Development, preparation and application of a carbapenamase immunochromatographic kit

By developing a carbapenemase immunochromatographic assay kit, which utilizes specific antibodies for multi-target detection, the problem of insufficient sensitivity and specificity in existing carbapenemase detection products has been solved. This enables efficient detection of multiple carbapenemase variants, supporting clinical diagnosis and treatment.

CN119775426BActive Publication Date: 2026-08-25JIANGSU MEDOMICS MEDICAL TECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411976295.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2026-08-25
Estimated Expiration
2044-12-31

AI Technical Summary

Technical Problem

Current technology lacks a carbapenemase detection product that is highly sensitive, specific, and can cover multiple genotypes, especially in carbapenemase-resistant bacterial infections, where it cannot effectively detect multiple carbapenemase variants.

Method used

A carbapenemase immunochromatographic kit has been developed, which utilizes specific antibodies against different carbapenemase variants, including anti-KPC, IMP, NDM, VIM and OXA48 carbapenemase antibodies, to achieve rapid and convenient multi-target detection via immunochromatography.

Benefits of technology

It achieves high sensitivity and specificity for the detection of KPC, IMP, NDM, VIM and OXA48 carbapenemases, and can provide accurate results in a short time, covering multiple genotypes, to assist in clinical diagnosis and guide medication.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119775426B_ABST
    Figure CN119775426B_ABST
Patent Text Reader

Abstract

The application discloses development, preparation and application of a carbapenemase immunochromatography kit, and belongs to the technical field of biological medicines.According to amino acid sequence comparison of five common carbapenemase variants of KPC, IMP, NDM, VIM and OXA48, the application obtains a conservative antigen epitope sequence to prepare an immunogen.Mice are immunized, and a specific antibody pair with high affinity and capable of combining multiple variants is obtained through multi-platform screening.Based on this, the application develops a carbapenemase five-union detection kit by using an immunochromatography method, and the kit has the advantages of high sensitivity, good specificity, covering multiple drug-resistant variants, one-time detection of multiple targets, rapid and convenient detection, and the like, and provides important help for clinical auxiliary diagnosis and medication guidance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the development, preparation and application of a carbapenemase immunochromatographic kit, belonging to the field of biomedical technology. Background Technology

[0002] Commonly found Enterobacteriaceae in clinical practice include Escherichia coli, Klebsiella pneumoniae, Enterobacter spp., Proteus spp., and Salmonella spp. β-lactamase production is the most significant drug resistance mechanism in Enterobacteriaceae, and the epidemiology of Enterobacteriaceae producing extended-spectrum β-lactamase (ESBL), cephalosporinase (AmpC)-producing, and carbapenemase-producing bacteria is of great clinical concern. Bacterial resistance is further amplified during infectious disease outbreaks and surgical infections. Drug-resistant infections pose a significant challenge and threat to surgical clinics, leading not only to treatment failure, prolonged treatment duration, and increased patient costs, but also increasing the risk of transmission, hospital infection rates, and mortality. Therefore, antimicrobial resistance has become an urgent global health and socioeconomic crisis. Carbapenem-resistant Enterobacteriaceae (CRE), listed as a critical priority pathogen by the World Health Organization (WHO), has become a major focus of attention.

[0003] The U.S. Centers for Disease Control and Prevention (CDC) defines CRE as Enterobacteriaceae that are insensitive to any carbapenem antibiotics (i.e., have a minimum inhibitory concentration (MIC) ≥4 μg / ml for dribineem, meropenem, or imipenem, or a MIC ≥2 μg / ml for ertapenem) or that have been shown to produce carbapenemase. Carbapenem antibiotics are a class of broad-spectrum β-lactam antibiotics that inhibit bacterial cell wall synthesis by suppressing penicillin-binding proteins (PBPs) and were once considered a "last resort" in antimicrobial therapy by many hospitals. Currently, CRE isolates are resistant to most clinically used antibiotics, thus limiting the choice of antibiotics in clinical practice.

[0004] Carbapenemases are a diverse family of β-lactamases capable of hydrolyzing and inactivating a variety of antibacterial drugs, including penicillins, cephalosporins, monocyclic β-lactams, and carbapenems. These enzymes, upon binding to the drug, disrupt the amide bond of the four-membered azadicone ring, thereby preventing the drug from binding to penicillin-binding proteins in the bacterial cell wall. Using the Ambler classification system, carbapenemases can be divided into class A, class B, and class D β-lactamases.

[0005] Type A carbapenemases utilize serine residues to hydrolyze β-lactam structures and include three types containing the blaKPC, blaNMC / blaIMI, and blaSME genes. The most common type contains the blaKPC gene and is mainly found in Klebsiella pneumoniae, but it is also found in many other Enterobacteriaceae, including Citrobacter freundii, Enterobacter cloacae, Escherichia coli, Serratia marcescens, and Pseudomonas.

[0006] Class B metallo-β-lactamases (MBLs) are zinc-dependent and include three types containing the blaVIM, blaIMP, and blaNDM genes. They are all located on mobile genetic material and can spread horizontally. Metallo-β-lactamases can hydrolyze many β-lactam antibiotics, but cannot hydrolyze monocyclic β-lactam antibiotics, such as aztreonam.

[0007] Class D carbapenemases include members encoding the OXA gene and are primarily found in Acinetobacter. The blaOXA-48 type is also present in Enterobacteriaceae and is associated with nosocomial CRE (carbapenem infection). The blaOXA-48 type includes OXA-48 and its related variants OXA-181, OXA-162, and OXA-232.

[0008] Currently, detection methods for carbapenemase-producing resistant bacteria are mainly divided into two categories: phenotypic detection and molecular detection. Phenotypic detection methods are simple to operate, do not require advanced technical skills or large equipment, and are relatively inexpensive. However, phenotypic detection has a longer turnaround time and is inferior to molecular detection in terms of specificity and sensitivity. Compared with phenotypic detection, molecular detection has extremely high specificity and sensitivity, and can provide accurate results in a short time, which helps to promptly implement treatment measures. However, molecular detection is more expensive, requires various large equipment, and demands a high level of technical skill from operators. In clinical testing, medical staff need to select the appropriate method based on the specific circumstances.

