Tumor intervention targets and uses thereof
By using the C9ORF50 gene as a tumor intervention target and employing CRISPR/Cas9 technology and cholesterol-modified siRNA to inhibit C9ORF50 expression, the treatment of tumors such as colorectal cancer has been solved, significantly inhibiting tumor growth and enhancing immune response, thereby improving patient survival rates.
Patent Information
- Application Number
- CN202411611133.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-12
- Publication Date
- 2026-07-10
- Estimated Expiration
- 2044-11-12
AI Technical Summary
The lack of targeted therapies for colorectal cancer in existing technologies, the limited effectiveness of tumor immunotherapy, and the lack of effective tumor treatment targets make treatment difficult for colorectal cancer patients.
The C9ORF50 gene is provided as a tumor intervention target. The C9ORF50 gene is knocked out using CRISPR/Cas9 technology, and siRNA modified with chemically synthesized cholesterol is used to inhibit C9ORF50 expression, thereby enhancing the tumor immune response and regulating the tumor microenvironment.
It significantly inhibits the growth of colorectal cancer, liver cancer, pancreatic cancer, breast cancer, and melanoma, activates the immune signaling pathways of tumor cells, promotes immune cell infiltration, and improves patient survival rates.
Smart Images

Figure CN119753136B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, and in particular relates to a tumor intervention target and its application. Background Technology
[0002] Colorectal cancer is the third most common cancer worldwide and one of the leading causes of cancer death. Currently, surgery and chemotherapy remain the primary treatments for colorectal cancer. However, due to the limitations of surgery and the development of chemotherapy resistance, most cancer patients face problems such as tumor recurrence, posing a significant challenge to clinical treatment.
[0003] In recent years, significant progress has been made in precision medicine in the areas of targeted therapy against tumor-specific functional molecules and tumor immunotherapy that modulates the body's anti-tumor immune response. However, the number of targeted therapies currently available for colorectal cancer is very limited (antibodies against epidermal growth factor receptor, vascular endothelial growth factor receptor, and human epidermal growth factor 2 receptor), resulting in a scarcity of available targeted drugs. Simultaneously, there are few means to modulate the body's anti-colorectal cancer immune response, and classic tumor immunotherapies such as checkpoint blockade therapy (anti-PD-1 or anti-PD-L1) only benefit a very small number of patients, severely restricting the treatment of colorectal cancer patients. Therefore, providing a novel tumor therapeutic target is an urgent problem to be solved in the treatment of colorectal cancer patients.
[0004] C9ORF50 (1700001o22Rik) is a protein-coding gene. Methylation modification of the C9ORF50 gene can serve as a diagnostic marker for esophageal cancer, gastric cancer, and colorectal cancer. However, current research on the C9ORF50 gene is still very limited, its role in colorectal cancer and other tumors is poorly understood, and the relationship between C9ORF50 gene expression levels and tumor development has not been reported. Therefore, further research is needed to clarify the relationship between the C9ORF50 gene and colorectal cancer, and based on this, to identify drugs that can affect C9ORF50 expression to achieve the goal of treating colorectal cancer. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a target of action of an anti-tumor drug and its use.
[0006] To address the aforementioned technical problems, this invention provides a tumor intervention target, wherein the tumor intervention target is the C9ORF50 gene, and the gene sequence of the C9ORF50 gene is shown in SEQ ID NO.1.
[0007] Based on a general technical concept, the present invention also provides the application of the aforementioned tumor intervention target in the preparation of a diagnostic kit for detecting the prognosis of tumor patients. The tumor includes colorectal cancer, liver cancer, pancreatic cancer, breast cancer, or melanoma.
[0008] Further, the above applications include detecting the expression level of the C9ORF50 gene to assess the prognosis of cancer patients. When the C9ORF50 expression level is higher than the normal value, the prognosis of cancer patients is poor and the future survival rate is low; when the C9ORF50 expression level is lower than the normal value, the prognosis of cancer patients is good and the future survival rate is high.
[0009] Based on a general technical concept, the present invention also provides the application of the aforementioned tumor intervention target in the preparation of anti-tumor drugs.
[0010] Further, the method of the above application includes: inhibiting tumor growth by knocking out the C9ORF50 gene.
[0011] The above-mentioned application, further, the method of the application includes: inhibiting the growth of colorectal cancer by knocking out the C9ORF50 gene, wherein the sgRNA sequence for targeted knockout of C9ORF50 includes human sgRNA1 and human sgRNA2;
[0012] The gene sequence of the human sgRNA1 is shown in SEQ ID NO.3;
[0013] The gene sequence of the human sgRNA2 is shown in SEQ ID NO.4.
[0014] Further, the method of the above application includes: enhancing the body's tumor immune response to cells by inhibiting the expression of C9ORF50 mRNA in cells through siRNA.
[0015] In the above applications, the siRNA is one of siC9ORF50-1, siC9ORF50-2, and siC9ORF50-3;
[0016] The gene sequence of siC9ORF50-1 is shown in SEQ ID NO.5 and SEQ ID NO.6;
[0017] The gene sequence of siC9ORF50-2 is shown in SEQ ID NO.7 and SEQ ID NO.8;
[0018] The gene sequence of siC9ORF50-3 is shown in SEQ ID NO.9 and SEQ ID NO.10.
[0019] In the above applications, furthermore, the 5' ends of siC9ORF50-1, siC9ORF50-2, and siC9ORF50-3 are modified with cholesterol.
[0020] Based on a general technical concept, this invention provides the application of the C9ORF50 gene in the preparation of drugs that regulate the body's tumor immunity.
