A chromatin open site marker associated with identification of high-risk populations for colorectal cancer and early screening and its application

Abstract

The present invention relates to a chromatin open site marker associated with the identification and early screening of high-risk populations for colorectal cancer and its application. The marker is rs10871066. Large-scale population data and biological functional experiments have confirmed that the rs10871066 site has functional regulatory activity, and individuals carrying the rs10871066[A] genotype are more likely to bind to the transcription factor FOXP1, while individuals carrying the rs10871066[G] genotype are more likely to bind to the transcription factor TCF7L2, thereby affecting the chromatin interaction between the region and the promoter of the target gene, promoting the expression levels of the target genes PIBF1 and KLF5, and thus promoting cancer cell proliferation, ultimately leading to an increased risk of colorectal cancer in individuals. By detecting the rs10871066 risk site in normal people, high-risk populations for colorectal cancer can be identified, assisting in the diagnosis of colorectal cancer patients.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and oncology medicine, and in particular to a chromatin open site marker associated with the identification and early screening of high-risk populations for colorectal cancer and its application. Background Art

[0002] Colorectal cancer is one of the common malignant tumors of the digestive tract, which seriously threatens human life and health. Its incidence rate ranks third among malignant tumors in my country. With the development of the country's economic level and changes in residents' lifestyles and dietary structures, the incidence and mortality rates of colorectal cancer in my country have shown an increasing trend year by year. Colorectal cancer has become a major public health problem that needs to be urgently addressed in China and even the world. At present, the most effective screening method for colorectal cancer is fecal occult blood test (FIT) combined with colonoscopy. However, this method also has problems such as low detection rate and low patient acceptance. Therefore, if early screening and early diagnosis can be carried out more accurately for high-risk individuals for colorectal cancer, it can make patients more accepting and save a lot of medical expenses for the country.

[0003] In recent years, personalized screening programs based on molecular genetics have become a key focus for screening high-risk populations for colorectal cancer. Single nucleotide polymorphisms (SNPs) are the most common genetic variations and a class of molecular markers that have been shown to be associated with tumor risk, reflecting individual differences in genetic background. To date, genome-wide association studies (GWAS) have identified over 200 genetic susceptibility SNPs for colorectal cancer. Of the susceptibility SNPs discovered by GWAS, over 90% are located in non-coding regions of the genome, which can influence colorectal cancer risk by participating in gene expression regulation. With the rapid development of GWAS and the support of high-throughput genomic detection technologies, researchers have discovered that non-coding regions contain numerous cis-regulatory elements (CREs), such as promoters, enhancers, and insulators. These CREs play a significant role in regulating gene expression, thereby influencing tumorigenesis and susceptibility. With the rise of epigenomics and three-dimensional genomics, researchers have gained a clearer understanding of the characteristics and mechanisms of action of CREs. For example, assays for transposase accessible chromatin with high-throughput sequencing (ATAC-seq) have revealed that CREs are often enriched in open chromatin regions. The exposed DNA makes them more accessible to transcription factors (TFs), thereby participating in gene expression regulation. Chromatin immunoprecipitation and high-throughput sequencing (ChIP-seq) have revealed that nucleosomes near CREs often possess specific histone modifications. These unique epigenetic marks can help predict the activity state of CREs and distinguish between different CREs. Furthermore, with the continued maturity of high-throughput chromatin conformation capture (Hi-C) technology, CREs are increasingly being identified. Researchers have found that chromatin can form a ring structure (Chromatin Looping) through three-dimensional folding, which spatially shortens the distance between enhancers and promoters, thereby activating gene transcription.

