Application of a SNP molecular marker combination in assisted breeding for body length

Through GWAS screening of SNP molecular markers related to body plagiarism length, PCR and sequencing were used to determine the genotype, and individuals with stagnant length dominant genotypes were selected, which solved the problem of slow progress in body plagiarism length breeding and achieved improvement in breeding efficiency.

CN119842928BActive Publication Date: 2025-08-08JIANGSU INST OF POULTRY SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510234659.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-28
Publication Date
2025-08-08
Estimated Expiration
2045-02-28

AI Technical Summary

Technical Problem

During the process of plagiarism-length breeding, generational genetic progress is slow, and it is difficult for the existing technology to effectively use molecular markers to accelerate breeding progress.

Method used

GWAS technology was used to screen out 10 SNP molecular markers that were significantly related to body oblique length, and genotypes were determined by PCR and sequencing methods, and dominant genotypes were selected, disadvantaged genotypes were eliminated, and molecular marker assisted breeding was used to combine dominant genotypes from SNP1~SNP10 loci.

Benefits of technology

The progress of breeding for generations of body tilt length has been accelerated, breeding efficiency has been improved, and breeding operations have been simplified.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842928B_ABST
    Figure CN119842928B_ABST
Patent Text Reader

Abstract

The present invention discloses an application of a SNP molecular marker combination in assisted breeding for body oblique length. The SNP molecular marker combination includes a total of 10 SNP sites, SNP1 to SNP10. In the molecular marker-assisted breeding for body oblique length, the method of assisting in improving the breeding for body oblique length by retaining individuals with an AA dominant genotype at the SNP1 site, an AA and GA dominant genotype at the SNP2 site, a GG dominant genotype at the SNP3 site, an AA and GA dominant genotype at the SNP4 site, individuals with a CCCC dominant genotype generated after linkage between SNP5 and SNP6 sites, a CC dominant genotype at the SNP7 site, a CC dominant genotype at the SNP8 site, an AA dominant genotype at the SNP9 site, and a CC dominant genotype at the SNP10 site, and eliminating individuals with inferior genotypes at the SNP1 to SNP10 sites can be used to accelerate the progress of intergenerational breeding for body oblique length.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and in particular to an application of a SNP molecular marker combination in body length-assisted breeding. Background Art

[0002] Poultry body size is an important phenotypic trait for breed selection. It is significantly correlated with meat-producing performance indicators such as body weight, carcass weight, and eviscerated weight. It is a commonly used indicator for evaluating poultry weight, conformation, and slaughter performance, and can, to a certain extent, reflect the growth and development of poultry. As an important body size trait, body slant length is directly or indirectly linked to numerous economic traits such as body weight, conformation, and slaughter performance. It is also a candidate trait for early selection of growth traits in chickens. Body slant length development is a quantitative trait controlled by multiple genes.

[0003] Currently, direct measurement or visual observation of body skew length is often used in breeding for skew length, resulting in slow genetic progress from generation to generation. Therefore, identifying molecular markers significantly associated with body skew length is crucial for accelerating the progress of skew length breeding. Summary of the Invention

[0004] To address the problem of slow progress in generational breeding for body skew length, the present invention provides an application of a SNP molecular marker combination in assisted breeding for body skew length. By using 10 SNP molecular markers significantly correlated with body skew length, the breeding for body skew length is assisted to improve the progress of generational breeding for body skew length.

[0005] In order to achieve the above object, the present invention provides an application of a SNP molecular marker combination in assisted breeding for body length, wherein the SNP molecular marker combination corresponds to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI as follows:

[0006]

[0007] The screening method of the SNP molecular marker is as follows:

[0008] Using the chicken genome bGalGal.mat.broiler.GRCg7b (GCF_016699485.2) as a reference, GWAS and genome-wide association analysis identified 10 SNPs significantly associated with body skew length. Univariate analysis of variance within a general linear model using SPSS 16.0 software was used to analyze and validate the association between polymorphic loci genotypes and body skew length, identifying dominant genotypes at the 10 SNPs.

