A gene related to pepper cucumber mosaic virus resistance and its application

By constructing and expressing a silencing and overexpression vector of the pepper E3 ubiquitin ligase BAH1-like gene Capana00g000026 in pepper, the problem of breeding pepper varieties resistant to cucumber mosaic virus in traditional breeding was solved, and pepper resistance to the virus was significantly improved.

CN119824012BActive Publication Date: 2026-05-15INST OF ECONOMIC CROP HUBEI ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INST OF ECONOMIC CROP HUBEI ACADEMY OF AGRI SCI
Filing Date
2025-01-22
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively breed pepper varieties resistant to cucumber mosaic virus. In traditional breeding, disease-resistant genes are mostly quantitative trait loci, making it difficult to clone and analyze the function of individual genes. Furthermore, introducing multiple genes presents challenges in breeding.

Method used

Using the pepper E3 ubiquitin ligase BAH1-like gene Capana00g000026, gene silencing and overexpression vectors were constructed. Gene silencing and overexpression experiments were conducted in pepper using Agrobacterium-mediated methods to detect its resistance to cucumber mosaic virus.

Benefits of technology

It significantly improves the resistance of pepper plants to cucumber mosaic virus, reduces virus accumulation, weakens the susceptible phenotype, and enhances the plant's resistance to the virus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119824012B_ABST
    Figure CN119824012B_ABST
Patent Text Reader

Abstract

The application belongs to the field of plant genetic engineering, and discloses a pepper cucumber mosaic virus disease resistance related gene and application thereof. The application constructs overexpression plants of pepper gene Capana00g000026 and silencing plants of the pepper gene Capana00g000026, identifies characteristics of the plants after inoculation of the cucumber mosaic virus, and analyzes the role of the pepper gene Capana00g000026 in the defense of the pepper infected with the cucumber mosaic virus; the genes related to the defense are screened; it is proved that increasing the content of the gene can significantly reduce the accumulation amount of the virus in the pepper leaves, and the disease phenotype of the plant is weakened, so the gene can be applied to pepper virus resistance engineering. The gene can be applied to the pepper, and the breeding material with CMV resistance can be cultivated by transformation of the pepper material.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, and more specifically relates to the application of the pepper E3 ubiquitin ligase BAH1-like gene Capana00g000026 in improving the resistance of pepper to cucumber mosaic virus. Background Technology

[0002] Cucumber mosaic virus (CMV) is one of the top ten most serious RNA viruses affecting plants. It has a wide host range, infecting more than 1200 plant species (Mochizuki and Ohki, 2012), and is widely transmitted with a high incidence rate (Palukaitis et al., 1992). CMV is one of the most significant limiting factors in chili pepper production, and it has been found in almost all chili-growing regions worldwide. CMV infection in chili peppers leads to yellowing leaves, severe mosaic patterns, twisting and deformation (Chaim et al., 2001), stunted and wrinkled plants, and systemic necrosis. Fruit quality and yield are severely affected (Zitter and Murphy, 2009), with severe infections causing yield losses exceeding 80%. To date, there are no safe and effective control measures; breeding CMV-resistant chili pepper varieties remains one of the most economical and effective ways to prevent CMV damage.

[0003] Traditional breeding methods typically utilize dominant resistance genes (R genes) associated with CMV resistance to cultivate resistant varieties. However, most identified dominant resistance genes for CMV are quantitative trait loci (QTLs), making it difficult to clone and analyze the function of individual genes. Furthermore, introducing multiple genes presents significant challenges in breeding. Existing research has revealed that the single gene Capana00g000026 in chili peppers significantly enhances the plant's resistance to CMV, reduces virus accumulation in the plant, and weakens the susceptible phenotype. Currently, the disease resistance function of this gene has not been reported, making it a novel disease resistance gene that can be applied to crop breeding. Summary of the Invention

[0004] This invention primarily provides the application of the chili pepper E3 ubiquitin ligase BAH1-like gene Capana00g000026 in regulating chili pepper resistance to CMV virus. The chili pepper Capana00g000026 gene described in this invention exhibits three alternative splices, with the specific nucleotide sequences shown in SEQ ID NO. 05-07, and the amino acid sequences encoded by the Capana00g000026 gene shown in SEQ ID NO. 16-18. The gene of this invention can be used in chili peppers, and CMV-resistant breeding materials can be cultivated through transformation of chili pepper materials.