[0009] Immunochromatography is a rapid and convenient in vitro diagnostic technique that requires no instruments and is unaffected by false positives from gene silencing. However, false negatives can occur if the target protein is weakly expressed or if the key amino acids of the antigen epitope recognized by the antibody are altered. Therefore, a highly sensitive, specific detection product for carbapenemases that covers multiple genotypes remains urgently needed in the market. Summary of the Invention

[0010] To address the shortcomings of the existing technologies, this invention provides the development, preparation, and application of a carbapenemase immunochromatographic kit, aiming to solve the technical problem of the lack of a carbapenemase detection product with high sensitivity, good specificity, and coverage of multiple genotypes.

[0011] The first technical solution provided by this invention is an anti-KPC carbapenemase antibody, wherein the anti-KPC carbapenemase antibody comprises a light chain variable region and a heavy chain variable region. The light chain variable region has a light chain CDR composed of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR composed of CDR-H1, CDR-H2, and CDR-H3. The amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are shown in any one of (a) to (b).

[0012] (a) SEQ ID NO: 1~3, SEQ ID NO: 5~7;

[0013] (b) SEQ ID NO:9~11, SEQ ID NO:13~15.

[0014] In some embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are shown in any one of (c) to (d):

[0015] (c) SEQ ID NO:4, SEQ ID NO:8;

[0016] (d) SEQ ID NO: 12, SEQ ID NO: 16.

[0017] The second technical solution provided by this invention is an anti-IMP carbapenemase antibody, wherein the anti-IMP carbapenemase antibody includes a light chain variable region and a heavy chain variable region. The light chain variable region has a light chain CDR composed of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR composed of CDR-H1, CDR-H2, and CDR-H3. The amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are shown in any one of (e) to (f).

[0018] (e) SEQ ID NO: 17~19, SEQ ID NO: 21~23;

[0019] (f) SEQ ID NO: 25~27, SEQ ID NO: 29~31.

[0020] In some embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are shown in any one of (g) to (h):

[0021] (g) SEQ ID NO:20, SEQ ID NO:24;

[0022] (h) SEQ ID NO:28, SEQ ID NO:32.

[0023] The third technical solution provided by this invention is an anti-NDM type carbapenemase antibody, wherein the anti-NDM type carbapenemase antibody includes a light chain variable region and a heavy chain variable region. The light chain variable region has a light chain CDR composed of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR composed of CDR-H1, CDR-H2, and CDR-H3. The amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are shown in any one of groups (i) to (j).

[0024] (i) SEQ ID NO: 33~35, SEQ ID NO: 37~39;

[0025] (j) SEQ ID NO:41~43, SEQ ID NO:45~47.

[0026] In some embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are shown in any one of groups (k) to (l):

[0027] (k) SEQ ID NO:36, SEQ ID NO:40;

[0028] (1) SEQ ID NO:44, SEQ ID NO:48.

[0029] The fourth technical solution provided by this invention is an anti-VIM type carbapenemase antibody, wherein the anti-VIM type carbapenemase antibody includes a light chain variable region and a heavy chain variable region. The light chain variable region has a light chain CDR composed of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR composed of CDR-H1, CDR-H2, and CDR-H3. The amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are shown in any group from (m) to (n).

[0030] (m) SEQ ID NO: 49~51, SEQ ID NO: 53~55;

[0031] (n) SEQ ID NO: 57~59, SEQ ID NO: 61~63.

[0032] In some embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are shown in any group (o) to (p):

[0033] (o) SEQ ID NO:52, SEQ ID NO:56;

[0034] (p) SEQ ID NO:60, SEQ ID NO:64.

[0035] The fifth technical solution provided by this invention is an anti-OXA48 carbapenemase antibody, wherein the anti-OXA48 carbapenemase antibody includes a light chain variable region and a heavy chain variable region. The light chain variable region has a light chain CDR composed of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR composed of CDR-H1, CDR-H2, and CDR-H3. The amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are shown in any one of (r) to (s):

[0036] (r) SEQ ID NO: 65~67, SEQ ID NO: 69~71;

[0037] (s) SEQ ID NO: 73~75, SEQ ID NO: 77~79.

[0038] In some embodiments, the amino acid sequences of the light chain variable region and the heavy chain variable region are shown in any group (t) to (u):

[0039] (t) SEQ ID NO: 68, SEQ ID NO: 72;

[0040] (u) SEQ ID NO:76, SEQ ID NO:80.

[0041] The sixth technical solution provided by the present invention is a gene encoding the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution, or the antibody described in the fifth technical solution.

[0042] The seventh technical solution provided by the present invention is a recombinant vector carrying the gene described in the sixth technical solution.

[0043] In some embodiments, the recombinant vector uses plasmid pCMV-C-Flag as the expression vector.

[0044] The eighth technical solution provided by the present invention is a recombinant cell expressing the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution, or the antibody described in the fifth technical solution, or containing the gene described in the sixth technical solution, or transformed with the recombinant vector described in the seventh technical solution.

[0045] In some embodiments, the recombinant cells use fungi, bacteria, animal cells, or plant cells as hosts.

[0046] In some embodiments, the fungus includes yeast or mold, and the bacteria includes Escherichia coli.

[0047] In some embodiments, the animal cells include, but are not limited to, 293 cells and sf9 cells.

[0048] The ninth technical solution provided by the present invention is a method for preparing an anti-carbapenemase antibody. The method involves culturing the recombinant cells described in the eighth technical solution to obtain a culture containing the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution, or the antibody described in the fifth technical solution.

