0023] (1) The present invention provides a tumor intervention target, which is the C9ORF50 gene or its expression product, the C9ORF50 protein. The present invention first discovered that downregulating the expression of the C9ORF50 gene is useful for treating colorectal cancer, liver cancer, pancreatic cancer, breast cancer and melanoma, and provides corresponding downregulation methods. The targetability of C9ORF50 in tumors is verified step by step from the following three levels, as follows:

[0024] (A) Using CRISPR / Cas9 technology to knock out the C9ORF50 gene in tumor cells, it was demonstrated that knocking out the C9ORF0 gene can inhibit tumor growth.

[0025] (II) Quantitative PCR and ELISA techniques were used to compare the expression of innate immune signaling molecules and chemokines in tumor cells with and without C9ORF50 gene knockout, demonstrating that C9ORF50 gene knockout can lead to the activation of the innate immune signaling pathway of tumor cells, the release of chemokines, the enhancement of immune cell infiltration in tumors, and the promotion of tumor immunity.

[0026] (III) Using chemically synthesized unmodified siRNA to knock down C9ORF50 gene expression in tumors, it was proved that inhibiting C9ORF50 gene can inhibit tumors; however, due to the poor stability and in vivo transfection efficiency of unmodified siRNA, unmodified siRNA is not a good means of tumor intervention; using chemically synthesized cholesterol-modified siRNA to knock down C9ORF50 gene expression in tumors, it was proved that modified siRNA has better tumor inhibition effect and is a more ideal intervention method. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0028] Figure 1 This is an analysis diagram of the expression level of C9ORF50 in colorectal cancer tissues and adjacent cancer tissues of colorectal cancer patients in Example 1 of the present invention.

[0029] Figure 2 This is an analysis chart of the expression level of the C9ORF50 gene in tumors of patients with colorectal cancer at different clinical stages, obtained by analyzing the public database in Example 1 of the present invention.

[0030] Figure 3 This is a correlation diagram between the C9ORF50 expression of colorectal cancer patients and the patients' overall survival rate (A) and progression-free survival rate (B) obtained based on Kaplan-Mier analysis in Example 1 of the present invention.

[0031] Figure 4 The knockout efficiency of the C9ORF50 gene in MC38, Hepa, Pan02, E0771 and B16F10 cells was detected by the T7E1 experiment in Example 2 of the present invention.

[0032] Figure 5 It is a growth curve diagram of colorectal cancer (A), liver cancer (B), pancreatic cancer (C), breast cancer (D), and melanoma (E) tumor cells with and without C9ORF50 gene knockout in Example 2 of the present invention after subcutaneous transplantation in mice.

[0033] Figure 6 The following are photos (A) and a statistical graph (B) of tumor weight formed by subcutaneous transplantation of C9ORF50 gene knockout and non-knockout colorectal cancer tumor cells in Example 2 of the present invention into mice 10 days later.

[0034] Figure 7 Tumor photographs (A) and tumor weight statistics (B) of colorectal cancer tumor cells with and without C9ORF50 gene knockout in Example 2 of the present invention 10 days after orthotopic transplantation in the mouse colon.

[0035] Figure 8 Graph showing changes in mRNA levels of chemokines CCL5 (A), CXCL9 (B), CXCL10 (C) and CXCL11 (D) in MC38-sgC9ORF50 and MC38-sgNTC cells in Example 3 of the present invention.

[0036] Fig. 9 Graph showing changes in mRNA levels of chemokines IFN-α (A), IFN-β (B), IL-6 (C) and TNF-α (D) in MC38-sgC9ORF50 and MC38-sgNTC cells in Example 3 of the present invention.

[0037] Fig.10The graphs are of the changes in the protein content of chemokines CCL5 (A), CXCL9 (B), CXCL10 (C) and CXCL11 (D) in the cell culture medium of MC38-sgC9ORF50 and MC38-sgNTC, the cell lysate of the repeated freezing and thawing method and the cell lysate of the RIPA method in Example 3 of the present invention.

[0038] Fig.11 The graphs are of the changes in the protein content of chemokines IFN-α (A), IFN-β (B), IL-6 (C) and TNF-α (D) in the cell culture fluid of MC38-sgC9ORF50 and MC38-sgNTC, the cell lysate by repeated freezing and thawing method and the cell lysate by RIPA method in Example 3 of the present invention.

[0039] Fig.12 This is a multicolor immunofluorescence staining diagram of CD3, CD4 and CD8 molecules and a positive cell statistics diagram in the subcutaneous tumor formed by MC38-sgC9ORF50 and MC38-sgNTC cells in Example 3 of the present invention.

[0040] Fig.13 The results of quantitative PCR detection of the knockdown efficiency of C9ORF50 mRNA in MC38 tumor cells by the three siRNAs in Example 4 of the present invention are shown.

[0041] Fig.14 Figure 4 shows the tumor growth curve after siC9ORF50 and NCsiRNA were injected into the subcutaneous colorectal cancer transplanted tumor of mice (A) and the tumor photo 30 days after transplantation (B).