[0009] GWAS is a powerful tool for analyzing the genetic structure of quantitative traits in livestock and poultry. The GWAS method is used to study the association between SNP sites and phenotypic values, which can identify molecular markers that affect economic traits and is particularly suitable for complex quantitative traits. Based on this, the present invention screened body oblique length molecular markers through GWAS and obtained 10 SNP molecular markers that were significantly correlated with body oblique length. Compared with candidate gene and QTL linkage analysis, GWAS has a high marker density, can analyze rare and low-frequency variations, can analyze the genetic structure of complex traits, and can also identify new variations, with more reliable results.

[0010] The nucleotide sequences of the primers for the above-mentioned SNP molecular markers are as follows:

[0011]

[0012] Specifically, the breeding method for increasing body slant length comprises the following steps:

[0013] (1) Determining the genotype of the chicken to be bred, wherein the genotype is the genotype of the above-mentioned SNP molecular marker combination;

[0014] (2) Select individuals with the AA dominant genotype at SNP1, the AA and GA dominant genotypes at SNP2, the GG dominant genotype at SNP3, the AA and GA dominant genotypes at SNP4, the CCCC dominant genotype resulting from the linkage of SNP5 and SNP6, the CC dominant genotype at SNP7, the CC dominant genotype at SNP8, the AA dominant genotype at SNP9, and the CC dominant genotype at SNP10.

[0015] Specifically, in step (1), the method for determining the genotype of the chicken to be bred is:

[0016] (1.1) Extracting total genomic DNA from the chicken to be tested; preferably, the genomic DNA from the chicken to be tested is obtained by collecting blood from the wing vein of the chicken to be tested;

[0017] (1.2) Based on the SNP molecular marker combination, the target sequence is amplified by PCR using the corresponding primer pair, the sequence of the primer pair is:

[0018] SNP1F: 5' AGGGAGTTCTGGATTCTTGCT3'

[0019] SNP1R: 5' CAACACCCAAAGATTGAGACC3'

[0020] SNP2F: 5'CATTCCCCCTTGTCCTATCA3'

[0021] SNP2R: 5'TTCTGTGGTGGAATTGCTCA3'

[0022] SNP3F: 5' GATGCTGGGGATGCTACTGT3'

[0023] SNP3R: 5' CATCCCACCATGTTTCTGTG3'

[0024] SNP4F: 5' GCCTGTTGCTCTCCATTGAT3'

[0025] SNP4R: 5'AGTGGCACACAGCAGCATAC3'

[0026] SNP5F: 5' TGAGGCAAGATCAAGTGCAG3'

[0027] SNP5R: 5'TCATCCAGTCCAACCATTCA3'

[0028] SNP6F: 5' AAATGGGCCAGTGTTTTCAG3'

[0029] SNP6R: 5'GAAGGCAAGTCTGAGCAAGG3'

[0030] SNP7F: 5' TTCTGTAAGCCTGCATACTG3'

[0031] SNP7R: 5'CGGATGCTGCACTGTAGAAA3'

[0032] SNP8F: 5' AGGACGGTTGGAATCTGATG3'

[0033] SNP8R: 5'GCATGGAAGTTTGGTTGACTG3'

[0034] SNP9F: 5' TGCAGAAGGATGCAGAGAGA3'

[0035] SNP9R: 5'GGAAGATTAGTCTTGGGCAAA3'

[0036] SNP10F: 5'TGGGGGAGATGAAAACAG3'

[0037] SNP10R: 5'TGATATTGGTGGCAGGTGAA3';

[0038] (1.3) After sequencing the PCR amplification product, determine the genotype.

[0039] The PCR product was sent to a biotechnology company for sequencing. The resulting sequence was compared with the chicken reference genome to identify the polymorphic site. The nucleotide sequence of the PCR product at the SNP site is shown below:

[0040] SNP1—G / A mutation at 59bp, PCR product length 220bp

[0041] AGGGAGTTCTGGATTCTTGCTAGAAATCATTATTCTCTTTTGAAACTTCTACATCTATK(G / A)TCTCCTAAGAAGTGTATGGAATGTTTTGTTTAAGAAATGTGCCACCTGTTGTGATCAGACATGCTGCCTGAAAAATGGAAATCGATTGATAAATTCAATATATCTAAATTCCTTCTTCCTTTGACTTTAAAATAAAATTAGGTCTCAATCTTTGGGTGTTG.