[0004] Integrating histone modification information to analyze chromatin activity states and identifying genetic susceptibility loci for colorectal cancer (CRC) allows for precise mapping of pathogenic loci and the precise elucidation of the susceptibility mechanisms underlying statistical associations. We collected tissue samples from normal, precancerous, and cancerous colorectal tissues and performed multi-omics analyses, including ATAC-seq, ChIP-seq, RNA-seq, and Hi-C. This led to the construction of a multi-stage cis-regulatory element map for CRC, identifying regulatory elements (CRE:chr13:73,990,100-73,990,450) that exhibit significant differences in CRC progression. The genetic locus rs10871066, located in this region, exhibited the strongest gene expression regulation, with individuals carrying the [G] allele having a significantly increased risk of CRC compared to individuals carrying the rs10871066 [A] allele. Mechanistically, we found that rs10871066 promotes PIBF1 and KLF5 expression in an allele-specific manner through long-range chromatin loop interactions. Furthermore, TCF7L2 specifically binds to the rs10871066[G] allele, and FOXP1 specifically binds to the rs10871066[A] allele, thereby affecting the expression levels of the target genes PIBF1 and KLF5. KLF5 is involved in multiple pathogenic pathways, including NF-κB, Wnt, and Apoptosis, while PIBF1 promotes the risk of colorectal cancer by inhibiting NK cell activity. Therefore, the rs10871066 variant, located in the non-coding region, is closely associated with the risk of colorectal cancer and is expected to be used clinically to assist in the early diagnosis and detection of colorectal cancer patients. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a chromatin open site marker and its application related to the identification and early screening of high-risk populations for colorectal cancer.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] A chromatin open site marker associated with the identification and early screening of high-risk populations for colorectal cancer, the marker being rs10871066.

[0008] The specific amplification primer sequences of the chromatin open site marker rs10871066, which is related to the identification and early screening of high-risk populations for colorectal cancer, are SEQ ID NO: 1 and SEQ ID NO: 2.

[0009] The probe sequences of the chromatin open site marker rs10871066, which is related to the identification and early screening of high-risk populations for colorectal cancer, are SEQ ID NO: 3 and SEQ ID NO: 4.

[0010] The use of the detection reagent for the chromatin open site marker rs10871066, which is associated with the identification and early screening of high-risk populations for colorectal cancer, in the preparation of a colorectal cancer auxiliary diagnosis kit.

[0011] A colorectal cancer early screening and auxiliary diagnosis kit for detecting rs10871066 in peripheral blood DNA.

[0012] The colorectal cancer early screening and auxiliary diagnosis kit comprises the specific amplification primers of the above-mentioned SNP markers and the specific probes of the SNP markers.

[0013] The beneficial effects of the present invention are: from the molecular biology and genetic diagnosis levels, a technical method for screening high-risk groups for colorectal cancer is provided. This method is based on our previous findings, which showed through the integration of multi-omics technologies, that the rs10871066 site is associated with colorectal cancer susceptibility in the Chinese population. By cleverly designing primers and probes for the rs10871066 site, it is possible to rely on fluorescent quantitative PCR to detect the rs10871066 risk site in the normal population, thereby identifying high-risk groups for colorectal cancer and assisting in early screening and diagnosis of colorectal cancer. This technical method is cleverly designed, simple and feasible, and the results are accurate and reliable. It can be promoted in hospitals at all levels, providing assistance for assessing the risk of colorectal cancer and facilitating colorectal cancer screening and early intervention in this population clinically. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Flowchart of integrated multi-omics identification of colorectal cancer susceptibility locus rs10871066;

[0015] Figure 2 AUC curve of the colorectal cancer risk prediction model based on the SNP site rs10871066;

[0016] Figure 3 Schematic diagram of the results of the rs10871066 dual-luciferase reporter gene experiment;

[0017] Figure 4 Schematic diagram of the regulation of rs10871066 genotype on the expression levels of target genes KLF5 and PIBF1;

[0018] Figure 5 Schematic diagram of the specific binding of rs10871066 genotype to transcription factors FOXP1 and TCF7L2;

[0019] Figure 6 Schematic diagram of the effect of target gene KLF5 overexpression on the proliferation ability of colorectal cancer cell lines;

[0020] Figure 7 Schematic diagram of the effect of target gene PIBF1 overexpression on the proliferation ability of colorectal cancer cell lines. DETAILED DESCRIPTION

[0021] The principles and features of the present invention are described below. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0022] The technical solution of the present invention to solve the above technical problems is as follows:

[0023] A chromatin open site marker associated with the identification and early screening of high-risk populations for colorectal cancer, the marker being rs10871066.