[0005] To achieve the above objectives, the present invention employs the following technical measures to study the function of the Capana00g000026 gene in chili peppers, particularly its role in resisting viruses (cucumber mosaic virus CMV).

[0006] First, three alternative splicing forms of the gene were cloned; simultaneously, vectors for silencing the gene and vectors for overexpressing the three alternative splicing forms of the gene were constructed.

[0007] Then, these four vectors were transformed into Agrobacterium GV3101 for subsequent gene silencing and overexpression experiments.

[0008] Furthermore, transient VIGS silencing and gene resistance identification were performed on pepper leaves mediated by the corresponding Agrobacterium, and transient overexpression and resistance identification were performed on pepper leaves mediated by the corresponding Agrobacterium.

[0009] Finally, the expression of the Capana00g000026 gene and the accumulation of cucumber mosaic virus (CMV) in peppers were detected by real-time quantitative PCR to evaluate the role of this gene in antiviral activity.

[0010] The experimental results confirmed that increasing the content of this gene can significantly reduce the accumulation of virus in pepper leaves and weaken the disease phenotype of the plant.

[0011] Compared with the prior art, the present invention has the following advantages:

[0012] This invention discloses for the first time the application of the Capana00g000026 gene in regulating chili pepper resistance to CMV virus. Using chili pepper as the receptor, gene silencing and overexpression results both demonstrated that the expression level of the Capana00g000026 gene in chili pepper is correlated with the plant's resistance to CMV virus; increasing the expression level of this gene in chili pepper plants significantly improves virus resistance. Therefore, overexpression of the Capana00g000026 gene in chili pepper can enhance plant resistance to CMV. Thus, this gene can be applied to chili pepper antiviral engineering. Attached Figure Description

[0013] Figure 1 The results of PCR detection of the full-length clones of the Capana00g000026 gene with alternative splicing in Example 1;

[0014] Figure 2 The results of PCR detection of Agrobacterium-positive clones in Example 4;

[0015] Figure 3 This is a schematic diagram illustrating the detection of the expression level of the Capana00g000026 gene in pepper leaves after silencing the gene in Example 7.

[0016] Figure 4 This is a schematic diagram illustrating the detection of CMV accumulation in pepper leaves with the silenced Capana00g000026 gene in Example 8.

[0017] Figure 5 This is a schematic diagram illustrating the detection of CMV accumulation in pepper leaves transiently transformed by the Capana00g000026 gene overexpression vector in Example 8.

[0018] Figure 6 The figure shows the disease phenotype of pepper plants after CMV inoculation following overexpression of the Capana00g000026 gene in Example 8; the data in the figure are the mean ± SD of at least 3 biological replicates, ** indicates a significant difference at the P<0.01 level, and *** indicates a significant difference at the P<0.0001 level. Detailed Implementation

[0019] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field; unless otherwise specified, the reagents or materials described are all from commercial sources.

[0020] Example 1: Full-length cloning of the pepper E3 ubiquitin ligase BAH1-like gene

[0021] Using the genomic cDNA of chili pepper (Capsicum annuum L.) as a template, the CDS region of the Capana00g000026 gene was amplified by PCR. Due to the presence of a 5' alternative splicing region, three fragments of different lengths were cloned. The forward primers for the three alternative splicing regions were F1: ATGAAGTTTGGAGAAATATTTTTGGA (as shown in SEQ ID NO. 01); F2: ATGAGTTGGTGGATAATTTTAGGA (as shown in SEQ ID NO. 02); and F3: ATGGACAACGACACGATGATCATCA (as shown in SEQ ID NO. 03). The reverse primers were the same: R1: TCATTCAGAAGCATGTCTTTCCTT (as shown in SEQ ID NO. 04). The final nucleotide sequences are shown in SEQ ID NO. 05, SEQ ID NO. 06, and SEQ ID NO. 07.