[0042] SNP2—A / G mutation at 161 bp, PCR product length 210 bp

[0043] CATTCCCCCTTGTCCTATCACTATCCACCCTTGTAAACAGACATTCCCTCTCCTGTTTATATGCTCCCTTCAAGTATTGGAAGGCCACAATAAGGTCTCCCCGGAGCCTTCTTTTCCAAGCTAAAAGACGAATCATACATCTTTTAAAAAAAGAGAACK(A / G)CAAACATCATGAGAAGGTGACCAATTTGGTGAGCAATTCCACCACAGAA.

[0044] SNP3—G / A mutation at 114 bp, PCR product length is 184 bp

[0045] GATGCTGGGGATGCTACTGTTCTAGGGGATCCTAGATCCTCTATAAAGGCGGTGAGACGGAAAGCCCAGCTGAAGTGCCTTTTATACCGGTGCACACAGCCTGAGTAATAAACAK(G / A)GACAAGTTGGAAACTGTGATGCACTTGGAAAGTTATGACCTTATTGCTATCACAGAAACATGGTGGGATG.

[0046] SNP 4-34bp G / A mutation, PCR product length 240 bp

[0047] GCCTGTTGCTCTCCATTGATTGCAGAAAGCACTK(G / A)TGTGAAACTACCTGAATTGTACTGATGGCAAAGAGAACTCAGCGTGGTTTTAACCCATATCTACCCTGACCATGCTTTAACCCAGACAATTCATGAGCACAGCATTAATTACAGGCCAAAGAGCAGTGCCAGCAGGCAGACAATCTGGCCGTGTGCTTTCATGGATAAGACTATGTTATAATATGTGTATGCTGCTGTGTGCCACT。

[0048] SNP5 - T / C mutation at 74 bp, PCR product length is 230 bp

[0049] TGAGGCAAGATCAAGTGCAGCATAAAAACTAGTCTGAAAGCTCTCAACCTCCAGTTGGATGTTGGGAAAAAATK(T / C)CTTCTCTGAAAGAGTGGTCACACGCTGGAATGGGCTTCCCAGGGAGGTGGTGGGGTCACCATCTCTGGAGGTTTTCAAGAAATGTGTAAATGTGGTAGTAAGGGACATGGTTTAGCAGGGAAATATTGGTGGTAGGTGAATGGTTGGACTGGATGA。

[0050] SNP6 - G / C mutation at 110 bp, PCR product length is 192 bp

[0051] AAATGGGCCAGTGTTTTCAGCTTATTTTGAGTTTCCCGTATTGGATTACCAGTTGCTGTTGGTTACTTACTTTGAAGAGGTCTTTCTTGCTGAAATTGCCCATGAAACAK(G / C)CTAAGTCTCTGATTTTGTGAATTATATCTTAGTGCAACCTTTCTCGATGATTGAGTTGCTGGCCTTGCTCAGACTTGCCTTC。

[0052] SNP7 - T / C mutation at 92 bp, PCR product length is 238 bp

[0053] TTCTGTAAGCCTGCATACTGTTTATTCCTTACAGTGTAAAAAAAACCTTTTCTTTCCGACATTGCAGTTTCAGAGCTATTTCGGTCTTTCAK(T / C)CCTCATCCCCTGTGAGAAAGAAAGGTGGGAACAGAAGAAAACTTTTTTCCCTCTTCCGTACTTTAGAGAATTCTCCTGCTGAAGGGTTCTTCCTTTTTCTTACCAGCTCCATAGGAATCTGGCTAATTTCTACAGTGCAGCATCCG。