[0024] The specific amplification primer sequences of rs10871066 are SEQ ID NO: 1 and SEQ ID NO: 2.

[0025] The specific probe for the chromatin open site marker associated with the identification and early screening of high-risk populations for colorectal cancer, the probe sequences of rs10871066 are SEQ ID NO: 3 and SEQ ID NO: 4.

[0026] The use of the detection reagent for chromatin open site markers related to the identification and early screening of high-risk populations for colorectal cancer in the preparation of a colorectal cancer auxiliary diagnosis kit.

[0027] A kit for early screening and auxiliary diagnosis of colorectal cancer, which is used to detect rs10871066 in peripheral blood DNA.

[0028] The kit includes the specific amplification primers for the above-mentioned SNP markers and the specific probes for the above-mentioned SNP markers.

[0029] Specifically, the technical solutions to the problems of the present invention include: (1) Establishing a unified standard specimen library and database: Collecting blood samples of subjects that meet the standards using standard operating procedures (SOPs), and systematically collecting complete demographic and clinical data. (2) Genotype detection: Selecting colorectal cancer cases and healthy controls, combining ATAC-seq, ChIP-seq, RNA-seq, Hi-C and other multi-omics, more accurately find the SNP marker rs10871066 associated with the onset of colorectal cancer. (3) The screened positive association markers are verified in independent large population samples to determine the stability of their association. (4) Development of auxiliary diagnostic kits for colorectal cancer: Developing early screening and auxiliary diagnostic kits based on genetic markers with significant differences in genotype distribution frequencies between colorectal cancer cases and healthy controls.

[0030] Specifically, the experimental method of the present invention mainly includes the following contents:

[0031] First, we collected colorectal tissue samples at three stages: normal, precancerous lesions, and cancer, which were removed by colorectal cancer surgery from Zhongnan Hospital Affiliated to Wuhan University and Tongji Hospital Affiliated to Huazhong University of Science and Technology. We performed ATAC-seq, H3K27ac ChIP-seq, and RNA-seq experiments and analyses, and then mapped multi-stage cis-regulatory elements across the entire genome, and discovered regulatory elements with significant differences in the progression of colorectal cancer. Among them, we found that the regulatory element region where rs10871066 is located: chr13:73,990,100-73,990,450, changed most significantly during the multi-stage progression of colorectal cancer. We then annotated the variations in this region (MAF>0.01) and obtained the candidate variation site rs10871066. Figure 1 We speculated that rs10871066 could be the causal variant within the reported GWAS locus because it is closely related to the tag variant rs1886450 (r 2 ≥0.8) exhibiting high linkage disequilibrium, we recruited 1,524 colorectal cancer patients and 1,522 normal controls with complete medical records from Beijing, China, and performed genotyping. Patients were diagnosed by histopathology, with no age restriction; normal controls had no history of cancer and no physical signs of tumors on physical examination. Information on the subjects' gender, age, smoking, and alcohol consumption was also collected. Each subject provided informed consent to participate in this study and donated 2 ml of peripheral venous blood for the isolation and preparation of lymphocyte genomic DNA. A European colorectal cancer genotype and phenotype dataset from the GECCO project was also downloaded from the dbGaP database, comprising 17,789 colorectal cancer cases and 19,951 controls. Basic demographic characteristics of the subjects are shown in Table 1.