[0042] Fig.15 This is a multicolor immunofluorescence staining diagram of CD3, CD4 and CD8 molecules and a positive cell statistics diagram in the tumor after siC9ORF50 and NCsiRNA were injected subcutaneously into the colorectal cancer transplanted tumor of mice in Example 4 of the present invention.

[0043] Fig.16 Figure 4 shows the tumor growth curve after subcutaneous injection of cholestrol-siC9ORF50 and cholestrol-NCsiRNA into mouse colorectal cancer transplanted tumors (A) and a tumor photograph 30 days after transplantation (B).

[0044] Fig.17 This is a multicolor immunofluorescence staining diagram of CD3, CD4 and CD8 molecules and a positive cell statistics diagram in the tumor after subcutaneous injection of cholestrol-siC9ORF50 and cholestrol-NCsiRNA into mouse colorectal cancer transplanted tumors in Example 4 of the present invention. DETAILED DESCRIPTION

[0045] The present invention is further described below in conjunction with specific preferred embodiments, but the protection scope of the present invention is not limited thereby.

[0046] The materials, reagents and instruments used in the following examples can all be purchased from commercial channels. The experimental methods in the following examples are all conventional methods in the art unless otherwise specified.

[0047] Example 1

[0048] A tumor intervention target of the present invention: C9ORF50 gene. The DNA sequence is shown in SEQ ID NO.1 (>NM_199350.4 Homo sapiens chromosome 9 open reading frame 50 (C9orf50), mRNA).

[0049] Protein sequence>NP_955382.3uncharacterized protein C9orf50[Homo sapiens], as shown in SEQ ID NO.2.

[0050] Example 2

[0051] An application of the C9ORF50 gene of Example 1 in the preparation of a detection kit for detecting the prognosis of tumor patients. The expression level of C9ORF50 is negatively correlated with the prognosis of tumors (such as colorectal cancer, etc.). When the expression level of C9ORF50 is higher than the normal value, the prognosis of the tumor patient is poor and the future survival rate is low; when the expression level of C9ORF50 is lower than the normal value, the prognosis of the tumor patient is good and the future survival rate is high. We downloaded the expression spectrum data and clinical follow-up data from the TCGA database respectively, and integrated the two parts of data for subsequent analysis. Preliminary data mining and analysis of online clinical databases such as TCGA were carried out by using tools such as R language, cBioportal and GEPIA.

[0052] Experiment 1: Investigate the expression level of C9ORF50 in colorectal cancer tumor tissues.

[0053] Figure 1 This is an analysis diagram of the expression level of C9ORF50 in colorectal cancer tumors; it can be found in the figure that the expression level of C9ORF50 in colorectal cancer tumor tissues is higher than that in normal tissues (paracancerous tissues). It can be associated with the fact that the C9ORF50 gene can be used to prepare a kit for drug intervention targets for colorectal cancer.

[0054] Furthermore, taking colorectal cancer as an example, in colorectal cancer tissues, the clinical stages ranged from stage I to stage IV, and the expression level of C9ORF50 in colorectal cancer patients was investigated.

[0055] Figure 2 This is an analysis of the expression level of the C9ORF50 gene in tumors of patients with colorectal cancer at different clinical stages. It can be seen from the figure that the expression level of C9ORF50 in patients with colorectal cancer at stages I to IV gradually increases.

[0056] Furthermore, the survival curves of patients with colorectal cancer were examined.

[0057] Figure 3 This is a correlation diagram between the expression of C9ORF50 in colorectal cancer patients and the overall survival rate (A in the figure) and progression-free survival rate (B in the figure) of the patients, which was obtained based on Kaplan-Mier analysis. It can be seen from the figure that the survival rate of patients with high expression of C9ORF50 is significantly lower than that of patients with low expression.

[0058] In summary, these results suggest that the gene function of C9ORF50 may contribute to the occurrence and development of colorectal cancer. It should be noted that C9ORF50 is a gene with unknown function, and its methylation modification can be used as a diagnostic marker for esophageal cancer, gastric cancer, and colorectal cancer. However, there is still no report on the targetability of C9ORF50 in tumors.

[0059] Example 3

[0060] A use of the C9ORF50 gene of Example 1 in the preparation of an anti-tumor drug to inhibit tumor growth by knocking out the C9ORF50 gene. The sgRNA sequence for targeted knockout of C9ORF50 is:

[0061] Mouse sgRNA1: 5'-GTCTGCGAATCGTACCCGGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3'.

[0062] Mouse sgRNA2: 5'-GAGGGACAAACCATTGCACTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3'.

[0063] Human sgRNA1: 5'-TCTCGTCAGCGAATCGCACCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3' (SEQ ID NO. 3).

[0064] Human sgRNA2: 5'-AGCGTCTGCGCTCCCAGTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3' (SEQ ID NO. 4).

[0065] The specific steps include:

[0066] (1) Establish different tumor cell lines with Cas9 gene knock-in.