[0022] The specific steps are as follows:

[0023] (1) Total RNA was extracted from fresh or frozen chili pepper (Capsicum annuum L.) tissues, and the RNA was reverse transcribed into cDNA using reverse transcriptase as a template for PCR amplification.

[0024] (2) Based on the sequence information of the Capana00g000026 gene (NCBI gene database number XM_047399045.1 for alternative splicing X1, XM_049525128.1 for alternative splicing X2, and XM_047399047.1 for alternative splicing X3), three forward primers (F1, F2, F3) were designed to target the 5' alternative splice region, and one reverse primer (R1) was designed to amplify the 3' end of the CDS region. Since the 5' end of this gene has different transcription start sites or splicing modes, it will produce mRNA transcripts of different lengths. Therefore, different forward primers (F1, F2, F3) were used to target these different transcripts for PCR amplification, resulting in three DNA fragments of different lengths.

[0025] The primer sequences are as follows:

[0026] Forward primer F1: ATGAAGTTTGGAGAAATATTTTTGGA (SEQ ID NO.01);

[0027] Forward primer F2: ATGAGTTGGTGGATAATTTTAGGA (SEQ ID NO.02);

[0028] Forward primer F3: ATGGACAACGACACGATGATCATCA (SEQ ID NO.03);

[0029] Reverse primer R1: TCATTCAGAAGCATGTCTTTCCTT (SEQ ID NO.04).

[0030] (2) PCR amplification, PCR reaction system: total volume 50μL, PrimeSTAR Max Premix (2X) 25μL, primers F1 / F2 / F3 and R1 1μL (10mM) each, and template cDNA 1μL (100-200ng / μL), and add sterile water to make up the volume to 50μL.

[0031] Set the PCR reaction conditions as follows: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 15 s, for 35 cycles, 72℃ extension for 5 min, and storage at 4℃ for 10 min.

[0032] (3) PCR product detection: The PCR products from the previous step were subjected to agarose gel electrophoresis, such as... Figure 1 As shown, the expected DNA fragment was amplified. Based on the electrophoresis results, clear and single bands were selected for subsequent operations. Sequencing analysis yielded the full-length sequences of the three alternative splicing regions of the pepper E3 ubiquitination ligase gene, as shown in SEQ ID NO. 05, SEQ ID NO. 06, and SEQ ID NO. 07.

[0033] Example 2: Construction of gene silencing vector

[0034] The target gene is silenced using a virus-induced gene silencing system.

[0035] A fragment (approximately 300 bp) that is identical and specific to the three alternative splicing regions obtained in Example 1 was selected. Forward and reverse primers were designed to perform PCR on the three alternative splicing regions. The fragments were purified and recovered using the kit according to the instructions. The recovered fragments were then ligated into the enzyme-digested TRV2 vector via homologous recombination.

[0036] The TRV2 backbone digestion system is as follows: EcoRI: 2 μL, SmaI: 2 μL, 10*cut smart buffer: 5 μL, DNA: 25 μL, sterile water: 16 μL, total 50 μL.

[0037] The forward primer is F4: GTGAGTAAGGTTACCGAATTCGCCATGATGAATGTTATTGCT (SEQ ID NO. 08).

[0038] The reverse primer is R2: TCGGGACATGCCCGGGATGTCCACAGCCTAAAGCGTAT (SEQ ID NO.09).

[0039] To achieve homologous recombination with vector TRV2, a homologous fragment (F: 5'-GTGAGTAAGGTTACCGAATTC-3') was added to the 5' end of the forward primer F4; and a homologous fragment (R: 5'-TCGGGACATGCCCGGG-3') was added to the 5' end of the reverse primer R2.