[0049] The tenth technical solution provided by this invention is a biomarker or chemically marked product, wherein the product is an antibody marked by a marker, and the antibody originates from any of the following sources:

[0050] (1) The antibody described in the first technical solution;

[0051] (2) The antibody described in the second technical solution;

[0052] (3) The antibody described in the third technical solution;

[0053] (4) The antibody described in the fourth technical solution;

[0054] (5) The antibody described in the fifth technical solution;

[0055] (6) The culture of recombinant cells described in the eighth technical solution.

[0056] The eleventh technical solution provided by the present invention is a detection reagent product, which contains the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution, the antibody described in the fifth technical solution, or a product containing the biomarker or chemical marker described in the tenth technical solution.

[0057] In some embodiments, the product includes test strips and reagent kits.

[0058] The twelfth technical solution provided by this invention is a carbapenemase multifactorial detection reagent product, wherein the reagent product comprises at least two of the following antibodies:

[0059] (1) The antibody described in the first technical solution;

[0060] (2) The antibody described in the second technical solution;

[0061] (3) The antibody described in the third technical solution;

[0062] (4) The antibody described in the fourth technical solution;

[0063] (5) The antibody described in the fifth technical solution.

[0064] In some embodiments, the product includes test strips and reagent kits.

[0065] The thirteenth technical solution provided by this invention is a carbapenemase pentavalent detection kit. The kit includes a detection card, which comprises: a PVC base plate, a sample pad, a conjugate pad, a nitrocellulose membrane, and absorbent paper. The sample pad, conjugate pad, nitrocellulose membrane, and absorbent paper are sequentially overlapped and pasted onto the base plate. The conjugate pad is sprayed with markers for antibody binding, namely C-lines and T-lines, wherein the C-lines are fixed with mouse anti-human IgG antibodies, and the T-lines are fixed with detection antibodies. The labeled antibodies and detection antibodies include anti-KPC carbapenemase antibody pairs, anti-IMP carbapenemase antibody pairs, anti-NDM carbapenemase antibody pairs, anti-VIM carbapenemase antibody pairs, and anti-OXA48 carbapenemase antibody pairs.

[0066] The anti-KPC carbapenemase antibody pairs include KPC-1 and KPC-2;

[0067] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of KPC-1 are shown in SEQ ID NO:1 to 3, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:5 to 7, respectively.

[0068] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of KPC-2 are shown in SEQ ID NO:9-11, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:13-15, respectively.

[0069] The anti-IMP carbapenemase antibody pairs include IMP-1 and IMP-2;

[0070] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of IMP-1 are shown in SEQ ID NO:17-19, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:21-23, respectively.

[0071] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of IMP-2 are shown in SEQ ID NO:25-27, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:29-31, respectively.

[0072] The anti-NDM carbapenemase antibody pairs include NDM-1 and NDM-2;

[0073] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of NDM-1 are shown in SEQ ID NO:33-35, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:37-39, respectively.

[0074] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of NDM-2 are shown in SEQ ID NO:41-43, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:45-47, respectively.

[0075] The anti-VIM type carbapenemase antibody pair includes VIM-1 and VIM-2;

[0076] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of VIM-1 are shown in SEQ ID NO:49-51, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:53-55, respectively.

[0077] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of VIM-2 are shown in SEQ ID NO:57-59, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:61-63, respectively.

[0078] The anti-OXA48 carbapenemase antibody pairs include OXA48-1 and OXA48-2;

[0079] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of OXA48-1 are shown in SEQ ID NO:65-67, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:69-71, respectively.

[0080] The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of OXA48-2 are shown in SEQ ID NO:73-75, respectively; the amino acid sequences of CDRL1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:77-79, respectively.

[0081] The fourteenth technical solution provided by this invention is the application of the antibody described in the first technical solution, the antibody described in the second technical solution, the antibody described in the third technical solution, the antibody described in the fourth technical solution, or the antibody described in the fifth technical solution, or the gene described in the sixth technical solution, or the expression recombinant vector described in the seventh technical solution, or the recombinant cell described in the eighth technical solution, or the method described in the ninth technical solution, or the biomarker or chemically labeled product described in the tenth technical solution in the preparation of a product for detecting carbapenemase.

[0082] In some embodiments, the product includes reagents, kits, detection chips, or biosensors.

[0083] The technical effects of this invention are as follows:

[0084] This invention utilizes conserved epitope sequences obtained from the amino acid sequence comparison of five common carbapenemase variants (KPC, IMP, NDM, VIM, and OXA48) to prepare immunogens. Mice were immunized with these immunogens, and specific antibody pairs with strong affinity and the ability to bind to multiple variants were obtained through multi-platform screening. Based on this, an immunochromatographic assay kit for the five carbapenemases was developed. This kit offers advantages such as high sensitivity, good specificity, coverage of multiple drug-resistant variants, simultaneous detection of multiple targets, and rapid and convenient detection. The detection limits of this kit are: KPC carbapenemase no higher than 600 pg / mL; IMP carbapenemase no higher than 200 pg / mL; NDM carbapenemase no higher than 150 pg / mL; VIM carbapenemase no higher than 300 pg / mL; and OXA-48 carbapenemase no higher than 300 pg / mL. This invention provides significant assistance for clinical diagnosis and medication guidance. Attached Figure Description

[0085] Figure 1 The purification results of the immunogen in specific embodiment 1 of the present invention;

[0086] Figure 2 Purification results of the KPC, IMP, NDM, VIM, and OXA48 antibody pairs in Specific Example 2 of this invention;

[0087] Figure 3 The detection results of the limit of detection of the reagent kit in specific embodiment 3 of the present invention. Detailed Implementation

[0088] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0089] Raw materials used in the examples:

[0090] 1. The pET28a vector was purchased from Takara.

[0091] 2. Escherichia coli DH5α and Escherichia coli BL21(DE3) were purchased from Takara.

[0092] 3. LB liquid medium: prepared with 10 g / L peptone, 5 g / L yeast extract and 5 g / L sodium chloride, and the pH value needs to be adjusted to 7.3±0.1.