[0067] 1.1. HEK293T cells were inoculated at a density of 30% in a 10 cm culture dish. When the cells grew to 80% confluence, Lipofectamine 3000 reagent (ThermoFisher) was used to transfect the spCas9 expression plasmid PHKO14 (containing the blasticidin gene) and the lentiviral backbone packaging plasmid pMD2.g and psPAX2 packaging spCas9 encoding gene virus (used to knock in the Cas9 gene in different cell lines to facilitate the subsequent knockout of the C9ORF50 gene in each cell line) according to the instructions.

[0068] 1.2. 48 hours after transfection, collect the supernatant culture medium of the cells, centrifuge at 2000 rpm at 4°C for 10 minutes, and collect the supernatant containing the virus.

[0069] (2) Transfecting the virus-containing supernatant into a cell line. The cell line selected in the present invention is one of the mouse colorectal tumor MC38 cell line, the mouse pancreatic cancer cell line Pan02, the mouse liver cancer cell line Hepa, the mouse breast cancer cell line E0771, and the mouse melanoma cell line B16F10. The specific steps are:

[0070] 2.1. MC38, Pan02, Hepa, E0771 and B16F10 were inoculated at a density of 30% in 10 cm cell culture dishes and cultured for 24 h.

[0071] 2.2. Mix 5 ml of supernatant containing the virus with 5 ml of culture medium in a volume ratio of 1:1, add 10 ul of Ploybrane and mix well to infect the cells.

[0072] 2.2. 24 hours after infection, the infected cells were screened with blasticidin to enrich the surviving cells, i.e. the positive cells that were successfully infected.

[0073] 2.3. After 10 days of screening, the enriched positive cells were subcultured and expanded to obtain MC38-cas9, Pan02, Hepa-cas9 and E0771-cas9 cells, respectively.

[0074] (2) Establish different tumor cell lines with C9ORF50 gene knockout.

[0075] 1.1. HEK293T cells were seeded at a density of 30% in a 10 cm culture dish. When the cells grew to 80% confluence, Lipofectamine 3000 reagent (ThermoFisher) was used to transfect the psc007 plasmid (containing the puromycin resistance gene) containing the sgRNA sequence (sgC9ORF50) targeting knockout of C9ORF50 and the lentiviral backbone packaging plasmid pMD2.g and psPAX2 packaging sgNTC lentivirus targeting C9ORF50 according to the instructions.

[0076] 1.2. 48 hours after transfection, collect the supernatant culture medium of the cells, centrifuge at 2000 rpm at 4°C for 10 minutes, and collect the supernatant containing the virus.

[0077] 1.3. MC38-cas9, Pan02, Hepa-cas9, E0771-cas9 and B16F10-cas9 cells were seeded at a density of 30% in 10 cm cell culture dishes and cultured for 24 h.

[0078] 1.4. Mix 5 ml of the supernatant containing the virus with 5 ml of DMEM medium containing 10% fetal bovine serum in a volume ratio of 1:1, add 10 ul of Ploybrane and mix well to infect the cells.

[0079] 1.5. 24 hours after infection, the infected cells were screened with puromycin (the screening criteria were whether the cells would die, and the cells that survived were the successfully transfected cells, i.e., positive cells), and the successfully infected positive cells (MC38-sgC9ORF50, Pan02-sgC9ORF50, Hepa-sgC9ORF50, E0771-sgC9ORF50, and B16F10-sgC9ORF50 cells) were enriched. The tumor cell lines with C9ORF50 gene knockout were obtained.

[0080] Comparative Example 1

[0081] The knockout non-targeting irrelevant sgRNA (sgNTC) sequence was compared with Example 2, wherein the sequence of sgNTC was 5′-ACGGAGGCTAAGCGTCGCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3′.

[0082] The application method specifically includes the following steps:

[0083] (1) Establish different tumor cell lines with non-targeted and unrelated sgNTC knock-in.

[0084] 1.1. HEK293T cells were seeded at a density of 30% in a 10 cm culture dish. When the cells grew to 80% confluence, Lipofectamine 3000 reagent (ThermoFisher) was used to transfect the psc007 plasmid (containing the puromycin resistance gene) expressing the sgNTC sequence and the lentiviral backbone packaging plasmid pMD2.g and psPAX2 packaging non-targeting unrelated sgNTC lentivirus according to the instructions.

[0085] 1.2. 48 hours after transfection, collect the supernatant culture medium of the cells, centrifuge at 2000 rpm at 4°C for 10 minutes, and collect the supernatant containing the virus.

[0086] (2) Transfect the cell line with the supernatant containing the virus.

[0087] 2.1. MC38-cas9, Pan02, Hepa-cas9 and E0771-cas9 cells were seeded at a density of 30% in 10 cm cell culture dishes and cultured for 24 h.

[0088] 2.2. Mix 5 ml of the supernatant containing the virus with 5 ml of DMEM medium containing 10% fetal bovine serum in a volume ratio of 1:1, add 10 ul of Ploybrane and mix well to infect the cells.

[0089] 2.3. 24 hours after infection, the infected cells were screened with puromycin (the screening criterion was whether the cells would die, and the cells that survived were the successfully transfected cells, i.e., positive cells), and the successfully infected positive cells (MC38-sgNTC, Pan02-sgNTC, Hepa-sgNTC, E0771-sgNTC, B16F10-sgNTC cells) were enriched.