[0054] SNP8 - C / T mutation at 82 bp, PCR product length is 223 bp

[0055] AGGACGGTTGGAATCTGATGGTCCTTGAGGTTCCTTCTAATCCAAGTCGTTCTATGACTCTCCATTATAAGAATTTTAGCCK(C / T)ATCTCTTTGTTTCATGTCCTGTGTATATTCTAGTATTACAGGCTTTTTTGTGTTCTTTTTTTTCCCCCCTTACTATTTACCTTCTCATGTTTTACTCCATAGATGCTCTCATCTTAATTACAGTCAACCAAACTTCCATGC。

[0056] SNP9 - A / G mutation at 77 bp, PCR product length is 246 bp

[0057] TGCAGAAGGATGCAGAGAGAAATAAAAGCAGGAAGAATGTTTGAGGTCAAAAACTTGAAAAAATTCAGCATTGTATK(A / G)TATGTCTTTAGATATTTATTCAAATTATGTAAGGGAAAAAATTGGACAAAACCACTCAGTACATAAGATCTACCACCTGATACTCTTTTCATCATGATTTATACAGATATACACCTAAAACTTTCTCTTCTCCTATAAAGATCTACATTTTGCCCAAGACTAATCTTCC。

[0058] SNP10 - C / T mutation at 51 bp, PCR product length is 229 bp

[0059] TGGGGGAGATGAAAACAGCTCCTCTATTTAGGACTTTTATCAGGCCTGK(C / T)CCAGGAATCTCAACAGGAGCAGCTATAGAGGCATGTGGTGAGCACTACAGAAACTACAGATACTGAAAACAGGAAAAGATGAGACTTCTAACACAGAGACATAGAACCACAAATCTGTTAAGGATGGAAAAGACTTAGACAATCATCTAGTCCAACCGTTCACCTGCCACCAATATCA.

[0060] Note: The K marked in the above sequence is the mutation site, and the mutated bases in brackets are allele mutations.

[0061] The specific method for determining individuals with dominant genotypes is as follows:

[0062] First, the correlation between single SNP markers and body skew length was analyzed. The body skew length of different genotypes at the 10 SNPs loci was significantly different. SNP1 (rs312577341) had three genotypes: AA, GA, and GG. Among them, the body skew length of individuals with the AA genotype was significantly greater than that of the GA and GG genotypes (P < 0.05). SNP2 (rs313388213) had three genotypes: AA, GA, and GG. Among them, the body skew length of individuals with the AA and GA genotypes was significantly greater than that of the GG genotype (P < 0.05). ; SNP3 (rs730967108) has three genotypes: AA, AG, and GG. The body oblique length of individuals with the GG genotype was significantly longer than that of individuals with the AA and AG genotypes (P < 0.05). SNP4 (rs315520013) has three genotypes: AA, GA, and GG. The body oblique length of individuals with the AA and GA genotypes was significantly longer than that of individuals with the GG genotype (P < 0.05). SNP5 (rs317946632) has three genotypes: CC, TC, and TT. The body oblique length of individuals with the CC genotype was significantly longer than that of individuals with the AA and GA genotypes (P < 0.05). The body oblique length of the body was significantly longer than that of the TC and TT genotypes (P < 0.05); SNP6 (rs315619998) had three genotypes: CC, GC, and GG, among which the body oblique length of the CC genotype individuals was significantly longer than that of the GC and GG genotypes (P < 0.05); SNP7 (rs317342517) had three genotypes: CC, TC, and TT, among which the body oblique length of the CC genotype individuals was significantly longer than that of the TC and TT genotypes (P < 0.05); SNP8 (rs313349990) There are two genotypes, CC and CT, among which the body skew length of individuals with CC genotype is significantly longer than that of individuals with CT genotype (P < 0.05); SNP9 (rs731600098) has three genotypes, AA, AG, and GG, among which the body skew length of individuals with AA genotype is significantly longer than that of AG and GG genotypes (P < 0.05); SNP10 (rs13792170) has three genotypes, CC, CT, and TT, among which the body skew length of individuals with CC genotype is significantly longer than that of individuals with CT and TT genotypes (P < 0.05).