[0093] LB solid medium: prepared from 10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride, and 15 g / L agar powder, with the pH adjusted to 7.3 ± 0.1.

[0094] Serum-free DMEM medium was purchased from Gibco;

[0095] 4. The immunization process for BALB / c mice was commissioned to Jiangsu Dongkang Biotechnology Co., Ltd.

[0096] Example 1: Analysis and preparation of immunogens

[0097] (I) Sequence Comparison and Determination

[0098] Research has identified 96 KPC-type carbapenemase genotypes, with KPC-2 and KPC-3 being the most common. KPC-2 production accounts for over 70% of carbapenem-resistant Klebsiella pneumoniae. For IMP-type enzymes, the most common variant is IMP-1, while blaIMP-4 is primarily found in China. Of the 12 reported NDM subtypes, NDM-1 and NDM-5 remain the predominant genotypes globally. For VIM, 27 subtypes have been identified, with VIM-1 and VIM-2 being the predominant genotypes. For OXA-type enzymes, since their discovery, they have been widely distributed among Enterobacteriaceae in Europe, Asia, North Africa, and the Middle East, with OXA-48 being the most common among Enterobacteriaceae.

[0099] In summary, the above-mentioned common and prevalent subtypes were selected for sequence comparison to determine the immunogen preparation method. Sequence comparisons were performed separately: blaKPC-2 (Uniprot: Q93LQ9) and blaKPC-3 (Uniprot: G0ZRI3), determining that blaKPC-2 (45-165AA, 175-240AA) should be truncated; blaIMP-1 (Uniprot: A0A6F8V4V7) and blaIMP-4 (Uniprot: A0A2Z2CFN0), determining that blaIMP-4 (46-235AA) should be truncated; blaNDM-1 (Uniprot: C7C422) and blaNDM-5 (Uniprot: A0A024B4D5), determining that blaNDM-1 (29-270AA) should be truncated; blaVIM-1 (Uniprot: A0A0F7KYQ8) and blaVIM-2 (Uniprot: Q5U7L7), determining that blaVIM-1 should be truncated. 21-266AA; blaOXA48(Uniprot: Q6XEC0), determined to extract 20-265AA.

[0100] (II) Construction of expression plasmids

[0101] According to the E. coil coding principle, the above amino acid sequence was converted into a nucleotide sequence (SEQ ID NO: 81-86). Conventional double enzyme digestion and ligation techniques in the field of molecular biology were used to construct the expression plasmid into the pET28a vector. The plasmid was then transformed into competent cells to obtain positive clones. The positive clones were transformed into E. coli BL21(DE3) competent cells, cultured and induced to express, and sent to Universal Biotech for sequencing confirmation.

[0102] SEQ ID NO:81

[0103] atgggcgtgtatgcgatggataccggcagcggcgcgaccgtgagctatcgcgcggaagaacgctttccgctgtgcagcagctttaaaggctttctggcggcggcggtgctggcgcgcagccagcagcaggcgggcctgctggataccccgattcgctatggcaaaaacgcgctggtgccgtggagcccgattagcgaaaaatatctgaccaccggcatgaccgtggcggaactgagcgcggcggcggtgcagtatagcgataacgcggcggcgaacctgctgctgaaagaactgggcggcccggcgggcctgaccgcgtttatgcgcagcattggcgataccacctttcgcctggatcgctgggaa

[0104] SEQ ID NO:82

[0105] atgggsggsgatgcgcgcgataccagcagcccgcgcgcggtgaccgaaagcctgcagaaactgaccctgggcagcgcgctggcggcgccgcagcgccagcagtttgtggattggctgaaaggcaacaccaccggcaaccatcgcattcgcgcggcggtgccggcggattgggcggtgggcgataaaaccggcacctgcggcgtgtat

[0106] SEQ ID NO:83

[0107] atgtggggcgtggtgccgaaacatggcctggtggtgctggtggatgcggaagcgtatctgattgataccccgtttaccgcgaaagataccgaaaaactggtgacctggtttgtggaacgcggctataaaattaaaggcagcattagcagccattttcatagcgatagcaccggcggcattgaatggctgaacagccagagcattccgacctatgcgagcgaactgaccaacgaactgctgaaaaaagatggcaaagtgcaggcgaaaaacagctttggcggcgtgaactattggctggtgaaaaacaaaattgaagtgttttatccgggcccgggccataccccggataacctggtggtgtggctgccggaacgcaaaattctgtttggcggctgctttattaaaccgtatggcctgggcaacctgggcgatgcgaacctggaagcgtggccgaaaagcgcgaaactgctgattagcaaatatggcaaagcgaaactggtggtgccgagccatagcgaagcgggcgatgcgagcctgctgaaactgaccctggaacaggcggtgaaaggcctg

[0108] SEQ ID NO:84

[0109] atgggcgaaattcgcccgaccattggccagcagatggaaaccggcgatcagcgctttggcgatctggtgtttcgccagctggcgccgaacgtgtggcagcataccagctatctggatatgccgggctttggcgcggtggcgagcaacggcctgattgtgcgcgatggcggccgcgtgctggtggtggataccgcgtggaccgatgatcagaccgcgcagattctgaactggattaaacaggaaattaacctgccggtggcgctggcggtggtgacccatgcgcatcaggataaaatgggcggcatggatgcgctgcatgcggcgggcattgcgacctatgcgaacgcgctgagcaaccagctggcgccgcaggaaggcatggtggcggcgcagcatagcctgacctttgcggcgaacggctgggtggaaccggcgaccgcgccgaactttggcccgctgaaagtgttttatccgggcccgggccataccagcgataacattaccgtgggcattgatggcaccgatattgcgtttggcggctgcctgattaaagatagcaaagcgaaaagcctgggcaacctgggcgatgcggataccgaacattatgcggcgagcgcgcgcgcgtttggcgcggcgtttccgaaagcgagcatgattgtgatgagccatagcgcgccggatagccgcgcggcgattacccataccgcgcgcatggcggataaactgcgc