[0090] Experiment 2: Investigate the knockout efficiency of each tumor cell line.

[0091] The genomes of the cell lines obtained in Example 2, Comparative Example 1 and Comparative Example 2 were extracted, and T7E1 experiments were performed to detect the knockout status of the cells.

[0092] Figure 4 The knockout efficiency of C9ORF50 gene in MC38, Hepa, Pan02, E0771 and B16F10 cells was detected by T7E1 experiment in Example 2 of the present invention. As can be seen from the figure: the T7E1 experimental results show that the knockout efficiency of each cell line is high and can be used for subsequent experiments.

[0093] (3) Mouse subcutaneous tumor model. Specifically includes the following steps:

[0094] 3.1. Selection of mice: The C57BL / 6j mice used in the present invention were purchased from Wuhan Beisai Model Biotechnology Co., Ltd. The purchased mice were kept in the breeding room of the laboratory for 2 weeks.

[0095] 3.2. The cells of Example 2 and Comparative Example 1 were digested, washed twice with PBS, and counted. 6 Resuspend the cells in 100 μL cold PBS and store at low temperature until use.

[0096] 3.3. When the mice are 7-8 weeks old, prepare for subcutaneous tumor transplantation. Each group of experiments needs to have 6-10 replicates. The specific steps are as follows: before the operation, place the mice in an induction box for inhaled isoflurane anesthesia, and pinch the mouse's toes to confirm whether the anesthesia is complete; after the mice are fully anesthetized, place the mice on the operating table and place them in an induction box for inhaled isoflurane anesthesia. After they are fully anesthetized, mark the ears of each group of mice. Subsequently, use a shaver to shave the hair on the lower left groin of the mouse, and disinfect the skin surface with 75% alcohol. Follow the procedure of 2×10 6 Then, some warming measures were taken to restore the body temperature and heart rate of the mice to the state before anesthesia as soon as possible. After they could move independently, they were put back into the IVC cage for continued feeding, and the state of the mice was closely monitored for 24 hours after surgery.

[0097] Experiment 3: The mouse subcutaneous tumor model was used to detect the inhibitory effect of C9ORF50 gene expression deficiency on tumor development in different tumor cell lines.

[0098] After cell inoculation, the tumor growth status of mice was detected every day, and the tumor volume was measured on the 3rd, 6th, 9th, 12th, 15th, 18th, 21st, 24th, 27th, and 30th days after transplantation. The measurement method is as follows: the anesthetized mice were placed on the operating table, and the contour lengths (length, width, and height) of the tumor were measured using a vernier caliper. Then, the volume of the tumor was calculated using an algorithm (V = 4 / 3 × π × length / 2 × height / 2 × width / 2), and the records were kept. The tumor growth curve was drawn based on the measurement results.

[0099] Figure 5 It is a growth curve diagram of colorectal cancer (A), pancreatic cancer (B), liver cancer (C), breast cancer (D), and melanoma (E) tumor cells with and without C9ORF50 gene knockout in Example 2 of the present invention after subcutaneous transplantation in mice.

[0100] The figure shows that in colorectal cancer (A in the figure), pancreatic cancer (B in the figure), liver cancer (C in the figure), breast cancer (D in the figure) and melanoma (E), the growth rate of the tumor in the C9ORF50 gene knockout group (sgC9ORF50) was significantly lower than that in the control group (sgNTC), and the tumor was completely eliminated about 20 days after tumor transplantation. This shows that C9ORF50 gene knockout significantly inhibits the development of colorectal cancer, pancreatic cancer, liver cancer, breast cancer and melanoma in vivo.

[0101] Experiment 4: Investigate the mouse subcutaneous tumor model to detect the inhibitory effect of C9ORF50 gene expression deficiency on the development of colorectal cancer.

[0102] On the 10th day after transplantation, 10 mice transplanted with MC38-sgC9ORF50 and MC38-sgNTC cells were randomly killed, subcutaneous tumors were surgically removed, tumor weights were weighed, and tumor morphology was recorded by photographing. Tumor tissues were then paraffin-embedded and tissue sections were prepared.

[0103] Figure 6 The following are photos of tumors formed by subcutaneous transplantation of C9ORF50 knockout and non-knockout colorectal cancer cells in mice 10 days later (A) and a statistical graph of tumor weight (B). As shown in the figure, the tumors in the C9ORF50 knockout group were significantly smaller than those in the MC38-NTC group in terms of morphology and weight. Through the subcutaneous tumor formation experiment in mice, we proved that C9ORF50 knockout can significantly inhibit the tumor formation ability of MC38 cell line in C57BL / 6j mice.

[0104] Furthermore, the present invention used a mouse colorectal tumor orthotopic tumor model to verify the inhibitory effect of knocking out the C9ORF50 gene on the tumorigenicity of MC38 cells. 7-8 week old C57BL / 6j mice were selected, and 3 replicates were set for each group of experiments. Before surgery, the mice to be operated on were anesthetized, the abdominal skin was dissected, and the colon was exposed. 2×10 6 MC38-sgC9ORF50 or MC38-sgNTC cells were added, and the wounds were sutured and the mice were raised normally. On the 10th day after transplantation, the mice were killed, the colon and rectum were surgically separated, and the subcutaneous tumors were removed and weighed after taking pictures.