[0040] The specific steps for recombination and transformation of the target gene and the silencing vector TRV2 are as follows:

[0041] (1) Prepare the recombination reaction system (10 μL), including 2 μL of 5×CE II Buffer; 1 μL of Exanse II; DNA fragment (the molar amount of the DNA fragment should be controlled to be 3-10 times that of the vector DNA); and ddH2O to 10 μL. Incubate at 37℃ in a metal bath for 30 min to allow the target fragment to be ligated to the TRV2 vector via homologous recombination;

[0042] (2) All the above ligation products were added to 100 μL of DH5α competent cells and placed on ice for 30 min; after heat shock at 42℃ for 45 s, the cells were placed in an ice-water bath for 2 min.

[0043] (3) Add 200 μL of liquid culture medium, incubate at 37°C with shaking at 150 rpm / min for 60 min; then incubate with kanamycin (kan) + Incubate overnight on LB solid medium (100 mg / L);

[0044] (4) Spread the transformed cells onto LB solid medium containing kanamycin and incubate overnight. Pick single colonies and transfer them to LB liquid medium (kanamycin). + The culture was carried out at 100 mg / L for about 4 hours. At the same time, PCR colony detection was performed on positive clones, and Sanger sequencing was performed to confirm that the target fragment had been successfully inserted into the TRV2 vector, thus obtaining the recombinant plasmid vector TRV2-Capana00g000026.

[0045] Example 3: Construction of gene overexpression vector

[0046] The three CDS coding regions containing the Capsicum annuum L. Capana00g000026 gene cloned in Example 1 were ligated into the overexpression vector p19. Homologous recombination was used for cloning, followed by screening and identification.

[0047] 1. Obtaining the target gene: The three alternative splices of the pepper E3 ubiquitin ligase BAH1-like gene (as shown in SEQ ID NO. 05, SEQ ID NO. 06, and SEQ ID NO. 07) obtained in Example 1 were used as the target gene. Specific primers were designed with homologous fragments at their 5' ends, identical to those at both ends of the p19 backbone vector (F: 5'-AGTCTCTCTCTACAAGAT-3'; R: 5'-TCTAGATCCGGTGGAT-3'). PCR amplification of the target gene was performed using the following primers:

[0048] The forward primer is F5: AGTCTCTCTCTACAAGATATGAAGTTTGGAGAAATATTTTTGGA (SEQ ID NO.19);

[0049] The forward primer is F6: AGTCTCTCTCTACAAGATATGAGTTGGTGGATAATTTTAGGA (SEQ ID NO.20);

[0050] The forward primer is F7: AGTCTCTCTCTACAAGATATGGACAACGACACGATGATCATCA (SEQ ID NO.21);

[0051] The reverse primer is R3: TCTAGATCGGTGGATTCATTCAGAAGCATGTCTTTCCTT (SEQ ID NO.22).

[0052] 2. Enzyme digestion: The backbone vector p19 was double-digested using xhoI and SmaI, and the digestion system was the same as in Example 2.

[0053] 3. Recovery and purification: The digested backbone vector p19 and the target gene amplified by PCR need to be recovered and purified using a kit to remove impurities and unreacted reagents.

[0054] 4. Recombination and transformation: The target gene, after being recovered and purified by the kit, is homologously recombinated with the backbone vector p19. The recombinant product is then transformed into E. coli for amplification and screening. The specific steps are the same as in Example 2.

[0055] 5. Screening and identification: The transformed E. coli need to be screened to select clones containing recombinant plasmids. The screened clones were identified and compared with Sanger sequencing to obtain three overexpression vectors: p19-X1, p19-X2, and p19-X3.

[0056] Example 4: Plasmid transformation of Agrobacterium GV3101

[0057] For plasmid extraction, *E. coli* cells containing the target plasmids (TRV2.Capana00g000026 and p19-X1, p19-X2, p19-X3) from Examples 2 and 3 were extracted according to the plasmid extraction kit instructions. Further, the accuracy of the target fragment sequence recombined into the vector was confirmed by sequencing. Subsequently, the extracted and purified recombinant plasmids were transformed into *Agrobacterium* GV3101, as follows:

[0058] (1) Add 1 μg of each of the above four purified plasmids to 100 μL of competent Agrobacterium GV3101, gently shake to mix; place on ice for 5 min, then immediately place in liquid nitrogen for 5 min; incubate in a water bath at 37℃ for 5 min; add 500 μL of YEB liquid medium, and culture on a shaker at 200 rpm / min at 28℃ for 2-4 h.