[0032] Table 1. Basic information of the colorectal cancer case-control group of Chinese and European populations used in this study

[0033]

[0034] We used an unconditional logistic regression model to calculate the association between the SNP locus rs10871066 and colorectal cancer susceptibility in the population samples included in the study, and adjusted for sex, age, smoking, and alcohol consumption. The case-control study results showed that in the European population sample, individuals carrying the rs10871066 risk genotype had a 5% increased risk of colorectal cancer compared with the normal population (OR = 1.05, 95% CI: 1.02-1.09, P = 6.65×10 -4Detailed results are shown in Table 2. In the Chinese population sample, individuals carrying the rs10871066[G] risk genotype had a 21% increased risk of colorectal cancer (OR = 1.21, 95% CI: 1.09-1.36, P = 6.92×10 -4 ). Detailed results are shown in Table 3.

[0035] Table 2. Results of association analysis of rs10871066 for colorectal cancer risk in case-control study samples from European population

[0036]

[0037] *Calculated using a logistic regression model, adjusted for gender and age.

[0038] Table 3. Results of association analysis of rs10871066 for colorectal cancer risk in case-control study samples from the Chinese population

[0039]

[0040] *Calculated using a logistic regression model, adjusted for sex, age, smoking, and alcohol consumption.

[0041] Previous large-scale population association analysis results showed that this site is a colorectal cancer risk site, so we used this risk SNP site to establish a colorectal cancer risk prediction model. We constructed a formula that comprehensively considers the three SNP genotypes and gender, age, smoking and alcohol consumption. Among them, for SNP genotyping, wild homozygous type = "1", heterozygous type = "2", and mutant homozygous type = "3"; for gender, male is "1" and female is "0"; for age, greater than or equal to 60 years old is "1" and less than 60 years old is "0". In the analysis, the multivariate logistic regression coefficient β was used as the weight, and the formula for the risk score based on the rs10871066 typing was as follows:

[0042] The risk score for the Chinese population = (0.1914 × gender score) + (-0.0407 × age score) + (0.8557 × smoking score) + (-0.4465 × drinking score) + (0.1895 × rs10871066 typing score).

[0043] European population risk score = (-0.1985 × sex score) + (0.4778 × age score) + (0.0563 × rs10871066 typing score)

[0044] By drawing the ROC curve, we can find that the area under the curve of the model is 0.595 for the Chinese population and 0.572 for the European population. Figure 2 shown.

[0045] To functionally analyze the association of the rs10871066 marker with colorectal cancer risk, the mechanism by which this SNP site affects the occurrence and development of colorectal cancer was explored.

[0046] First, we used reporter gene experiments to verify the functional regulatory function of the region where rs10871066 is located. DNA fragments containing different alleles of rs10871066 were constructed in the forward or reverse direction into reporter gene plasmid vectors and co-transfected with the internal control plasmid pRL-SV40 into two human colorectal cancer cell lines, SW480 and HCT116. The expression of dual luciferase genes was then detected, and the relative luciferase activity differences between different groups were compared. We found that regardless of the direction of DNA fragment insertion, the reporter gene activity of the rs10871066[G] genotype group was significantly increased compared with the rs10871066[A] genotype group. The results show that the transcriptional activation effect of the enhancer of rs10871066[G] at this site is stronger than that of rs10871066[A]. The results are as follows Figure 3 At the same time, the eQTL analysis results showed that the rs10871066 site with enhancer activity was closely related to the expression levels of target genes PIBF1 and KLF5 in CRC tissues of population samples. Figure 4 Then we used the JASPAR website prediction and EMSA experiments to verify that individuals carrying the rs10871066[A] genotype are more likely to bind to the transcription factor FOXP1, and individuals carrying the rs10871066[G] genotype are more likely to bind to the transcription factor TCF7L2. The results are as follows Figure 5 shown.

[0047] To explore the mechanism by which target genes affect the occurrence and development of colorectal cancer, we verified the biological functions of the target genes KLF5 and PIBF1 through in vitro cell experiments.