[0021] The above applications further demonstrate how knocking out the C9ORF50 gene can promote the remodeling of the tumor immune microenvironment and enhance the body's immune response to tumors.
[0022] Compared with the prior art, the advantages of the present invention are as follows:
[0023] (1) This invention provides a tumor intervention target, namely the C9ORF50 gene or its expression product C9ORF50 protein. This invention is the first to discover that downregulating C9ORF50 gene expression can be used to treat colorectal cancer, liver cancer, pancreatic cancer, breast cancer, and melanoma, and provides corresponding downregulation methods. The targetability of C9ORF50 in tumors is verified step-by-step from the following three levels, as follows:
[0024] (i) Using CRISPR / Cas9 technology to knock out the C9ORF50 gene in tumor cells, it was demonstrated that knocking out the C9ORF0 gene can inhibit tumor growth.
[0025] (II) Using quantitative PCR and ELISA techniques, the expression of innate immune signaling molecules and chemokines in tumor cells with C9ORF50 gene knockout and those without gene knockout was compared and detected. This demonstrated that knocking out C9ORF50 gene can activate the innate immune signaling pathway in tumor cells, release chemokines, enhance the infiltration of immune cells in tumors, and promote tumor immunity.
[0026] (III) Using chemically synthesized unmodified siRNA to knock down C9ORF50 gene expression in tumors, it was demonstrated that inhibiting C9ORF50 gene can suppress tumors; however, due to the poor stability and in vivo transfection efficiency of unmodified siRNA, unmodified siRNA is not a good tumor intervention method; using chemically synthesized cholesterol to modify siRNA to knock down C9ORF50 gene expression in tumors, it was demonstrated that the modified siRNA has a better tumor-suppressing effect and is a more ideal intervention method. Attached Figure Description
[0027] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.
[0028] Figure 1 This is a graph showing the expression level analysis of C9ORF50 in colorectal cancer tissue and adjacent tissue of patients with colorectal cancer in Example 1 of the present invention.
[0029] Figure 2 This is a graph showing the expression level analysis of the C9ORF50 gene in tumors of colorectal cancer patients at different clinical stages, obtained from the analysis of public databases in Example 1 of this invention.
[0030] Figure 3 This is a graph showing the correlation between C9ORF50 expression and overall survival (A) and progression-free survival (B) of colorectal cancer patients, obtained based on Kaplan-Mier analysis in Example 1 of this invention.
[0031] Figure 4 The T7E1 experiment in Example 2 of this invention was used to detect the knockout efficiency of the C9ORF50 gene in MC38, Hepa, Pan02, E0771 and B16F10 cells.
[0032] Figure 5 This is a growth curve diagram of colorectal cancer (A), liver cancer (B), pancreatic cancer (C), breast cancer (D), and melanoma (E) tumor cells with and without C9ORF50 gene knockout in mice after subcutaneous transplantation in Example 2 of the present invention.
[0033] Figure 6 The images (A) and (B) show tumors formed 10 days after subcutaneous transplantation of C9ORF50 gene knockout and non-knockout colorectal cancer cells in mice in Example 2 of this invention.
[0034] Figure 7 The images (A) and (B) show tumor images and tumor weight statistics of C9ORF50 gene knockout and non-knockout colorectal cancer cells after orthotopic transplantation into the colon of mice 10 days later, as described in Example 2 of this invention.
[0035] Figure 8 This is a graph showing the changes in mRNA levels of chemokines CCL5 (A), CXCL9 (B), CXCL10 (C), and CXCL11 (D) in MC38-sgC9ORF50 and MC38-sgNTC cells in Example 3 of the present invention.
[0036] Figure 9 This is a graph showing the changes in mRNA levels of chemokines IFN-α (A), IFN-β (B), IL-6 (C), and TNF-α (D) in MC38-sgC9ORF50 and MC38-sgNTC cells in Example 3 of the present invention.
[0037] Figure 10This is a graph showing the changes in protein content of chemokines CCL5 (A), CXCL9 (B), CXCL10 (C), and CXCL11 (D) in MC38-sgC9ORF50 and MC38-sgNTC cell culture media, cell lysates obtained by repeated freeze-thaw cycles, and cell lysates obtained by RIPA assay in Example 3 of this invention.
[0038] Figure 11 This is a graph showing the changes in protein content of chemokines IFN-α (A), IFN-β (B), IL-6 (C), and TNF-α (D) in MC38-sgC9ORF50 and MC38-sgNTC cell culture media, cell lysates obtained by repeated freeze-thaw cycles, and cell lysates obtained by RIPA assay in Example 3 of this invention.
[0039] Figure 12 This image shows multicolor immunofluorescence staining of CD3, CD4, and CD8 molecules and a statistical diagram of positive cells in subcutaneous tumors formed by MC38-sgC9ORF50 and MC38-sgNTC cells in Example 3 of this invention.
[0040] Figure 13 This is the quantitative PCR detection result of the knockdown efficiency of C9ORF50 mRNA in MC38 tumor cells by the three siRNAs in Example 4 of the present invention.
[0041] Figure 14 The images show the tumor growth curve (A) after subcutaneous injection of siC9ORF50 and NCsiRNA into the xenograft of colorectal cancer in mice in Example 4 of this invention, and a tumor photograph (B) 30 days after transplantation.
[0042] Figure 15 This is a multicolor immunofluorescence staining image of CD3, CD4 and CD8 molecules and a statistical diagram of positive cells in the tumor after subcutaneous injection of siC9ORF50 and NCsiRNA into the xenograft of colorectal cancer in mice, as shown in Example 4 of this invention.