[0059] (2) Centrifuge to remove most of the supernatant, precipitate, gently pipette to mix, take 100 μL of bacterial culture, spread it on LB agar plates containing 50 mg / L kanamycin and 12.5 mg / L rifampin, and incubate at 28°C for 48 h.

[0060] (3) Once resistant colonies are visible, pick a single colony and inoculate it into 2 mL of YEB medium (containing kanamycin and rifampin), and incubate overnight at 28°C with shaking; finally, perform PCR to identify positive colonies, such as... Figure 2 As shown. Ensure that the target plasmids TRV2-Capana00g000026 and p19-X1, p19-X2, and p19-X3 are successfully transformed into Agrobacterium GV3101 to utilize the infectivity of Agrobacterium to introduce the target gene into plant cells for subsequent gene silencing and overexpression experiments.

[0061] Example 5: Agrobacterium-mediated transient silencing of VIGS in pepper leaves and identification of gene resistance

[0062] This experiment used the Tobacco Rottle Virus-Mediated Gene Silencing System (VIGS) technology to silence the target gene Capana00g000026. This technology utilizes Tobacco Rottle Virus (TRV2) as a vector, inserting the target gene fragment (i.e., the Capana00g000026 fragment from Example 1) into the TRV2 viral vector. The viral vector is then introduced into plant cells via Agrobacterium-mediated transformation, thereby achieving the silencing of the target gene. The detailed experimental procedures for this part have been completed according to Example 2.

[0063] Positive control plants were established by injecting TRV2 vectors containing a specific fragment of the PDS (phytoene desaturase) gene, i.e., injecting TRV2:PDS vectors, for visual representation. The PDS gene is an important enzyme gene in plants, involved in chlorophyll synthesis. When the PDS gene is silenced, the plant cannot synthesize chlorophyll normally, leading to leaf whitening. Therefore, by observing whether the positive control plants exhibit whitening, a preliminary assessment can be made as to whether the VIGS system has successfully silenced the target gene in peppers. Similarly, the preparation steps of TRV2-PDS can be performed as described in Example 2.

[0064] The specific implementation method is as follows:

[0065] (1) Select positive Agrobacterium single clones (pTRV1, pTRV2, pTRV2:PDS, pTRV2:Capana00g000026) into liquid LB medium containing 50 mg / mL kanamycin (Kan) and 10 mg / mL rifampin (Rif). Incubate on a constant temperature shaker at 28℃ with a rotation speed of 220 rpm / min until the bacterial culture is saturated.

[0066] In this step, the selected positive Agrobacterium single clones are Agrobacterium strains containing vectors such as pTRV1, pTRV2, pTRV2-PDS, and pTRV2:Capana00g000026, each carrying different gene fragments. These clones were obtained through the following steps: pTRV1 was modified from tobacco rotavirus genome 1 and then transformed into Agrobacterium; it is an essential component of the tobacco rotavirus-mediated gene silencing system (VIGS) and is generally stored in the laboratory long-term. pTRV2 was modified from tobacco rotavirus genome 2 and is an empty vector without additional foreign fragments; it was also transformed into Agrobacterium and stored long-term. TRV2-PDS involves inserting a PDS-specific fragment into the TRV2 vector, and after successful recombinant plasmid transformation, it was transformed into Agrobacterium. The specific steps are the same as those in Examples 2 and 4.

[0067] (2) Dilute the saturated bacterial solution and add it to a new culture medium. Add the saturated bacterial solution to a liquid LB medium (50 ml LB medium) containing 50 mg / mL Kan, 10 mg / mL Rif, 10 μM pH 5.6 morpholine ethanesulfonic acid (MES) and 40 μM acetosyringone (AS) at a ratio of 1:40. Incubate for 16 h on a constant temperature shaker at 28 °C with a rotation speed of 220 rpm / min.