[0048] KLF5 is an important transcription factor and oncogene, and its expression activity is regulated by multiple signaling pathways, including Ras / MAPK, PKC, TGFβ, and various post-transcriptional regulatory pathways such as phosphorylation, acetylation, and ubiquitination. Through cell proliferation and clone formation experiments, the effect of target genes on the proliferation ability of colorectal cancer cells was detected. The results showed that compared with the blank control group cells, the clone formation ability of the KLF5 overexpressing cell line was significantly enhanced. The experimental results showed that KLF5 can play a certain role in promoting the proliferation of colorectal cancer cells. The results are as follows Figure 6 shown.

[0049] PIBF1 encodes a protein induced by the steroid hormone progesterone that regulates multiple aspects of the immune system, including cytokine synthesis, natural killer (NK) cell activity, and arachidonic acid metabolism, to promote normal pregnancy. In an in vitro co-culture of tumor cells and NK cells, we found that overexpression of PIBF1 reduced tumor cell mortality through cell proliferation and colony formation experiments. Figure 7 shown.

[0050] Combining these large-scale population analyses, bioinformatics analysis, and rigorous experimental design, the results showed that the rs10871066 risk locus, located within the regulatory region chr13:73,990,100-73,990,450, significantly increases the risk of colorectal cancer in individuals carrying the [G] allele compared to individuals carrying rs10871066[A]. This mechanism of action is thought to be through influencing the specific binding of the transcription factor TCF7L2 to the rs10871066[G] allele and FOXP1 to the rs10871066[A] allele, thereby affecting the expression levels of the target genes PIBF1 and KLF5, thereby promoting colorectal cancer risk. Therefore, the rs10871066 risk locus, located in a noncoding region, is closely associated with colorectal cancer risk and has the potential for clinical application, assisting in the early diagnosis of colorectal cancer and identifying individuals at high risk.

[0051] Experimental methods:

[0052] 1. Peripheral Blood DNA Extraction:

[0053] We used the conventional phenol-chloroform method to extract DNA. The specific steps are as follows:

[0054] 1) Take approximately 3 ml of anticoagulated blood and centrifuge at 5,000 × g for 15 minutes at room temperature. Discard the upper layer, leaving approximately 0.3 ml of blood cells. Add 0.5 ml of freshly prepared RNase extraction buffer with a final concentration of 20 μg / ml, mix well, and incubate at 37°C for 1 hour.

[0055] 2) Add proteinase K to a final concentration of 100 μg / ml, mix well, and incubate at 37°C overnight.

[0056] 3) Add 0.7 ml of phenol (pH = 7.0) equilibrated with Tris buffer to each tube, mix thoroughly, and centrifuge at 8,000 × g for 15 min at room temperature.

[0057] 4) Transfer the supernatant to another 1.5 ml centrifuge tube, add an equal volume of 0.7 ml of phenol-chloroform (1:1), mix thoroughly for 15 minutes, and centrifuge at 8,000 × g for 15 minutes at room temperature.

[0058] 5) Transfer the supernatant to another clean 1.5 ml centrifuge tube, add 10% volume of 10 M ammonium acetate solution, add 2 volumes of pre-cooled anhydrous ethanol, and let it stand at –20°C for 2 hours to precipitate the DNA.

[0059] 6) The precipitated DNA was washed with 75% ethanol, centrifuged at 12,000 × g for 15 min, and the supernatant was discarded; then washed again with 75% ethanol, centrifuged at 12,000 × g for 15 min, and the supernatant was discarded.

[0060] 7) Place the tube upside down on absorbent paper. After the ethanol has evaporated, add an appropriate amount of TE buffer to each tube. Store at 4°C for one week and then store at –20°C until ready for use.

[0061] 2. Genotyping

[0062] The typing platform used was TaqMan genotyping technology (ABI 7900HT Real Time PCR system, Applied Biosystems). The 5 μl PCR reaction system is shown in Table 4:

[0063] Table 4. TaqMan genotyping system preparation

[0064]

[0065] The reaction conditions were as follows: pre-denaturation at 95°C for 10 min, followed by 45 cycles of 95°C for 15 sec and 60°C for 1 min, and cooling to 4°C.