[0043] Figure 16 The images show tumor growth curves (A) and tumor photographs (B) taken 30 days after transplantation of cholesterol-siC9ORF50 and cholesterol-NCsiRNA into mouse subcutaneous colorectal cancer xenografts in Example 4 of this invention.
[0044] Figure 17 This is a multicolor immunofluorescence staining image of CD3, CD4 and CD8 molecules and a statistical diagram of positive cells in the tumor after subcutaneous injection of cholesterol-siC9ORF50 and cholesterol-NCsiRNA into the xenograft of colorectal cancer in mice, as shown in Example 4 of this invention. Detailed Implementation
[0045] The present invention will be further described below with reference to specific preferred embodiments, but this does not limit the scope of protection of the present invention.
[0046] The materials, reagents, and instruments used in the following examples are all commercially available. Unless otherwise specified, the experimental methods used in the following examples are conventional methods in the art.
[0047] Example 1
[0048] A tumor intervention target of the present invention: the C9ORF50 gene. The DNA sequence is shown in SEQ ID NO.1 (>NM_199350.4Homo sapiens chromosome 9 open reading frame 50 (C9orf50), mRNA).
[0049] Protein sequence > NP_955382.3 uncharacterized protein C9orf50 [Homo sapiens], as shown in SEQ ID NO.2.
[0050] Example 2
[0051] This paper describes the application of the C9ORF50 gene in Example 1 in the preparation of a diagnostic kit for detecting the prognosis of tumor patients. C9ORF50 expression level is negatively correlated with the prognosis of tumors (such as colorectal cancer). When C9ORF50 expression level is higher than normal, the prognosis of tumor patients is poor, and the future survival rate is low; when C9ORF50 expression level is lower than normal, the prognosis of tumor patients is good, and the future survival rate is high. We downloaded expression profile data and clinical follow-up data from the TCGA database and integrated the two sets of data for subsequent analysis. Preliminary data mining and analysis were performed on online clinical databases such as TCGA using R language, cBioportal, and GEPIA.
[0052] Experiment 1: To investigate the expression level of C9ORF50 in colorectal cancer tumor tissues.
[0053] Figure 1 This is a graph analyzing the expression level of C9ORF50 in colorectal cancer tumors. The graph shows that the expression level of C9ORF50 in colorectal cancer tumor tissues is higher than that in normal tissues (adjacent tissues). This suggests that the C9ORF50 gene could be used to develop kits targeting drug interventions for colorectal cancer.
[0054] Furthermore, taking colorectal cancer as an example, the expression level of C9ORF50 in colorectal cancer tissues was examined from clinical stage I to IV.
[0055] Figure 2 This figure shows the expression level of the C9ORF50 gene in tumors of colorectal cancer patients at different clinical stages. The figure indicates that the C9ORF50 expression level gradually increases from stage I to stage IV colorectal cancer patients.
[0056] Furthermore, we examined the survival curves of colorectal cancer patients.
[0057] Figure 3 This is a correlation plot based on Kaplan-Mier analysis between C9ORF50 expression and overall survival (A) and progression-free survival (B) in colorectal cancer patients. The plot shows that patients with high C9ORF50 expression have significantly lower survival rates than those with low expression.
[0058] In summary, these results suggest that the gene function of C9ORF50 may be beneficial to the occurrence and development of colorectal cancer. It should be noted that C9ORF50 is a gene with unknown function; its methylation modification can serve as a diagnostic marker for esophageal, gastric, and colorectal cancers. However, the targetability of C9ORF50 in tumors remains unreported.
[0059] Example 3
[0060] An example of Example 1 illustrates the application of the C9ORF50 gene in the preparation of an anti-tumor drug, where tumor growth is inhibited by knocking out the C9ORF50 gene. The sgRNA sequence targeting and knocking out C9ORF50 is as follows:
[0061] Mouse sgRNA1: 5'-GTCTGCGAATCGTACCCGGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3'.
[0062] Mouse sgRNA2: 5'-GAGGGACAAACCATTGCACTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3'.
[0063] Human sgRNA1: 5'-TCTCGTCAGCGAATCGCACCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3' (SEQ ID NO. 3).
[0064] Human sgRNA2: 5'-AGCGTCTGCGCTCCCAGTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3' (SEQ ID NO. 4).
[0065] Specifically, the following steps are included:
[0066] (1) Establish different tumor cell lines with Cas9 gene knock-in.
[0067] 1.1. HEK293T cells were seeded at a density of 30% in 10cm culture dishes. When the cells reached 80% confluence, the spCas9 expression plasmid PHKO14 (containing the cytotoxic gene) and the lentiviral backbone packaging plasmid pMD2.g and psPAX2 (containing the spCas9 encoding gene) were transfected according to the instructions using Lipofectamine 3000 reagent (Thermo Fisher Scientific).
[0068] 1.2. 48 h after transfection, collect the cell supernatant culture medium, centrifuge at 2000 rpm for 10 minutes at 4℃, and collect the supernatant containing the virus.
[0069] (2) Transfect the cell lines with the supernatant containing the virus. The cell lines selected in this invention are one of the following: mouse colorectal cancer MC38 cell line, mouse pancreatic cancer cell line Pan02, mouse liver cancer cell line Hepa, mouse breast cancer cell line E0771, and mouse melanoma cell line B16F10. The specific steps are as follows:
[0070] 2.1. MC38, Pan02, Hepa, E0771 and B16F10 were seeded at a density of 30% in 10cm cell culture dishes and cultured for 24h.
[0071] 2.2 Mix 5 ml of virus-containing supernatant with 5 ml of culture medium at a volume ratio of 1:1, add 10 μl of polybrane and mix well to infect the cells.