[0110] SEQ ID NO:85

[0111] atgagcccgctggcgcatagcggcgaaccgagcggcgaatatccgaccgtgaacgaaattccggtgggcgaagtgcgcctgtatcagattgcggatggcgtgtggagccatattgcgacccagagctttgatggcgcggtgtatccgagcaacggcctgattgtgcgcgatggcgatgaactgctgctgattgataccgcgtggggcgcgaaaaacaccgcggcgctgctggcggaaattgaaaaacagattggcctgccggtgacccgcgcggtgagcacccattttcatgatgatcgcgtgggcggcgtggatgtgctgcgcgcggcgggcgtggcgacctatgcgagcccgagcacccgccgcctggcggaagcggaaggcaacgaaattccgacccatagcctggaaggcctgagcagcagcggcgatgcggtgcgctttggcccggtggaactgttttatccgggcgcggcgcatagcaccgataacctggtggtgtatgtgccgagcgcgaacgtgctgtatggcggctgcgcggtgcatgaactgagcagcaccagcgcgggcaacgtggcggatgcggatctggcggaatggccgaccagcgtggaacgcattcagaaacattatccggaagcggaagtggtgattccgggccatggcctgccgggcggcctggatctgctgcagcataccgcgaacgtggtgaaagcgcataaaaaccgcagcgtggcggaa

[0112] SEQ ID NO:86

[0113] atggcggtggcgaaagaatggcaggaaaacaaaagctggaacgcgcattttaccgaacataaaagccagggcgtggtggtgctgtggaacgaaaacaaacagcagggctttaccaacaacctgaaacgcgcgaaccaggcgtttctgccggcgagcacctttaaaattccgaacagcctgattgc gctggatctgggcgtggtgaaagatgaacatcaggtgtttaaatgggatggccagacccgcgatattgcgacctggaaccgcgatcataacctgattaccgcgatgaaatatagcgtggtgccggtgtatcaggaatttgcgcgccagatggcgaagcgcgcatgagcaaaatgctgcatgcgt ttgattatggcaacgaagatattagcggcaacgtggatagcttttggctggatggcggcattcgcattagcgcgaccgaacagattagctttctgcgcaaactgtatcataacaaactgcatgtgagcgaacgcagccagcgcattgtgaaacaggcgatgctgaccgaagcgaacggcgattat attattcgcgcgaaaaccggctatagcacccgcattgaaccgaaaattggctggtgggtgggctgggtggaactggatgataacgtgtggttt tttgcgatgaacatggatatgccgaccagcgatggcctgggcctgcgccaggcgattaccaaagaagtgctgaaacaggaaaaaattattccg

[0114] (III) Preparation of Immunogens

[0115] The recombinant plasmids were transformed into BL21(DE3) strain and cultured overnight on LB agar plates. Single colonies were picked and expanded until the OD600 reached 0.6-0.8. IPTG at a final concentration of 0.8 mM was added to induce expression. After 4 hours of expression, the bacterial cells were collected by centrifugation. The bacterial cells were resuspended in a Tris buffer system and sonicated for 40 min. The supernatant after high-speed centrifugation was passed through a pre-equilibrated Ni-NTA column for binding. The target protein was purified by imidazole buffer gradient elution, collected in separate tubes, and SDS-PAGE electrophoresis was used to verify protein size and purity. The results are as follows: Figure 1 As shown, the purity of the purified recombinant protein is ≥95%.

[0116] The KPC expression protein fragments are 45-165 AA and 175-240 AA. Due to their small molecular weight, BSA was chosen as the carrier protein for the immunogen. The synthesized peptide was conjugated to BSA using the SPDP conjugation method. BSA was dissolved in PBS-EDTA solution and incubated at room temperature for 1 hour. Excess SPDP was washed away using a HiTrap desalting column. Finally, the target peptide was added to the conjugated BSA-SPDP system and incubated overnight at room temperature. The KPC immunogen was obtained by mixing BSA-KPC (45-165 AA) and BSA-KPC (175-240 AA) in equal proportions. The remaining purified antigens can be used as immunogens (including IMP immunogen, NDM immunogen, VIM immunogen, and OXA48 immunogen).

[0117] Example 2: Preparation and Identification of Monoclonal Antibodies

[0118] (I) Animal Immunity and Cell Fusion

[0119] The target protein antigen was emulsified with Freund's complete adjuvant. Five SPF-grade 8-10 week old female BALB / c mice were selected and injected subcutaneously. The first immunization was performed with Freund's complete adjuvant, 50 μg / 0.5 ml / mouse, via intraperitoneal injection. The second immunization was performed 3 weeks later with Freund's incomplete adjuvant at the same dose. The third injection was performed 10 days later. Before the fourth immunization, the changes in antibody levels in the tail vein serum were detected (ELISA method). If the titer did not reach 1:104 and OD ≥1.0, immunization was continued. If the titer was reached, the final immunization was performed, and the immunogen was injected intraperitoneally at 80 μg / mouse as a booster immunization. Serum was collected after immunization for testing.

[0120] Conventional cell fusion techniques used in mouse immunization were employed to prepare myeloma cells and immunized mouse spleen cells. The prepared myeloma cells and mouse spleen cells were mixed at a ratio of 1:5, and 20 mL of RPMI 1640 culture medium was added. The mixture was centrifuged at 1000 rpm to remove the supernatant, and preheated 50% PEG4000 fusion cells were immediately added. After incubation for 1 minute, serum-free DMEM medium was added to terminate the fusion. The mixture was incubated at 37°C for 10 minutes, then centrifuged, the supernatant was removed, and the cells were resuspended in HAT medium. The cells were then aliquoted into 96-well plates and cultured in a cell culture incubator for approximately 10 days, until the fusion cells covered 20%-50% of the bottom of the wells.