[0068] (3) Collect Agrobacterium using a rotation speed of 5000 rpm / min, discard the supernatant, and resuspend the Agrobacterium in a resuspension containing 200 mM magnesium chloride (MgCl2) and 150 μM AS. Adjust each bacterial suspension to an appropriate concentration (OD). 600 =0.6), then wrapped in aluminum foil and left to stand at room temperature for 2-3 hours. Finally, suspensions of Agrobacterium strains containing the vectors pTRV1, pTRV2, pTRV2:PDS and pTRV2:Capana00g000026 were obtained for injection.

[0069] (4) Before injection, the bacterial suspensions obtained in step (3) were mixed in groups. pTRV1 was mixed with equal amounts of pTRV2, pTRV2:PDS, and pTRV2:Capana00g000026, and diluted with resuspension. The injection concentration of the two bacterial suspensions in each group was OD. 600 =0.3. During injection, the bacterial solution is injected into the leaf through a 1 mL syringe on the underside of the cotyledon or true leaf.

[0070] (5) Chili seedlings were injected at the 3-leaf stage (two cotyledons and one true leaf). The injected chili plants were placed in the dark at 16℃ for 56 hours, and then transferred to normal growth conditions (temperature 20℃, 16h / 8h light-dark cycle).

[0071] (6) After the positive control (injected with TRV2:PDS vector) showed whitening, leaves from plants injected with pTRV1 and pTRV2, and pTRV1 and pTRV2:Capana00g000026 combination systems were selected to detect the degree of gene downregulation. After confirming that the target gene was successfully downregulated, cucumber mosaic virus (CMV) was inoculated on plants that successfully silenced the Capana00g000026 gene and control plants. CMV inoculation was performed by friction inoculation: plant leaves containing the virus were taken, weighed, and ground in a mortar. Buffer solution (1.0g leaf homogenate added to 10mL of 0.03M KH2PO4 solution, pH 8.0) and an appropriate amount of carbon powder were added in a certain proportion, and the mixture was quickly ground into a homogenate to prepare the virus inoculation solution. This solution was then friction inoculated onto the true leaves of the plant.

[0072] (7) On the 4th and 7th day after inoculation with cucumber mosaic virus (CMV), the total RNA was extracted from the leaves of each plant system and the accumulation of the virus was detected by real-time PCR to identify its resistance.

[0073] Example 6: Agrobacterium-mediated transient overexpression in pepper leaves and identification of disease resistance

[0074] In this embodiment, the overexpression vector prepared in Example 3 was used to obtain an Agrobacterium suspension containing the overexpression vector in Example 4.

[0075] (1) Select positive Agrobacterium clones (p19-X1, p19-X2, p19-X3) and place them in liquid LB medium containing 50 mg / mL kanamycin (Kan) and 10 mg / mL rifampin (Rif). Incubate on a shaker at 28°C at 220 rpm / min until the culture is saturated. Simultaneously, use Agrobacterium culture expressing only GFP protein as a control (laboratory-preserved), and incubate with the culture until saturated.

[0076] (2) Add the saturated bacterial solution to liquid YEB medium containing 50 mg / mL Kan, 10 mg / mL Rif, 10 μM pH 5.6 morpholine ethanesulfonic acid (MES) and 40 μM acetosyringone (AS) at a ratio of 1:40 and shake for 16 h.

[0077] (3) Collect Agrobacterium, discard the supernatant, and resuspend the Agrobacterium in a resuspension containing 200 mM magnesium chloride (MgCl2) and 150 μM AS. Adjust each bacterial suspension to the same concentration (OD). 600 =0.8-1.0), then wrap it with aluminum foil and let it stand at room temperature for 2-3 hours before injection.