[0072] 2.2. 24 hours after infection, the infected cells were screened with cypermethrin to enrich the surviving cells, which were the positive cells of successful infection.
[0073] 2.3 After 10 days of screening, the enriched positive cells were passaged and cultured to obtain MC38-cas9, Pan02, Hepa-cas9 and E0771-cas9 cells, respectively.
[0074] (2) Establish different tumor cell lines with C9ORF50 gene knockout.
[0075] 1.1. HEK293T cells were seeded at a density of 30% in 10cm culture dishes. When the cells reached 80% confluence, they were transfected with Lipofectamine 3000 reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. The transfected plasmid psc007 (containing the puromycin resistance gene) and lentiviral backbone packaging plasmids pMD2.g and psPAX2 (containing the C9ORF50 knockout sgNTC lentivirus) were used.
[0076] 1.2. 48 h after transfection, collect the cell supernatant culture medium, centrifuge at 2000 rpm for 10 minutes at 4℃, and collect the supernatant containing the virus.
[0077] 1.3. MC38-cas9, Pan02, Hepa-cas9, E0771-cas9 and B16F10-cas9 cells were seeded at a density of 30% in 10cm cell culture dishes and cultured for 24h.
[0078] 1.4 Mix 5 ml of virus-containing supernatant with 5 ml of DMEM medium containing 10% fetal bovine serum at a volume ratio of 1:1, add 10 μl of polybrane and mix well to infect the cells.
[0079] 1.5. Twenty-four hours after infection, the infected cells were screened using puromycin (the screening criterion was whether the cells died; those that survived were considered successfully transfected, i.e., positive cells). Successfully infected positive cells (MC38-sgC9ORF50, Pan02-sgC9ORF50, Hepa-sgC9ORF50, E0771-sgC9ORF50, and B16F10-sgC9ORF50 cells) were enriched. This yielded a C9ORF50 gene knockout tumor cell line.
[0080] Comparative Example 1
[0081] The sequence of knocking out non-target-related sgRNA (sgNTC) was compared with that in Example 2, where the sgNTC sequence is 5'-ACGGAGGCTAAGCGTCGCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3'.
[0082] Its application method specifically includes the following steps:
[0083] (1) Establish different tumor cell lines with non-target-independent sgNTC knock-in.
[0084] 1.1. HEK293T cells were seeded at a density of 30% in 10cm culture dishes. When the cells reached 80% confluence, they were transfected with the psc007 plasmid (containing the puromycin resistance gene) expressing the sgNTC sequence and the lentiviral backbone packaging plasmids pMD2.g and psPAX2 packaging plasmids containing non-targeting sgNTC lentiviruses according to the instructions using Lipofectamine 3000 reagent (Thermo Fisher Scientific).
[0085] 1.2. 48 h after transfection, collect the cell supernatant culture medium, centrifuge at 2000 rpm for 10 minutes at 4℃, and collect the supernatant containing the virus.
[0086] (2) Transfect the cell line with the supernatant containing the virus.
[0087] 2.1. MC38-cas9, Pan02, Hepa-cas9 and E0771-cas9 cells were seeded at a density of 30% in 10cm cell culture dishes and cultured for 24h.
[0088] 2.2 Mix 5 ml of virus-containing supernatant with 5 ml of DMEM medium containing 10% fetal bovine serum at a volume ratio of 1:1, add 10 μl of Polybrane and mix well to infect the cells.
[0089] 2.3. 24 hours after infection, the infected cells were screened with puromycin (the screening criterion was whether the cells died; those that survived were successfully transfected, i.e., positive cells), and the successfully infected positive cells (MC38-sgNTC, Pan02-sgNTC, Hepa-sgNTC, E0771-sgNTC, B16F10-sgNTC cells) were enriched.
[0090] Experiment 2: To investigate the knockout efficiency of various tumor cell lines.
[0091] The genomes of the cell lines obtained in Example 2, Comparative Example 1 and Comparative Example 2 were extracted, and the T7E1 experiment was performed to detect the knockout status of the cells.
[0092] Figure 4 The T7E1 experiment in Example 2 of this invention was used to detect the knockout efficiency of the C9ORF50 gene in MC38, Hepa, Pan02, E0771, and B16F10 cells. The figure shows that the T7E1 experiment results indicate high knockout efficiency in each cell line, making them suitable for subsequent experiments.
[0093] (3) Mouse subcutaneous tumorigenesis model. This includes the following steps:
[0094] 3.1 Selection of Mice: The C57BL / 6j mice used in this invention were purchased from Wuhan Beisai Model Biotechnology Co., Ltd. The purchased mice were acclimatized in the laboratory's breeding room for two weeks.
[0095] 3.2. Cells from Example 2 and Comparative Example 1 were digested, washed twice with PBS, and counted at a rate of 2 × 10⁻⁶ cells per cell. 6 Each cell was resuspended in 100 μL of PBS at low temperature and stored at low temperature for later use.
[0096] 3.3. When mice reach 7-8 weeks of age, subcutaneous tumor transplantation is prepared. Each experiment requires 6-10 replicates. The specific steps are as follows: Before surgery, mice are placed in an induction box for inhaled isoflurane anesthesia, and the toes are pinched to confirm complete anesthesia. After complete anesthesia, the mice are placed on the operating table and placed in the induction box for inhaled isoflurane anesthesia. After complete anesthesia, the ears of each group of mice are clipped and marked. Subsequently, the hair on the lower left groin of the mice is shaved, and the skin surface is disinfected with 75% alcohol. The transplantation is performed at a rate of 2 × 10⁶ mice per mouse. 6 A sample of cells was injected. Subsequently, some warming measures were taken to restore the mice's body temperature and heart rate to their pre-anesthesia state as quickly as possible. After they were able to move independently, they were returned to the IVC cage for continued rearing, and their condition was closely monitored for 24 hours after the operation.