[0121] (II) Screening and Cloning of Hybridoma Positive Clones

[0122] Hybridoma-positive clones were screened using an indirect ELISA method. The immunogen described above was coated onto 96-well plates. HRP-labeled rabbit anti-mouse IgG was used as a secondary antibody. Serum collected from enucleated mice served as a positive control, and the supernatant from cultured SP2 / 0 myeloma cells served as a negative control. Antibody-positive hybridoma clones were subjected to clonal culture using limiting dilution, repeated until 100% positive well rate was achieved to ensure antibody production from a single clone. The cells were then expanded for further culture.

[0123] When cell viability is less than 50%, the culture medium is removed and collected into a centrifuge bottle. The supernatant is collected by centrifugation at 12,000 rpm for 10 min and filtered through a 0.45 μm filter membrane to remove impurities. The Protein G affinity chromatography column is equilibrated with binding buffer, and antibody purification is performed using this method. After confirmation by SDS-PAGE electrophoresis, the antibody is dialyzed into binding buffer and sent to General Biotech for sequencing.

[0124] A total of 18 secretory antibodies against KPC enzyme were obtained: MKN02, MKN26, MKN35, MKN38, MKN50, MKN52, MKN67, MKN68, MKN99, MKN102, MKN105, MKN134, MKN135, MKN156, MKN160, MKN169, MKN181, and MKN186.

[0125] Six secretory antibodies against IMP enzyme were obtained: MK22A1, MK28D5, MK35G9, MK46C4, MK56G2, and MK77H6.

[0126] Seven secretory antibodies against NDM enzyme were obtained: MKD029, MKD035, MKD077, MKD089, MKD101, MKD124, and MKD233.

[0127] Eight secretory antibodies against VIM enzyme were obtained: MKV037, MKV066, MKV098, MKV099, MKV111, MKV145, MKV147, and MKV187.

[0128] Ten secretory antibodies against the OXA48 enzyme were obtained: MKA009, MKA033, MKA052, MKA061, MKA077, MKA094, MKA118, MKA129, MKA144, and MKA193.

[0129] (III) Antibody pairing and titer testing

[0130] Antibodies were paired using the ELISA double-antibody sandwich method, and the pairing results are shown in Tables 1-5.

[0131] Table 1. Pairing Results for KPC Antibodies

[0132] 1 MKN26 MKN50 2 MKN50 MKN99 3 MKN67 MKN68 4 MKN102 MKN38 5 MKN134 MKN156 6 MKN169 MKN99 7 MKN181 MKN134

[0133] Table 2. Matching Results for IMP Antibodies

[0134] 1 MK22A1 MK35G9 2 MK35G9 MK56G2 3 MK35G9 MK77H6 4 MK46C4 MK28D5

[0135] Table 3: Pairing Results for NDM Antibodies

[0136]

[0137]

[0138] Table 4. Matching Results for VIM Type Antibodies

[0139] 1 MKV037 MKV111 2 MKV037 MKV099 3 MKV098 MKV066 4 MKV145 MKV187 5 MKV145 MKV147

[0140] Table 5 shows the pairing results for OXA48 type antibodies.

[0141] 1 MKA009 MKA052 2 MKA061 MKA033 3 MKA094 MKA144 4 MKA118 MKA077 5 MKA118 MKA193 6 MKA129 MKA077

[0142] Further screening was conducted using an immunochromatographic platform, and the final matched antibodies are shown in Table 6.

[0143] Table 6. Identification of Antibodies

[0144] 1 MKN67 (KPC-1) MKN68(KPC-2) 2 MK35G9(IMP-1) MK56G2(IMP-2) 3 MKD233(NDM-1) MKD089(NDM-2) 4 MKV037(VIM-1) MKV099(VIM-2) 5 MKA118(OXA48-1) MKA193(OXA48-2)

[0145] The titer of the antibodies in Table 6 was determined using the following method: The prepared IMP enzyme was diluted with 50 mM Na2CO3 pH 9.6 buffer to a final concentration of 1 μg / ml, added to a 96-well plate, coated overnight at 4°C, washed three times with 1×PBST, and patted dry. The plate was then blocked and incubated with PBST containing 2% BSA (purchased from Sigma) for 2 h, washed in the same manner, and the antibodies were serially diluted with 1×PBS buffer at concentrations of 1:10000, 1:20000, 1:40000, 1:80000, 1:160000, 1:320000, 1:640000, 1:1280000, and 1:2560000 to obtain antibody test samples of different concentrations. The diluted antibody test sample was added to the above-mentioned ELISA plate and incubated at 37°C for 1 hour. Then, HRP-goat anti-mouse IgM diluted 1:4000 (purchased from Sigma) was added and incubated at 37°C for 1 hour. Finally, TMB substrate was added and the reaction was carried out at room temperature in the dark for 10 minutes, and the reaction was terminated with sulfuric acid. The OD450nm value was measured by an ELISA reader, and the titers of each antibody are shown in Table 7.

[0146] Table 7. Valence Test Results

[0147] KPC-1 1:1280000 KPC-2 1:1280000 IMP-1 1:1280000 IMP-2 1:1280000 NDM-1 1:640000 NDM-2 1:640000 VIM-1 1:640000 VIM-2 1:640000 OXA48-1 1:1280000 OXA48-2 1:1280000

[0148] (iv) Preparation and purification of recombinant antibodies

[0149] The antibodies in Table 6 were sent to Sangon Biotech for sequencing to obtain the antibody variable region sequences, as shown in Table 8.