[0063] Haploview software was used to analyze the linkage disequilibrium (LD) of the 10 SNPs. The results of the LD analysis showed that SNP5 and SNP6 were in a strong linkage state (R 2=94), linkage between SNP5 and SNP6 resulted in three haplotypes: H1 (TG), H2 (CC), and H3 (CG), with haplotype frequencies of 0.795, 0.177, and 0.019, respectively. The other eight SNPs were not strongly linked, so only the combined genotype of SNP5 and SNP6 was analyzed for association with body skew length, and no analysis of the combined genotypes of the other eight molecular markers was performed. Combining the three haplotypes generated by the linkage between SNP5 and SNP6 yielded five genotypes. Association analysis revealed that the H2H2 haplotype (CCCC genotype) was significantly associated with higher body skew length than the other haplotype combinations.

[0064] The AA genotype at SNP1, the AA and GA genotypes at SNP2, the GG genotype at SNP3, the AA and GA genotypes at SNP4, the CCCC genotype resulting from the linkage of SNP5 and SNP6, the CC genotype at SNP7, the CC genotype at SNP8, the AA genotype at SNP9 and the CC genotype at SNP10 are the dominant genotypes for body oblique length and can serve as important molecular markers for molecular-assisted breeding of body oblique length.

[0065] Through the above technical solution, the present invention achieves the following beneficial effects:

[0066] In molecular marker-assisted breeding of body skew length, the method of retaining individuals with superior genotypes at 10 SNP sites (SNP1~SNP10) and eliminating individuals with inferior genotypes at SNP1~SNP10 sites can assist in improving the selection of body skew length and accelerate the progress of generational selection of body skew length. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 Manhattan plots are labeled for body length-related molecules;

[0068] Figure 2 The QQ plot is a molecular marker related to body length;

[0069] Figure 3 This is a linkage disequilibrium analysis diagram of 10 SNP molecular markers;

[0070] Figure 4 Haplotype frequencies of three haplotypes were generated for the linkage of SNP5 and SNP6. DETAILED DESCRIPTION

[0071] The following is a detailed description of the specific embodiments of the present invention in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention.

[0072] Example 1 Screening for Molecular Markers Significantly Associated with Body Plagiograndiosis

[0073] 1. Experimental Materials

[0074] The test subjects were the terminal paternal line A of the Lihua Yellow-footed Chicken. The main selected traits of this line are body weight, comb development, feed conversion rate, and slaughter rate. It has undergone six generations of closed selection. The experimental chickens were raised at Jiangsu Lihua Breeding Co., Ltd. in Changzhou, Jiangsu Province. All experimental chickens were hatched from the same batch and raised in the same chicken house. The experimental chickens were raised in a two-stage manner. They were raised in cages from 1 to 4 weeks of age and then transferred to individual cages after 5 weeks of age. They were fed the company's standard breeder feed and had free access to water and food during the experimental period. Immunization followed the standard procedures established by the company.

[0075] 2. Measurement of body oblique length

[0076] A total of 400 roosters from the specialized strain A of Lihua yellow-footed chicken were randomly selected and weighed after fasting for 12 hours. The leg numbers were recorded and the body oblique length of the 60-day-old roosters was measured. The specific measurement method was as follows: the distance from the shoulder joint to the ischial tuberosity on the same side was measured with a tape measure. All body oblique length measurements were made by the same person and the measured parts were basically the same.

[0077] 3. Mining of molecular markers of body plagioclase

[0078] At 60 days of age, 1.5 mL of blood was collected from the subwing vein of all groups whose combs were tested. The blood was anticoagulated with EDTA. After blood collection, the anticoagulated tube was gently shaken up and down to ensure thorough contact and mixing of the EDTA in the tube. The tube was then stored in an insulated container with ice packs. After blood collection, the tube was quickly transported to the laboratory and stored at -20°C until further use. DNA was extracted using the TIANGEN Blood Genomic DNA Extraction Kit (Spin Column Type) (YDP348). DNA integrity and purity were assessed by gel migration (1% agarose gel electrophoresis). DNA concentration was determined using a Qubit 4 Fluorometer (Thermo Fisher, Shanghai) to ensure that the extracted DNA sample concentration was greater than 15 ng / μL.