[0097] Experiment 3: To investigate the inhibitory effect of C9ORF50 gene expression loss on tumor development in different tumor cell lines using a mouse subcutaneous tumor model.
[0098] Tumor growth in mice was monitored daily after cell inoculation, and tumor volume was measured on days 3, 6, 9, 12, 15, 18, 21, 24, 27, and 30 post-transplantation. The measurement method was as follows: anesthetized mice were placed on an operating table, and the outline dimensions (length, width, and height) of the tumor were measured using calipers. The tumor volume was then calculated using an algorithm (V = 4 / 3 × π × length / 2 × height / 2 × width / 2), and the results were recorded. Tumor growth curves were plotted based on the measurement results.
[0099] Figure 5 This is a growth curve diagram of colorectal cancer (A), pancreatic cancer (B), liver cancer (C), breast cancer (D), and melanoma (E) tumor cells with and without C9ORF50 gene knockout in mice after subcutaneous transplantation in Example 2 of the present invention.
[0100] The figure shows that in colorectal cancer (A), pancreatic cancer (B), liver cancer (C), breast cancer (D), and melanoma (E), the growth rate of tumors in the C9ORF50 gene knockout group (sgC9ORF50) was significantly lower than that of tumors in the control group (sgNTC), and the tumors completely disappeared approximately 20 days after transplantation. This indicates that C9ORF50 gene knockout significantly inhibits the development of colorectal cancer, pancreatic cancer, liver cancer, breast cancer, and melanoma in vivo.
[0101] Experiment 4: To investigate the inhibitory effect of C9ORF50 gene expression loss on the development of colorectal cancer in a mouse subcutaneous tumor model.
[0102] On day 10 post-transplantation, 10 mice that had received MC38-sgC9ORF50 and MC38-sgNTC cells were randomly sacrificed. Subcutaneous tumors were surgically removed, weighed, and their morphology was photographed. The tumor tissue was then embedded in paraffin and tissue sections were prepared.
[0103] Figure 6 The figures show photographs (A) and tumor weight statistics (B) of colorectal cancer cells with and without C9ORF50 gene knockout, 10 days after subcutaneous transplantation in mice. As shown, the tumors in the C9ORF50 knockout group were significantly smaller in both morphology and weight than those in the MC38-NTC group. Through subcutaneous tumorigenesis experiments in mice, we demonstrated that C9ORF50 gene knockout significantly inhibits the tumorigenicity of the MC38 cell line in C57BL / 6j mice.
[0104] Furthermore, this invention utilizes a mouse colorectal tumor in situ model to verify the inhibitory effect of C9ORF50 gene knockout on the tumorigenicity of MC38 cells. Seven- to eight-week-old C57BL / 6j mice were selected, with three replicates per experiment. Mice undergoing surgery were anesthetized before the procedure, and the abdominal skin was dissected to expose the colon. 2 × 10⁻⁶ g of the C9ORF50 gene was then injected into the colon. 6 Mice were transplanted with MC38-sgC9ORF50 or MC38-sgNTC cells. After the wound was sutured, the mice were fed normally. On day 10 post-transplantation, the mice were euthanized, the colon and rectum were surgically separated, photographed, and the subcutaneous tumor was removed and weighed.
[0105] Figure 7The images (A) and (B) show tumor photographs (10 days after orthotopic transplantation of C9ORF50 gene knockout and non-knockout colorectal cancer cells into the mouse colon in Example 2 of this invention. As shown in the figures, the tumors in the C9ORF50 gene knockout group were significantly smaller in both morphology and weight than those in the MC38-NTC group, further demonstrating that knocking out the C9ORF50 gene inhibits the tumorigenicity of the MC38 cell line in C57BL / 6j mice.
[0106] Example 4
[0107] This invention relates to the application of the C9ORF50 gene in the preparation of drugs that regulate tumor immunity against colorectal cancer cells. Knocking out the C9ORF50 gene promotes tumor immune microenvironment remodeling, significantly upregulating chemokines CCL5, CXCL9, CXCL10, and CXCL11, and cytokines IFN-α, IFN-β, IL-6, and TNF-α. CD4+ levels in colorectal cancer tumor tissue are also significantly increased. + T and CD8 + The significantly enhanced infiltration of T cells demonstrates that knocking out the C9ORF50 gene enhances the body's tumor immune response to colorectal cancer cells.
[0108] Its application method is as follows:
[0109] (1) Establish different tumor cell lines with C9ORF50 gene knockout. MC38-sgC9ORF50 cells were obtained according to the method in Example 2.
[0110] Meanwhile, MC38-sgNTC cells were obtained using the same method as in Comparative Example 1.
[0111] Experiment 5: Detection of immune factors in C9ORF50 knockout tumor cells.
[0112] 5.1 Collect MC38-sgC9ORF50 and MC38-sgNTC cells in the logarithmic growth phase. Extract total RNA according to the Invitrogen Trizol instruction manual. Agarose gel electrophoresis was used to assess the total RNA quality, and the total RNA concentration was determined using a NanoDrop microspectrophotometer. cDNA was obtained according to the Thermo Fisher Scientific RevertAid RT reverse transcription kit instruction manual.