[0150] Table 8 Antibody Variable Region Sequence

[0151]

[0152]

[0153]

[0154]

[0155]

[0156] The amino acid sequences of the variable regions in Table 8 were translated into nucleotide sequences according to the Homo sapiens coding principle. Using molecular construction methods, the heavy chain variable region of the above antibody was grafted onto the nucleoside sequence of the human IgG heavy chain constant region backbone, and the light chain variable region was grafted onto the nucleotide sequence of the human IgG light chain constant region backbone. The antibody heavy chain and light chain variable regions obtained from sequencing were recombined with the constant region of mouse IgG and constructed into a modified mammalian cell expression vector pCMV-C-Flag to prepare an expression plasmid (vector purchased from Beyotime, human IgG constant region gene synthesized from Sangon Biotech). The plasmid was transfected into Expi 293F cells using PEIMax for secretion expression. The process of grafting and constructing the eukaryotic expression plasmid and the reagents or parameters used in each step are not limited; any existing technology that can achieve the above objectives is acceptable and will not be elaborated here. Antibody purification was performed according to standard protein purification procedures, and the recombinant antibody was obtained through expression. Figure 2 As shown.

[0157] (V) Verification of Recombinant Antibody Affinity

[0158] This invention utilizes The detection instrument measures the affinity of the antibodies listed in Table 6. The biosensor has the aforementioned IMP enzyme immunogen immobilized at its bottom, covered by a biofilm layer. When visible light with a certain bandwidth is incident perpendicularly on the biofilm layer, the light is reflected at the two interfaces of the biofilm layer, forming an interference wave of a specific wavelength that is detected by the spectrometer. The immobilized recombinant antigen interacts with antibodies of different concentrations in the buffer solution. As the biofilm thickness increases, the interference spectrum shifts towards increasing wavelength. This phase shift is detected and analyzed by the workstation, yielding the kinetic data of the antibodies on the sensor surface. The saved data is imported into the data analysis module of the BLI instrument, and the affinity (KD = kd / ka) is calculated by fitting a kinetic model. The results are shown in Table 9.

[0159] Table 9 Affinity Test

[0160]

[0161] Table 9 shows that the recombinant antibody still exhibits strong affinity.

[0162] Example 3: Preparation of a carbapenemase pentavalent detection kit

[0163] This invention utilizes the antibody pairs with strong affinity from Table 6 of Example 2. Based on an immunochromatographic platform, a detection kit with high sensitivity and specificity is further developed. The labeled antibodies are labeled according to the following labeling method, and the detection antibodies are streaked according to the following streaking process to prepare the kit. The specific operations are as follows:

[0164] Step 1: While stirring, add 200-800 μL of 0.05-0.2 M K₂CO₃ solution dropwise to 100 mL of colloidal gold solution. After addition, seal the container and mix slowly for 2-5 minutes. Then, add each labeled antibody listed in Table 6 dropwise. After addition, seal the container and mix slowly for 1-10 minutes. Incubate for 30-60 minutes. After incubation, add 10-100 mL of blocking buffer (1-3% BSA) dropwise, mix for 2-5 minutes, and incubate for 30-60 minutes. After incubation, seal the container and mix for another 1-10 minutes. After blocking, centrifuge at the following parameters: 3000-6000 rpm, 2-8℃, and 20-60 min. After centrifugation, discard the supernatant to obtain the gold-labeled precipitate. Preserve the precipitate in the preservation solution to obtain the gold-labeled solution.

[0165] Step 2: Label the five marker antibodies according to the above labeling process to obtain gold label solution. Mix the five markers and add 1-20 mL of preservation solution. Mix well and spray the gold label solution onto the glass cellulose membrane. Dry to make gold label pad.

[0166] Step 3: Add 1-20% sucrose solution to each of the detection antibodies in Table 6, mix well to form the detection line coating solution, then add 1-20% sucrose solution to the goat anti-mouse IgG antibody, mix well to form the control line coating solution, and apply the control line coating solution and the detection line coating solution at 0.5-2 μL / cm onto the nitrocellulose membrane, dry to obtain the coated plate;

[0167] Step 4: Attach the gold label pad, absorbent paper, and sample pad to the PVC base plate in sequence, cut them into 3cm wide test strips, and insert them into the corresponding card holders.

[0168] Example 4: Performance verification of the carbapenemase pentavalent detection kit

[0169] 1. Detection limit

[0170] Take the labeled negative samples and prepare a negative matrix. Perform multiple concentration gradient dilutions on the five carbapenemases mentioned above (KPC diluted to 1000, 800, 600, 500, 400, 300, 200 pg / mL; IMP diluted to 1000, 800, 600, 400, 200, 100, 50 pg / mL; NDM diluted to 1000, 500, 250, 200, 150, 100, 50 pg / mL; VIM...). The kit was diluted to 1000, 800, 600, 400, 300, 200, and 100 pg / mL; OXA48 was diluted to 1000, 800, 600, 400, 300, 200, and 100 pg / mL. Each concentration gradient was tested 20 times using the kit from Example 3, and the tests were conducted continuously for 3 days. The degree of color development and the positive rate of each concentration were observed. The lowest concentration with a 95% positive detection rate and consistent color development was taken as the limit of detection.

[0171] Based on the above-mentioned result determination method, the detection limits of the kit of this invention are as follows: KPC carbapenemase no higher than 600 pg / mL; IMP carbapenemase no higher than 200 pg / mL; NDM carbapenemase no higher than 150 pg / mL; VIM carbapenemase no higher than 300 pg / mL; OXA-48 carbapenemase no higher than 300 pg / mL. Figure 3 ).

[0172] 2. Cross-reaction

[0173] The kit described in Example 3 was used to detect common non-carbapenemase-producing strains, and all results were negative. This demonstrates that the listed strains do not exhibit cross-reactivity with the test strips.

[0174] Table 10 Results of cross-substance influence detection

[0175] E. coli ATCC 25922 KNIVO- Klebsiella pneumoniae ATCC 1706 KNIVO- Enterobacter cloacae ATCC 13047 KNIVO- Pseudomonas aeruginosa ATCC 9027 KNIVO- Acinetobacter baumannii ATCC 19606 KNIVO-

[0176] All of the above strains were purchased from the American Type Culture Collection (ATCC).