[0078] (4) Pepper seedlings are injected at the 6-leaf stage (two cotyledons and four true leaves). During injection, the bacterial solution is injected into the leaf through a 1mL syringe on the underside of the cotyledon or true leaf. After injection, the seedlings are cultured under normal conditions.

[0079] (5) One day after injection, the injected leaves showed no abnormalities. CMV was then inoculated onto the injected leaves, as described above. Similarly, on the 4th and 7th days after inoculation, samples were taken from the systemic leaves of each plant to detect the amount of virus accumulation, thereby further identifying their disease resistance.

[0080] Example 7: Real-time quantitative PCR detection of the expression of the target gene Capana00g000026 in pepper.

[0081] Once the positive control group (injected with a mixed bacterial solution of pTRV1 and pTRV2:PDS vector) developed leukoplakia symptoms, leaves from single pepper plants in the experimental group (injected with a mixed bacterial solution of pTRV1 and pTRV2:Capana00g000026 vector) inoculated with CMV, and leaves from single pepper plants in the control group (injected with a mixed bacterial solution of pTRV1 and pTRV2 vector) inoculated with CMV were selected. RNA was extracted from both groups and reverse transcription and real-time quantitative PCR were performed to detect the expression of the gene.

[0082] The chili pepper gene CaUbi3 was used as an internal reference gene. The primer sequences are as follows: CaUbi3-F: 5'-CCCTGGAATTGCTGACCGTA-3' (SEQ ID NO.10) and CaUbi3-R: 5'-TGGAAAGTGCTGAGGGATGC-3' (SEQ ID NO.11) are internal reference genes.

[0083] The forward primer F5 for the Capana00g000026 gene is 5'-CCATGATGCAGAAGTGCCAA-3' (SEQ ID NO. 12), and the reverse primer R3 is 5'-GCTCAGCACGCATCTTTGAC-3' (SEQ ID NO. 13). The primers are located at the same region in each of the three alternative splicing regions to detect the overall RNA expression level of this gene. RNA extraction from pepper leaves, reverse transcription of cDNA first strand, and quantitative real-time PCR were all performed using the kit according to the manufacturer's instructions.

[0084] The result is as follows Figure 3 As shown, the expression level of the Capana00g000026 gene was significantly reduced after silencing.

[0085] Example 8: Real-time quantitative PCR detection of CMV virus accumulation

[0086] On days 4 and 7 post-inoculation, RNA was extracted from leaves of each plant system in Example 5 and Example 6, and reverse transcription and real-time quantitative PCR were performed to detect virus accumulation. The pepper gene CaUbi3 was used as an internal reference gene. The detection primers for CMV virus were F6: 5'-TTCCTGCCTCCTCGGACTTA-3' (SEQ ID NO.14) for the forward direction and R4: 5'-CTCGAGCGCATCGTCTTTTG-3' (SEQ ID NO.15) for the reverse direction.

[0087] The results showed that, in Example 5, after treatment with silencing the Capana00g000026 gene, the accumulation of CMV in the systemic leaves of the experimental group was significantly increased compared to the control group. Figure 4 As shown.

[0088] The results also showed that, in Example 6, after overexpression of this gene (Capana00g000026 gene), the accumulation of CMV in the systemic leaves of the experimental group was significantly reduced compared to the control group (GFP). Figure 5 As shown. Similarly, in Example 6, the experimental group (leaves of plants with overexpression of the Capana00g000026 gene in pepper) showed a relatively weakened susceptibility phenotype compared to the control group, such as... Figure 6 As shown.

Claims

1. A chili pepper gene Capana00g000026 Its application in improving the resistance of chili peppers to cucumber mosaic virus is characterized by... The chili gene Capana00g000026 The nucleotide sequences are shown in SEQ ID NO.05, SEQ ID NO.06, and SEQ ID NO.07, and the protein sequences encoded by this gene are shown in SEQ ID NO.16, SEQ ID NO.17, and SEQ ID NO.

18.

2. The application according to claim 1, characterized in that, The application involves using chili gene technology. Capana00g000026 The coding region is linked into the overexpression vector p19, which drives the expression of the gene in pepper plants.