[0113] RevertAid RT reverse transcription reaction system:
[0114]
[0115] The reverse transcription reaction system was prepared by reacting at 25℃ for 5 min, 42℃ for 1 h, and 70℃ for 10 min to inactivate the reverse transcriptase.
[0116] 5.2. cDNA was obtained using TB. Premix Ex Taq TM Takara reagent was used for real-time quantitative detection on a LightCycler 480II Real-time PCR instrument (Roche). The quantitative PCR program was a two-step Real-time PCR: 95℃ pre-denaturation for 30 s; followed by each subsequent step of 95℃ denaturation for 10 s, annealing and extension at 60℃ for 30 s, for a total of 40 cycles. After PCR, denaturation was performed at 95℃ for 1 min, followed by cooling to 55℃ to ensure complete DNA double-strand binding. From 55℃ to 95℃, the temperature was increased by 0.5℃ at each step, held for 4 s, and absorbance was recorded simultaneously to construct a melting curve. SDHA gene expression level was used as an internal control, and 2... -ΔΔCt The expression abundance of immune molecules such as chemokines (CCL5, CXCL9, CXCL10, and CXCL11) and cytokines (IFN-α, IFN-β, IL-6, and TNF-α) in cells of each group was calculated using analytical methods. Each experiment was conducted in 3-6 replicates.
[0117] Figure 8 The graph shows the changes in mRNA levels of chemokines CCL5 (A), CXCL9 (B), CXCL10 (C), and CXCL11 (D) in MC38-sgC9ORF50 and MC38-sgNTC cells.
[0118] Figure 9 The graph shows the changes in mRNA levels of chemokines IFN-α (A), IFN-β (B), IL-6 (C), and TNF-α (D) in MC38-sgC9ORF50 and MC38-sgNTC cells.
[0119] from Figure 8 and Figure 9 The results showed that knocking out the C9ORF50 gene led to the loss of the chemokine CCL5 in MC38 cells. Figure 8 A) CXCL9 ( Figure 8 B), CXCL10 Figure 8 C) and CXCL11 ( Figure 8 D) and cytokine IFN-α ( Figure 9 A in IFN-β Figure 9 B in IL-6 Figure 9 C) and TNF-α Figure 9 The expression of D in both D and D was significantly upregulated.
[0120] Furthermore, in this invention, the supernatant cell culture medium of MC38-sgC9ORF50 and MC38-sgNTC cells in the logarithmic growth phase was separately aspirated, and cell lysates of MC38-sgC9ORF50 and MC38-sgNTC cells were extracted using repeated freeze-thaw cycles and RIPA lysis. The specific steps are as follows:
[0121] 5.3. After trypsin digestion of MC38-sgC9ORF50 and MC38-sgNTC cells in the logarithmic growth phase, the cells were washed three times with PBS. 2 × 10⁻⁶ cells were then collected. 6 Cells were collected, centrifuged, and the supernatant was removed. The cells were then stored at -20°C.
[0122] 5.4 After 1 hour, remove the cells and thaw them rapidly in a 40°C water bath. After thawing, place them in a -20°C freezer. Repeat the freeze-thaw cycle multiple times until the cells are completely lysed. Then, centrifuge at 15000g for 10 minutes at 4°C and collect the supernatant for analysis.
[0123] The RIPA lysis method was performed according to the Thermo Fisher Scientific RIPA lysis buffer (#89901) instructions, with a cell lysis volume of 2 × 10⁻⁶ cells. 6 Cells were lysed with RIPA and centrifuged at 15000g for 10 min at 4℃. The supernatant was collected for analysis. The levels of immune molecules such as chemokines (CCL5, CXCL9, CXCL10, and CXCL11) and cytokines (IFN-α, IFN-β, IL-6, and TNF-α) in the samples were detected using the mouse CCL5, CXCL9, CXCL10, CXCL11, IFN-α, IFN-β, IL-6, and TNF-α ELISA kit from Hunan Aifang Biotechnology Co., Ltd., according to the relevant instructions. Each experiment was performed in 3-6 replicates.
[0124] Figure 10 The graph shows the changes in protein content of chemokines CCL5 (A), CXCL9 (B), CXCL10 (C), and CXCL11 (D) in MC38-sgC9ORF50 and MC38-sgNTC cell culture medium, cell lysate obtained by repeated freeze-thaw cycles, and cell lysate obtained by RIPA assay.
[0125] Figure 11 The graph shows the changes in protein content of chemokines IFN-α (A), IFN-β (B), IL-6 (C), and TNF-α (D) in MC38-sgC9ORF50 and MC38-sgNTC cell culture medium, cell lysate obtained by repeated freeze-thaw method, and cell lysate obtained by RIPA method.
[0126] from Figure 10 and Figure 11The results showed that knocking out the C9ORF50 gene led to the synthesis and secretion of the chemokine CCL5 into the culture medium in MC38 cells. Figure 10 A) CXCL9 ( Figure 10 B), CXCL10 Figure 10 C) and CXCL11 ( Figure 10 D) and cytokine IFN-α ( Figure 11 A in IFN-β Figure 11 B in IL-6 Figure 11 C) and TNF-α Figure 11 D) in the middle molecule was significantly upregulated.
[0127] These results demonstrate that the deletion of the C9ORF50 gene in colorectal cancer cells leads to the activation of the immune response, suggesting that it affects the tumor's immune microenvironment.
[0128] Experiment 6: Detection of immune cell infiltration in C9ORF50 knockout tumors.