[0177] 3. Interference Experiment

[0178] Negative matrix and borderline positive samples were selected as base samples and a certain concentration of interfering substance was added to confirm whether a certain concentration of interfering substance would affect the test results.

[0179] Table 11 Detection Results of Interfering Substances

[0180]

[0181]

[0182] The results in the table above demonstrate that the kit of the present invention can effectively resist interference from endogenous and exogenous substances.

[0183] 4. Stability

[0184] Using positive and negative samples with three different antibody concentrations as research materials, three batches of the kit described in Example 2 were stored at 2–8℃, 20±2℃, and 30±2℃ for 27 months, respectively. Testing was conducted at 0, 4, 8, 12, 16, 20, 24, 26, and 27 months to evaluate the stability of the kit. The results are shown in Tables 12–14.

[0185] Table 12 Reagent Kit Tests (Storage at 2–8°C)

[0186]

[0187]

[0188] Table 13 Reagent Kit Tests (Storage at 20±2℃)

[0189]

[0190]

[0191] Table 14 Reagent Kit Tests (Storage at 30±2℃)

[0192]

[0193]

[0194] As can be seen from the table above, the kit was stored at 2–8℃, 20±2℃ and 30±2℃ for 27 months. Strongly positive, moderately positive, weakly positive and negative samples were tested at 0 months, 4 months, 8 months, 12 months, 16 months, 20 months, 24 months, 26 months and 27 months respectively. The test results met the requirements and the kit has excellent stability.

[0195] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. An anti-NDM type carbapenemase antibody, characterized in that, The anti-NDM carbapenemase antibody includes a light chain variable region and a heavy chain variable region. The light chain variable region has a light chain CDR composed of CDR-L1, CDR-L2, and CDR-L3, and the heavy chain variable region has a heavy chain CDR composed of CDR-H1, CDR-H2, and CDR-H3. The amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are shown in SEQ ID NO:33~35 and SEQ ID NO:37~39, respectively; or the amino acid sequences of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 are shown in SEQ ID NO:41~43 and SEQ ID NO:45~47, respectively.

2. The antibody according to claim 1, characterized in that, The amino acid sequences of the light chain variable region and the heavy chain variable region are shown in SEQ ID NO:36 and SEQ ID NO:40, respectively; or the amino acid sequences of the light chain variable region and the heavy chain variable region are shown in SEQ ID NO:44 and SEQ ID NO:48, respectively.

3. The gene encoding the antibody according to any one of claims 1 to 2.

4. A recombinant vector carrying the gene of claim 3.

5. Recombinant cells expressing the antibody of any one of claims 1 to 2, or containing the gene of claim 3, or transformed with the recombinant vector of claim 4.

6. The recombinant cell according to claim 5, characterized in that, The recombinant cells are bacteria, fungi, animal cells, or plant cells; the fungi include yeast or mold, the bacteria include Escherichia coli, and the animal cells include 293 cells and sf9 cells.

7. A method for preparing an anti-carbapenemase antibody, characterized in that, The method is to culture the recombinant cells as described in claim 5 or 6 to obtain a culture containing the antibody as described in any one of claims 1 to 2.

8. A diagnostic reagent product, characterized in that, The test reagent product contains the antibody as described in any one of claims 1 to 2, and the product includes test strips and reagent kits.

9. A carbapenemase pentavalent detection kit, characterized in that, The kit includes a test card comprising: a PVC base plate, a sample pad, a conjugate pad, a nitrocellulose membrane, and absorbent paper; the sample pad, conjugate pad, nitrocellulose membrane, and absorbent paper are sequentially overlapped and adhered to the base plate; the conjugate pad is sprayed with markers for antibody binding, namely C-lines and T-lines, wherein the C-lines are fixed with goat anti-mouse IgG antibodies, and the T-lines are fixed with detection antibodies; wherein the labeled antibodies and detection antibodies include anti-KPC carbapenemase antibody pairs, anti-IMP carbapenemase antibody pairs, anti-NDM carbapenemase antibody pairs, anti-VIM carbapenemase antibody pairs, and anti-OXA48 carbapenemase antibody pairs; The anti-KPC carbapenemase antibody pairs include KPC-1 and KPC-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of KPC-1 are shown in SEQ ID NO:1~3, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:5~7, respectively. The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of KPC-2 are shown in SEQ ID NO:9~11, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:13~15, respectively. The anti-IMP carbapenemase antibody pairs include IMP-1 and IMP-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of IMP-1 are shown in SEQ ID NO:17~19, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:21~23, respectively. The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of IMP-2 are shown in SEQ ID NO:25~27, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:29~31, respectively. The anti-NDM carbapenemase antibody pairs include NDM-1 and NDM-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of NDM-1 are shown in SEQ ID NO:33~35, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:37~39, respectively. The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of NDM-2 are shown in SEQ ID NO:41~43, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:45~47, respectively. The anti-VIM type carbapenemase antibody pair includes VIM-1 and VIM-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of VIM-1 are shown in SEQ ID NO:49~51, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:53~55, respectively. The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of VIM-2 are shown in SEQ ID NO:57~59, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:61~63, respectively. The anti-OXA48 carbapenemase antibody pairs include OXA48-1 and OXA48-2; The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of OXA48-1 are shown in SEQ ID NO:65~67, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:69~71, respectively. The amino acid sequences of CDR-H1, CDR-H2 and CDR-H3 of OXA48-2 are shown in SEQ ID NO:73~75, respectively; the amino acid sequences of CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO:77~79, respectively.

10. The use of the antibody according to any one of claims 1 to 2, or the gene according to claim 3, or the recombinant vector according to claim 4, or the recombinant cell according to claim 5 or 6, or the method according to claim 7 in the preparation of a product for detecting NDM type carbapenemase.

Citation Information

Patent Citations

  • Carbapenemase joint detection kit

    CN114755420A

  • Carbapenemase immunochromatography test paper, preparation method thereof, kit and application of carbapenemase immunochromatography test paper

    CN115963257A