[0066] The primers and probes used in the reaction are as follows:

[0067] rs10871066 primers:

[0068] Forward primer: AGCCCTTAGAGAGCATGCAAGA (SEQ ID NO: 1)

[0069] Reverse primer: AGAATGGAGGCAGCAAGGAAG (SEQ ID NO: 2)

[0070] rs10871066 probe:

[0071] Forward probe: FAM-CATTAGCTACTCCTTCTC-MGB (SEQ ID NO: 3)

[0072] Reverse probe: VIC-CATTAGCTACTCTTTCTC-MGB (SEQ ID NO: 4)

[0073] 3. Cell Proliferation Assay

[0074] 1) Cell counting

[0075] Before conducting CCK-8 proliferation and clone formation experiments, cell counting is required to ensure that the appropriate number of cells are seeded in the wells of different groups. This experiment uses a blood cell counting chamber for cell counting. The counting chamber consists of two counting pools of the same size, each of which consists of nine 1mm×1mm squares, each of which can accommodate 0.1mm 3 Liquid volume. The specific counting steps are as follows:

[0076] ① Digest the cell wells that have been cultured for a period of time to obtain a cell suspension and mix as much as possible to break up the cells.

[0077] ②Disinfect the counting chamber and cover it with a coverslip.

[0078] ③ Pipette 10mL of cell suspension and slowly drip it into the counting chamber along the edge of the glass slide, ensuring that no bubbles are generated between the coverslip and the counting chamber.

[0079] ④ Leave the plate for 1 minute, observe the counting plate under a microscope, and count the four corner squares according to the following principles: a. For cells pressing against the edge of the square, only count the cells on the top and left sides; b. If the cells are in clumps, count them as one cell.

[0080] ⑤Cell suspension concentration = total number of cells in the square / 4 × 10 4 pieces / mL.

[0081] 2) CCK-8 cell proliferation assay

[0082] In this study, CCK-8 kit (Dojindo, Japan) was used to detect the proliferation ability of colorectal cancer cells.

[0083] ①Pipette 100 mL of cell suspension and dilute to about 2,000 cells according to the counting concentration, and inoculate into a 96-well plate.

[0084] ② Perform cell viability assays at 24, 48, 72, and 96 hours. Add 10 mL of CCK-8 reagent to each well, gently shake the wells up and down to mix thoroughly, and return the cells to the incubator for another 1.5 hours.

[0085] ③ Use a microplate reader to measure absorbance with the wavelength set at 450 nm. Draw cell proliferation curves of different experimental groups based on the absorbance values ​​at four time points to compare their differences.

[0086] 3) Clone formation assay

[0087] ① 36 hours after transfection, count the cells and dilute to an appropriate concentration. Add 2 mL of cell suspension to each well of a 6-well plate to a cell count of approximately 1,000 cells. Continue culturing for approximately 2 weeks.

[0088] ② During this period, observe cell morphology and replace fresh culture medium every 2-3 days. If cell colonies are observed under a microscope, fixation and staining can be performed.

[0089] ③ Remove the 6-well plate from the incubator, aspirate the waste liquid, and slowly add PBS to wash twice. After aspirating the PBS in each well, add 2 mL of methanol solution and let it stand at room temperature for 30 minutes.

[0090] ④ After absorbing the methanol, add 0.25% crystal violet solution and place in the dark for 30 minutes for staining.

[0091] ⑤ After staining is completed, remove the waste liquid from the wells and wash the well plate with double distilled water until the field of view is clear, then take pictures and save them.

[0092] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of a detection reagent for the chromatin open site marker rs10871066, which is associated with the identification and early screening of high-risk populations for colorectal cancer, in the preparation of an auxiliary diagnostic kit for colorectal cancer. The marker is located at the rs10871066 risk site, so that individuals carrying the G allele variant significantly increase the risk of colorectal cancer compared to individuals carrying the A allele.

Images