[0079] Whole-genome resequencing: DNA samples that pass quality inspection are uniformly delivered to Beijing Bozhi Geya Biotechnology Co., Ltd. for whole-genome resequencing, including genomic library preparation and sequencing on the MGISEQ-2000 platform.

[0080] Quality control primarily involved filtering raw genomic reads from paired-end sequencing on the MGISEQ-2000 platform using the fastp (v.0.20.0) preprocessor (set to default parameters) to remove low-quality reads, adapters, and reads containing poly-N. Finally, quality-controlled reads were aligned to the NCBI-published chicken reference genome, version bGalGal1.mat.broiler.GRCg7b, using BWA (v0.7.17) software. Duplicate reads were removed using Picard software. High-quality SNPs were analyzed using GATK 4.0 software.

[0081] Genome-wide association analysis: Principal component analysis (PCA) was performed on quality-controlled SNP loci using PLINK (v1.90p) software to prevent false-positive results due to population stratification. Association analysis of body weight traits was performed using linear mixed models (LMM) using GEMMA (v0.98.5) software.

[0082] y=Wα+xβ+u+

[0083] Where y is the phenotype vector; W is the fixed effect matrix (the first three principal components including PCA); α is the fixed effect vector; x is the genotype vector, β is the SNP effect vector; u is the random effect vector; Represents the residual vector. MVNn is the n-dimensional multivariate normal distribution, λ is the genetic variance and the residual variance (random effect vector u and residual vector ), τ-1 is the residual variance, K is the kinship matrix calculated based on SNPs using GEMMA, and In is the identity matrix.

[0084] The (-indep-pairwise 50 10 0.2) parameter in PLINK software was used to infer the number of valid SNPs for independent testing, and the final inferred number of valid independent testing SNPs was 432,5210. After multiple testing, the Bonferroni correction method was used to set the significance threshold. The genome-wide significance level in this study was 1.16×10 -7 (0.05 / number of effective independent test SNPs 432529), then the negative logarithm of log10 was taken for the p-value, the genome-wide significance level threshold; the genome-wide potential significance level p was 2.31×10 -6(1 / 432,529), taking the negative logarithm of log10, the potential significance threshold was 5.63. GWAS results were visualized using the Cmplot package in R. Genes adjacent to the significant loci within 100 kb upstream and downstream were annotated using Bedtools (v2.30.0) software.

[0085] After quality inspection, genome-wide association analysis was performed on the plagioclase phenotype values of 366 chickens. The results were as follows: Figure 1 、 Figure 2 As shown in the Manhattan plot, 10 SNPs with significant genomic associations (threshold value above 5.63) are present on chicken chromosomes 1, 4, 7, and 11, all of which are annotated as potentially associated SNPs (threshold value above 5.63). The QQ plot further validates the reliability of the GWAS results. The significantly associated molecular markers for body length are summarized in Table 1:

[0086] Table 1 Molecular markers significantly associated with body length

[0087]

[0088] The physical position of the marker chromosome is referenced to the chicken whole genome (bGalGal1.mat broiler .GRCg7b).

[0089] 4. Genetic polymorphism analysis of 10 SNPs significantly associated with body length

[0090] The genotype frequency, gene frequency, and heterozygosity (He) of the 10 SNP markers were analyzed using PopGene (version 1.31). The chi-square test was used to test whether the SNP loci were in Hardy-Weinberg (HW) equilibrium. The analysis results are shown in Table 2.

[0091] As shown in Table 2, among the 10 SNP sites, except for SNP8 which has 2 genotypes, the other 9 SNP sites have 3 genotypes. After HW balance test, among the 10 SNPs sites, except for SNP3, SNP4, and SNP10 which deviate from the HW equilibrium state (P<0.05), the other 7 SNP sites are in the HW equilibrium state (P>0.05). The genetic diversity of 3 SNP sites (SNP8, SNP9, and SNP10) is low (He<0.25), and the other 7 SNP sites (SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7) are moderately genetically diverse (0.25 <He<0.50)。

[0092] Table 2 Genetic polymorphisms of 10 SNP sites and Hardy-Weinberg equilibrium test

[0093]

[0094] 5. Analysis of dominant genotypes of body length SNP molecular markers

[0095] The association between polymorphic locus genotype and body skew length was analyzed using univariate analysis of variance within a general linear model using SPSS 16.0 software. The fixed factor was the different genotypes of the SNP marker, and the dependent variable was body skew length. The LSD method was used to compare the significance of body skew length differences between different marker genotypes. P < 0.05 indicated a significant difference.