[0129] The infiltration of T lymphocytes in subcutaneous colorectal cancer tumors formed by MC38-sgC9ORF50 and MC38-sgNTC cell lines was detected. The specific steps were as follows: tumor tissue was fixed in formalin solution and then sectioned in paraffin. Immunofluorescence staining was performed using mouse CD3 antibody (ThermoFisher), mouse CD4 antibody (ThermoFisher), and mouse CD8 antibody (ThermoFisher). After photographing under a fluorescence microscope, the data were analyzed.
[0130] Figure 12 Multicolor immunofluorescence staining images and statistical diagrams of CD3, CD4, and CD8 molecules in subcutaneous tumors formed by MC38-sgC9ORF50 and MC38-sgNTC cells. Experiments showed that knockout of the C9ORF50 gene led to increased CD4 concentration in colorectal cancer tumor tissue. + T and CD8 + The significantly enhanced infiltration of T cells demonstrates that knocking out the C9ORF50 gene enhances the body's tumor immune response to colorectal cancer cells.
[0131] Example 5
[0132] An application of the C9ORF50 gene in the preparation of antitumor drugs according to the present invention. By using chemically synthesized, unmodified siRNA to inhibit the expression of C9ORF50 mRNA in cells, the body's tumor immune response against colorectal cancer cells is enhanced.
[0133] The specific steps include:
[0134] (1) Prepare siRNA targeting the mouse C9ORF50 gene.
[0135] Gene information for the mouse homology of the C9ORF50 gene, 1700001o22Rik(NM_198000.3), was retrieved from GenBank; effective siRNA targets for this gene were designed. Four siRNA sequences were chemically synthesized by Suzhou Hongxun Biotechnology Co., Ltd.
[0136] siC9ORF50-1:
[0137] Chain of Justice (5'-3'): AGCUGUAUCUGUGUCAGAACGTT (SEQ ID NO.5);
[0138] Antisense chain (5'-3'): CGUUCUGACACAGAUACAGCUTT (SEQ ID NO.6).
[0139] siC9ORF50-2:
[0140] Chain of Justice (5'-3'): GGGUACGAUUCGCAGACGAGATT (SEQ ID NO.7);
[0141] Antisense chain (5'-3'): UCUCGUCUGCGAAUCGUACCCTT (SEQ ID NO.8).
[0142] siC9ORF50-3:
[0143] Chain of Justice (5'-3'): GCUGCUUAUUCCUCCCAGACCTT (SEQ ID NO.9);
[0144] Antonym chain (5'-3'): GGUCUGGGAGGAAUAAGCAGCTT (SEQ ID NO.10).
[0145] Negative control siRNA (NCsiRNA):
[0146] Justice Chain (5'-3'): UUCUCCGAACGUGUCACGUdTdT;
[0147] Antisense chain (5'-3'): ACGUGACACGUUCGGAGAAdTdT.
[0148] (2) The C9ORF50 gene was silenced using chemically synthesized, unmodified siRNA. Mouse colorectal cancer cells MC38 in logarithmic growth phase were digested with trypsin to prepare a cell suspension (approximately 5 × 10⁻⁶ cells). 4( / ml) was seeded in 24-well plates and cultured until cell confluence reached approximately 50%. siRNA was transfected, with three replicates per group. The specific steps are as follows:
[0149] 2.1 Dilute the synthesized siRNA with 50 μL of Opti-MEM to achieve a final concentration of 50 nM in transfected cells.
[0150] 2.2 Add 1.0 μL of Lipofectamine™ 2000 to 50 μL of Opti-MEM, gently mix by blowing and aspiration, and let stand at room temperature for 5 min.
[0151] 2.3 Mix the siRNA dilution buffer and transfection reagent, and let stand at room temperature for 20 min. Then add 100 μL of transfection material dropwise to a 24-well cell culture plate, gently shake to mix, and incubate at 37°C, 5% CO2 for 6 h, then replace with fresh culture medium.
[0152] 2.4. After 48 hours of culture, cells were collected. Total RNA was extracted according to the Invitrogen Trizol instruction manual. The total RNA quality was assessed by agarose gel electrophoresis, and the total RNA concentration was determined using a NanoDrop microspectrophotometer. cDNA was obtained according to the Thermo Fisher Scientific RevertAid RT reverse transcription kit instruction manual.
[0153] Experiment 7: Investigate the effect of siRNA knockdown of the C9ORF50 gene on suppressing the malignant phenotype of tumor cells.
[0154] cDNA was used with TB Premix Ex Taq TM Takara reagent was used for real-time quantitative detection on a LightCycler 480II Real-time PCR instrument (Roche). SDHA gene expression level was used as an internal control, and the expression abundance of C9ORF50 mRNA transfected with siRNA was calculated using the 2-ΔΔCt analysis method.
[0155] Figure 13 This is the quantitative PCR result of the knockdown efficiency of C9ORF50 mRNA in MC38 tumor cells by the three siRNAs in Example 4 of this invention. As can be seen from the figure, siC9ORF50-1 and siC9ORF50-3 have a strong inhibitory effect on C9ORF50 mRNA in MC38 cells, with siC9ORF50-3 showing the best effect. Therefore, subsequent experiments only tested siC9ORF50-3.
[0156] Experiment 8: To investigate the ability of chemically synthesized, unmodified siRNA to knock down C9ORF50 and inhibit tumorigenesis in MC38 cells in vivo.