[0105] Figure 7The tumor photos (A) and tumor weight statistics (B) of colorectal cancer tumor cells with and without C9ORF50 gene knockout in Example 2 of the present invention after orthotopic transplantation in the mouse colon for 10 days. As shown in the figure, the tumors in the C9ORF50 gene knockout group were significantly smaller than those in the MC38-NTC group in terms of morphology and weight, further indicating that knockout of the C9ORF50 gene inhibited the tumorigenicity of the MC38 cell line in C57BL / 6j mice.

[0106] Example 4

[0107] The invention discloses an application of the C9ORF50 gene in the preparation of a drug for regulating the body's tumor immunity to colorectal cancer cells. By knocking out the C9ORF50 gene, the tumor immune microenvironment is remodeled, and the chemokines CCL5, CXCL9, CXCL10 and CXCL11 and the cytokines IFN-α, IFN-β, IL-6 and TNF-α are significantly upregulated, and the CD4 + T and CD8 + The infiltration of T cells was significantly enhanced, proving that knocking out the C9ORF50 gene enhanced the body's tumor immune response to colorectal cancer cells.

[0108] Its application method is:

[0109] (1) Establishment of different tumor cell lines with C9ORF50 gene knockout. MC38-sgC9ORF50 cells were obtained according to the method of Example 2.

[0110] At the same time, MC38-sgNTC cells were obtained according to the method of Comparative Example 1.

[0111] Experiment 5: Detection of immune factors in C9ORF50 knockout tumor cells.

[0112] 5.1. Collect MC38-sgC9ORF50 and MC38-sgNTC cells in logarithmic phase growth, and extract total RNA according to the Trizol operating instructions of Invitrogen. The quality of total RNA was detected by agarose gel electrophoresis, and the total RNA concentration was determined by NanoDrop micro-spectrophotometer. According to the operating instructions of RevertAid RT reverse transcription kit of Thermo Fisher Scientific, cDNA was obtained.

[0113] RevertAid RT reverse transcription reaction system:

[0114]

[0115] The reverse transcription reaction system was as follows: 25°C for 5 min, 42°C for 1 h, and 70°C for 10 min to inactivate the reverse transcriptase.

[0116] 5.2 cDNA using TB Premix Ex Taq TM (Takara) reagent, and real-time quantitative detection was performed on a LightCycler480II Real time PCR instrument (Roche). The quantitative PCR procedure was a two-step Real-time PCR: pre-denaturation at 95°C for 30 seconds; then denaturation at 95°C for 10 seconds, annealing and extension at 60°C for 30 seconds, for a total of 40 cycles. After the PCR was completed, denaturation was performed at 95°C for 1 minute, and then cooled to 55°C to allow the DNA double strands to fully combine. From 55°C to 95°C, each step increased by 0.5°C and maintained for 4 seconds. At the same time, the absorbance value was read to make a melting curve. The expression level of the SDHA gene was used as the internal reference, and 2 -ΔΔCt The expression abundance of immune molecules such as chemokines (CCL5, CXCL9, CXCL10 and CXCL11), cytokines (IFN-α, IFN-β, IL-6 and TNF-α) in each group of cells was calculated by analytical method. Each group of experiments was set up with 3-6 parallel replicates.

[0117] Figure 8 The graph shows the changes in mRNA levels of chemokines CCL5 (A), CXCL9 (B), CXCL10 (C), and CXCL11 (D) in MC38-sgC9ORF50 and MC38-sgNTC cells.

[0118] Fig. 9 The graph shows the changes in mRNA levels of chemokines IFN-α (A), IFN-β (B), IL-6 (C), and TNF-α (D) in MC38-sgC9ORF50 and MC38-sgNTC cells.

[0119] from Figure 8 and Fig. 9 The results showed that knocking out the C9ORF50 gene resulted in the expression of chemokine CCL5 ( Figure 8 A in), CXCL9( Figure 8 B), CXCL10 ( Figure 8 C) and CXCL11 ( Figure 8 D) and cytokine IFN-α ( Fig. 9 A in), IFN-β( Fig. 9 B), IL-6 ( Fig. 9 C) and TNF-α ( Fig. 9 D) were significantly upregulated.

[0120] Furthermore, the present invention respectively absorbs the supernatant cell culture fluid of MC38-sgC9ORF50 and MC38-sgNTC cells growing in the logarithmic phase, and extracts the cell lysate of MC38-sgC9ORF50 and MC38-sgNTC cells by repeated freezing and thawing method and RIPA lysis method. The specific steps are:

[0121] 5.3. Digest the MC38-sgC9ORF50 and MC38-sgNTC cells in logarithmic phase with trypsin and wash them with PBS three times. Take 2×10 6 After centrifugation, remove the supernatant and place in a -20℃ refrigerator.

[0122] 5.4. After 1 hour, take out the cells and place them in a 40℃ water bath for rapid thawing. After thawing, place them in a -20℃ refrigerator. Repeat freezing and thawing several times until the cells are completely lysed, centrifuge at 15000g for 10 minutes at 4℃, and collect the supernatant for examination.

[0123] The RIPA lysis method was performed according to the instructions of the RIPA lysis buffer (#89901) of Thermo Fisher Scientific, and the amount of cells lysed was 2×10 6 The cells were lysed by RIPA and centrifuged at 15000g for 10 min at 4°C, and the supernatant was collected for testing. The contents of immune molecules such as chemokines (CCL5, CXCL9, CXCL10 and CXCL11), cytokines (IFN-α, IFN-β, IL-6 and TNF-α) in the samples were detected using the mouse CCL5, CXCL9, CXCL10, CXCL11, IFN-α, IFN-β, IL-6 and TNF-α ELISA kits of Hunan Aifang Biological according to the relevant instructions. Each group of experiments was set up with 3-6 groups of parallel repetitions.

[0124] Fig.10 The graph shows the changes in the protein levels of chemokines CCL5 (A), CXCL9 (B), CXCL10 (C) and CXCL11 (D) in the cell culture medium of MC38-sgC9ORF50 and MC38-sgNTC, the cell lysate of repeated freezing and thawing method and the cell lysate of RIPA method.

[0125] Fig.11 The graphs show the changes in the protein content of chemokines IFN-α (A), IFN-β (B), IL-6 (C) and TNF-α (D) in the cell culture medium of MC38-sgC9ORF50 and MC38-sgNTC, the cell lysate of repeated freezing and thawing method and the cell lysate of RIPA method.

[0126] from Fig.10 and Fig.11The results showed that knocking out the C9ORF50 gene resulted in the synthesis and secretion of the chemokine CCL5 ( Fig.10 A in), CXCL9( Fig.10 B), CXCL10 ( Fig.10 C) and CXCL11 ( Fig.10 D) and cytokine IFN-α ( Fig.11 A in), IFN-β( Fig.11 B), IL-6 ( Fig.11 C) and TNF-α ( Fig.11 D) were significantly upregulated.

[0127] These results demonstrate that loss of the C9ORF50 gene in colorectal cancer cells leads to activation of the immune response, suggesting that it affects the tumor immune microenvironment.

[0128] Experiment 6: Detection of immune cell infiltration in C9ORF50 knockout tumors.

[0129] The infiltration of T lymphocytes in subcutaneous colorectal cancer tumors formed by MC38-sgC9ORF50 and MC38-sgNTC cell lines was detected. The specific steps were as follows: the tumor tissue was fixed with formalin solution and then paraffin sections were made. Immunofluorescence staining was performed using mouse CD3 antibody (ThermoFisher), mouse CD4 antibody (ThermoFisher) and mouse CD8 antibody (ThermoFisher), and the data were analyzed after taking pictures under a fluorescence microscope.

[0130] Fig.12 The multicolor immunofluorescence staining of CD3, CD4 and CD8 molecules and the positive cell statistics in the subcutaneous tumors formed by MC38-sgC9ORF50 and MC38-sgNTC cells. The experiment showed that knocking out the C9ORF50 gene led to the decrease of CD4 in colorectal cancer tumor tissue. + T and CD8 + The infiltration of T cells was significantly enhanced, proving that knocking out the C9ORF50 gene enhanced the body's tumor immune response to colorectal cancer cells.

[0131] Example 5

[0132] An application of the C9ORF50 gene of the present invention in the preparation of anti-tumor drugs. The expression of C9ORF50 mRNA in cells is inhibited by chemically synthesized unmodified siRNA, thereby enhancing the body's tumor immune response to colorectal cancer cells.

[0133] The specific steps include:

[0134] (1) Preparation of siRNA targeting mouse C9ORF50 gene.

[0135] The gene information of the homologous gene 1700001o22Rik (NM_198000.3) of the C9ORF50 gene in mice was retrieved from Genbank; effective siRNA targets against the gene were designed. Four groups of siRNA sequences were chemically synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0136] siC9ORF50-1:

[0137] Sense strand (5'-3'): AGCUGUAUCUGUGUCAGAACGTT (SEQ ID NO. 5);

[0138] Antisense strand (5'-3'): CGUUCUGACACAGAUACAGCUTT (SEQ ID NO. 6).

[0139] siC9ORF50-2:

[0140] Sense strand (5'-3'): GGGUACGAUUCGCAGACGAGATT (SEQ ID NO. 7);

[0141] Antisense strand (5'-3'): UCUCGUCUGCGAAUCGUACCCTT (SEQ ID NO. 8).

[0142] siC9ORF50-3:

[0143] Sense strand (5'-3'): GCUGCUUAUUCCUCCCAGACCTT (SEQ ID NO. 9);

[0144] Antisense strand (5'-3'): GGUCUGGGAGGAAUAAGCAGCTT (SEQ ID NO. 10).