[0157] Mouse colorectal cancer cells MC38 in logarithmic growth phase were digested with trypsin, diluted with PBS, and a cell suspension was prepared (cell count approximately 2 × 10⁻⁶). 7 Cells ( / ml) were injected subcutaneously into the left lower groin of C57BL / 6j mice. Tumor growth was monitored daily after cell inoculation. On days 6, 9, and 12 post-transplantation, 30 μg siC9ORF50 or NCsiRNA was injected at multiple sites into the tumor of each mouse. Tumor volume was measured on days 3, 6, 9, 12, 15, 18, 21, 24, 27, and 30 post-transplantation. The measurement method involved placing anesthetized mice on an operating table and measuring the tumor's outline (length, width, and height) using calipers. The tumor volume was then calculated using an algorithm (V = 4 / 3 × π × length / 2 × height / 2 × width / 2), and the results were recorded. A tumor growth curve was plotted based on the measurement results. One month after transplantation, mice were sacrificed, subcutaneous tumor tissue was isolated, and photographs were taken to compare the effect of C9ORF50 knockdown on tumor size. Simultaneously, tissue sections were prepared from the tumor tissue, and immunofluorescence staining was used to analyze CD4+ in the tumor tissue. + T and CD8 + T-cell infiltration.
[0158] Figure 14 The figures show tumor growth curves (A) and tumor photographs (B) 30 days after subcutaneous injection of siC9ORF50 and NCsiRNA into mouse colorectal cancer xenografts in Example 4 of this invention. As shown in the figures, the tumor growth curves indicate that, compared to the control group (NCsiRNA), the proliferation of mouse colorectal cancer cells MC38 was significantly inhibited after siC9ORF50 injection. The tumor size further demonstrates that MC38 cell proliferation was significantly inhibited after siC9ORF50 injection, indicating that C9ORF50 knockdown significantly inhibits the tumorigenic ability of MC38 cells in vivo. After unmodified siRNA knockdown of C9ORF50, CD4+ in the tumor tissue... + T and CD8 + Enhanced T-cell infiltration demonstrates that knocking down the C9ORF50 gene enhances the body's tumor immune response to colorectal cancer cells.
[0159] Figure 15 This is a multicolor immunofluorescence staining image of CD3, CD4 and CD8 molecules and a statistical diagram of positive cells in the tumor after subcutaneous injection of siC9ORF50 and NCsiRNA into the xenograft of colorectal cancer in mice, as shown in Example 4 of this invention.
[0160] However, due to the poor stability and cell transfection efficiency of unmodified siRNA in vivo, unmodified siRNA is not the best tumor intervention method.
[0161] Example 6
[0162] This invention relates to the application of the C9ORF50 gene in the preparation of antitumor drugs. Building upon Example 5, cholesterol modification at the 5' end of siRNA can promote cellular uptake of siRNA, increase membrane permeability, and prolong the half-life of siRNA in serum, thereby enhancing its in vivo tumor intervention effect. Therefore, this invention modifies the 5' end of the aforementioned siC9ORF50 and NCsiRNA with cholesterol, obtaining the corresponding cholesterol-siC9ORF50 and cholesterol-NCsiRNA. Subsequently, this siRNA was used to knock down the C9ORF50 gene in mouse tumors, following the same experimental procedure as the unmodified siRNA knockdown process.
[0163] Experiment 9: To investigate the ability of siRNA knockdown of C9ORF50 to inhibit tumorigenesis in MC38 cells in vivo.
[0164] Figure 16 The images show tumor growth curves (A) and tumor photographs (B) taken 30 days after subcutaneous injection of cholesterol-siC9ORF50 and cholesterol-NCsiRNA into mouse colorectal cancer xenografts, as described in Example 4 of this invention. The results show that the tumor growth curves indicate that, compared to the control group (cholestrol-NCsiRNA), injection of cholesterol-siC9ORF50 significantly inhibited the proliferation of mouse colorectal cancer cells (MC38 cells) in mice. The tumor size data further demonstrates that the proliferation of MC38 cells was significantly inhibited after injection of cholesterol-siC9ORF50.
[0165] Figure 17 The images show (A) and (B) of multicolor immunofluorescence staining of CD3, CD4, and CD8 molecules in mouse colorectal cancer xenografts after subcutaneous injection of cholesterol-siC9ORF50 and cholesterol-NCsiRNA in Example 4 of this invention; the figures show that after cholesterol-modified siRNA knocked down C9ORF50, CD4 in the tumor tissue was reduced. + T and CD8 +The significantly enhanced T cell infiltration demonstrates that cholestrol-modified siRNA knockdown of the C9ORF50 gene enhances the body's tumor immune response against colorectal cancer cells, indicating that C9ORF50 knockdown significantly inhibits the tumorigenic ability of MC38 cells in vivo. This demonstrates that the modified siRNA has a better tumor-suppressing effect and is a relatively ideal intervention method.
[0166] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solutions of the present invention shall still fall within the protection scope of the technical solutions of the present invention.
Claims
1. The application of a reagent targeting the C9ORF50 gene in the preparation of antitumor drugs, characterized in that, The gene sequence of the C9ORF50 gene is shown in SEQ ID NO.1, the tumor is colorectal cancer, and the reagents targeting the C9ORF50 gene are sgRNA1, sgRNA2, siC9ORF50-1 or siC9ORF50-3. The gene sequence of the sgRNA1 is shown in SEQ ID NO.3; The gene sequence of the sgRNA2 is shown in SEQ ID NO.4; The gene sequence of siC9ORF50-1 is shown in SEQ ID NO.5 and SEQ ID NO.6; The gene sequence of siC9ORF50-3 is shown in SEQ ID NO.9 and SEQ ID NO.
10.
2. The application according to claim 1, characterized in that, The 5' ends of siC9ORF50-1 and siC9ORF50-3 are modified with cholesterol.
Citation Information
Patent Citations
Colorectal cancer DNA methylation markers
WO2014062218A1