[0145] Negative control siRNA (NCsiRNA):

[0146] Sense strand (5′-3′): UUCUCCGAACGUGUCACGUdTdT;

[0147] Antisense strand (5'-3'): ACGUGACACGUUCGGAGAAdTdT.

[0148] (2) Chemically synthesized unmodified siRNA silenced the C9ORF50 gene. Mouse colorectal cancer cell MC38 cells in the logarithmic growth phase were digested with trypsin and prepared into a cell suspension (cell number was about 5×10 4 / ml) were inoculated in a 24-well plate and cultured until the cell confluence reached about 50%. siRNA was transfected, and 3 parallel replicates were set for each group. The specific steps were as follows:

[0149] 2.1. Dilute the synthesized siRNA with 50 μL Opti-MEM to make the final concentration of transfected cells 50 nM.

[0150] 2.2. Add 1.0 μL LipofectamineTM 2000 to 50 μL Opti-MEM, pipette gently to mix, and let stand at room temperature for 5 min.

[0151] 2.3. Mix the siRNA diluent and transfection reagent, and let stand at room temperature for 20 minutes. Then add the transfection material dropwise into the 24-well cell culture plate at 100 μL / well, shake gently to mix, and place in a 37°C, 5% CO2 incubator for 6 hours, and replace with fresh culture medium.

[0152] 2.4. After 48 hours of culture, cells were collected. Total RNA was extracted according to the Trizol operating instructions of Invitrogen, the quality of total RNA was detected by agarose gel electrophoresis, and the total RNA concentration was determined by NanoDrop micro-spectrophotometer. cDNA was obtained according to the RevertAid RT reverse transcription kit operating instructions of Thermo Fisher Scientific.

[0153] Experiment 7: Investigate the effect of siRNA knockdown of C9ORF50 gene on the malignant phenotype of tumor cells.

[0154] cDNA using TB Premix Ex Taq TM (Takara) reagent, and real-time quantitative detection was performed on a LightCycler 480II Realtime PCR instrument (Roche). The expression level of the SDHA gene was used as an internal reference, and the 2-ΔΔCt analysis method was used to calculate the expression abundance of C9ORF50 mRNA transfected with siRNA.

[0155] Fig.13 The results of quantitative PCR detection of the knockdown efficiency of C9ORF50 mRNA in MC38 tumor cells by three siRNAs in Example 4 of the present invention are shown in the figure. It can be seen from the figure that siC9ORF50-1 and siC9ORF50-3 have a strong inhibitory effect on C9ORF50 mRNA in MC38 cells, and siC9ORF50-3 has the best effect, so only siC9ORF50-3 is detected in subsequent experiments.

[0156] Experiment 8: Investigate the ability of chemically synthesized unmodified siRNA to knock down C9ORF50 and inhibit the in vivo tumorigenicity of MC38 cells.

[0157] Mouse colorectal cancer cell MC38 cells in the logarithmic growth phase were digested with trypsin and diluted with PBS to prepare a cell suspension (cell number was about 2×10 7 / ml) and injected subcutaneously into the left lower groin of C57BL / 6j mice. The tumor growth status of mice was detected every day after cell inoculation. On the 6th, 9th and 12th days after transplantation, 30ug siC9ORF50 or NCsiRNA was injected into the tumor of each mouse at multiple points. The volume of the tumor was measured on the 3rd, 6th, 9th, 12th, 15th, 18th, 21st, 24th, 27th and 30th days after transplantation. The measurement method is: place the anesthetized mouse on the operating table, use a vernier caliper to measure the contour length (length, width, height) of the tumor, and then use the algorithm (V = 4 / 3×π×length / 2×height / 2×width / 2) to calculate the volume of the tumor and keep a record. The tumor growth curve was drawn according to the measurement results. One month after transplantation, the mice were killed, the subcutaneous tumor tissue was separated, and the effect of knocking down C9ORF50 on the size of the tumor was compared after taking pictures. At the same time, the tumor tissue was sliced, and immunofluorescence staining was used to analyze the CD4 + T and CD8 + Infiltration of T cells.

[0158] Fig.14 Figure 4 shows the tumor growth curve after siC9ORF50 and NCsiRNA were injected into the subcutaneous colorectal cancer transplanted tumor of mice (A) and the tumor photo 30 days after transplantation (B); the results are shown in the figure. The tumor growth curve shows that compared with the control group (NCsiRNA), the proliferation of mouse colorectal cancer cell MC38 cells in the mouse body was significantly inhibited after injection of siC9ORF50. The tumor size level further shows that the proliferation of MC38 cells was significantly inhibited after injection of siC9ORF50, indicating that knocking down C9ORF50 significantly inhibits the tumorigenic ability of MC38 cells in vivo. After knocking down C9ORF50 by unmodified siRNA, the CD4 + T and CD8 + The enhanced infiltration of T cells proved that knocking down the C9ORF50 gene enhanced the body's tumor immune response to colorectal cancer cells.

[0159] Fig.15 This is a multicolor immunofluorescence staining diagram of CD3, CD4 and CD8 molecules and a positive cell statistics diagram in the tumor after siC9ORF50 and NCsiRNA were injected subcutaneously into the colorectal cancer transplanted tumor of mice in Example 4 of the present invention.

[0160] However, due to the poor stability and cell transfection efficiency of unmodified siRNA in vivo, unmodified siRNA is not the best means of tumor intervention.

[0161] Example 6

[0162] A use of the C9ORF50 gene of the present invention in the preparation of anti-tumor drugs. On the basis of Example 5, the cholestrol (cholesterol) modification at the 5' end of siRNA can promote the absorption of siRNA by cells, increase the membrane permeation effect, prolong the half-life of siRNA in serum, and better exert the effect of tumor intervention in vivo. Therefore, the present invention performs cholestrol modification at the 5' end of the above-mentioned siC9ORF50 and NCsiRNA to obtain the corresponding cholestrol-siC9ORF50 and cholestrol-NCsiRNA. Subsequently, the siRNA was used to knock down the C9ORF50 gene in mouse tumors, and the experimental process was the same as the unmodified siRNA knockdown process.

[0163] Experiment 9: Investigate whether knocking down C9ORF50 by siRNA significantly inhibits the tumorigenic ability of MC38 cells in vivo.

[0164] Fig.16 The figure is a graph of the tumor growth curve after the injection of cholestrol-siC9ORF50 and cholestrol-NCsiRNA into the subcutaneous colorectal cancer transplanted tumor of mice (A) and a photo of the tumor 30 days after transplantation (B) in Example 4 of the present invention. The experimental results show that the tumor growth curve shows that the proliferation of mouse colorectal cancer cell MC38 cells in the mouse body is significantly inhibited after the injection of cholestrol-siC9ORF50 compared with the control group (cholestrol-NCsiRNA). The tumor size level further shows that the proliferation of MC38 cells is significantly inhibited after the injection of cholestrol-siC9ORF50.

[0165] Fig.17 Figure 4 shows the multicolor immunofluorescence staining of CD3, CD4 and CD8 molecules in the tumor after subcutaneous injection of cholestrol-siC9ORF50 and cholestrol-NCsiRNA into the colorectal cancer transplanted tumor of mice (A) and the positive cell statistics (B); the figure shows that after knocking down C9ORF50 by cholestrol-modified siRNA, CD4 in the tumor tissue + T and CD8 +The infiltration of T cells was significantly enhanced, proving that knocking down the C9ORF50 gene by cholestrol-modified siRNA enhanced the body's tumor immune response to colorectal cancer cells, indicating that knocking down C9ORF50 significantly inhibited the tumorigenicity of MC38 cells in vivo. This proves that the modified siRNA has a better tumor inhibition effect and is a more ideal intervention method.

[0166] The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as above in the preferred embodiment, it is not used to limit the present invention. Any technician familiar with the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above without departing from the spirit and technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention, still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A tumor intervention target, characterized in that: The tumor intervention target is the C9ORF50 gene, and the gene sequence of the C9ORF50 gene is shown in SEQ ID NO.

1.

2. The tumor intervention target according to claim 1, characterized in that: The tumor includes colorectal cancer, liver cancer, pancreatic cancer, breast cancer or melanoma.

3. Use of the tumor intervention target according to claim 1 or 2 in the preparation of a detection kit for detecting the prognosis of tumor patients.

4. The use according to claim 3, characterized in that: The prognosis of tumor patients is detected by detecting the expression level of the C9ORF50 gene. When the expression level of C9ORF50 is higher than the normal value, the prognosis of the tumor patient is poor and the future survival rate is low; when the expression level of C9ORF50 is lower than the normal value, the prognosis of the tumor patient is good and the future survival rate is high.

5. Use of the tumor intervention target according to claim 1 or 2 in the preparation of anti-tumor drugs.

6. The use according to claim 5, characterized in that: The application method comprises: inhibiting tumor growth by targeted knockout of the C9ORF50 gene, wherein the sgRNA sequence for targeted knockout of C9ORF50 comprises human sgRNA1 and human sgRNA2; The gene sequence of human sgRNA1 is shown in SEQ ID NO.3; The gene sequence of human sgRNA2 is shown in SEQ ID NO.

4.

7. The use according to claim 5, characterized in that: The application method comprises: inhibiting the expression of C9ORF50 mRNA in cells by siRNA, thereby enhancing the body's tumor immune response to cells.

8. The use according to claim 7, characterized in that: The siRNA is one of siC9ORF50-1, siC9ORF50-2, and siC9ORF50-3; The gene sequence of the siC9ORF50-1 is shown in SEQ ID NO.5 and SEQ ID NO.6; The gene sequence of the siC9ORF50-2 is shown in SEQ ID NO.7 and SEQ ID NO.8; The gene sequence of the siC9ORF50-3 is shown in SEQ ID NO.9 and SEQ ID NO.

10.

9. The use according to claim 8, characterized in that: The 5' ends of the siC9ORF50-1, siC9ORF50-2, and siC9ORF50-3 are modified with cholesterol.

10. Use of the tumor intervention target according to claim 1 or 2 in the preparation of a drug for regulating the body's immunity to tumors.

Images