[0096] First, the correlation between single SNP markers and body skew length was analyzed. The body skew lengths of the 10 SNPs were significantly different among different genotypes, as shown in Table 3. SNP1 (rs312577341) has three genotypes: AA, GA, and GG. Among them, the body skew length of individuals with the AA genotype was significantly greater than that of the GA and GG genotypes (P < 0.05). SNP2 (rs313388213) has three genotypes: AA, GA, and GG. Among them, the body skew length of individuals with the AA and GA genotypes was significantly greater than that of the GG genotype (P < 0.05); SNP3 (rs730967108) has three genotypes: AA, AG, and GG. The body slant length of individuals with the GG genotype was significantly longer than that of individuals with the AA and AG genotypes (P < 0.05); SNP4 (rs315520013) has three genotypes: AA, GA, and GG. The body slant length of individuals with the AA and GA genotypes was significantly longer than that of the GG genotype (P < 0.05); SNP5 (rs317946632) has three genotypes: CC, TC, and TT. The CC genotype has a significantly longer body slant length than that of individuals with the AA and GA genotypes (P < 0.05). The body skew length of individuals with this genotype was significantly greater than that of TC and TT genotypes (P < 0.05); SNP6 (rs315619998) had three genotypes: CC, GC, and GG, among which the body skew length of individuals with CC genotype was significantly greater than that of GC and GG genotypes (P < 0.05); SNP7 (rs317342517) had three genotypes: CC, TC, and TT, among which the body skew length of individuals with CC genotype was significantly greater than that of TC and TT genotypes (P < 0.05); SNP8 (rs313349990 ) has two genotypes, CC and CT, among which the body skew length of individuals with CC genotype was significantly longer than that of individuals with CT genotype (P < 0.05); SNP9 (rs731600098) has three genotypes, AA, AG, and GG, among which the body skew length of individuals with AA genotype was significantly longer than that of AG and GG genotypes (P < 0.05); SNP10 (rs13792170) has three genotypes, CC, CT, and TT, among which the body skew length of individuals with CC genotype was significantly longer than that of individuals with CT and TT genotypes (P < 0.05).

[0097] Haploview software was used to analyze the linkage disequilibrium (LD) of the 10 SNPs. The results of the linkage disequilibrium analysis are shown in Figure 3 . Figure 3 The value R in the box 2 It is obtained by multiplying the D' value by 100. Figure 3 It can be seen that SNP5 and SNP6 are in a strong linkage state (R 2 =94), the linkage between SNP5 and SNP6 produced three haplotypes: H1 (TG), H2 (CC), and H3 (CG), with haplotype frequencies of 0.795, 0.177, and 0.019, respectively (e.g. Figure 4 (as shown). The other eight SNPs were not strongly linked, so only the combined genotype of SNP5 and SNP6 was analyzed for correlation with body skew length, and the combined genotypes of the other eight molecular markers were not analyzed for correlation with body skew length. Combining the three haplotypes generated by the linkage of SNP5 and SNP6 yielded five genotypes, the results of which are shown in Table 4. As shown in Table 4, the association analysis revealed that the H2H2 haplotype (CCCC genotype) was associated with significantly longer body skew length than the other haplotype combinations.

[0098] The AA genotype at SNP1, the AA and GA genotypes at SNP2, the GG genotype at SNP3, the AA and GA genotypes at SNP4, the CCCC genotype resulting from the linkage of SNP5 and SNP6, the CC genotype at SNP7, the CC genotype at SNP8, the AA genotype at SNP9 and the CC genotype at SNP10 are the dominant genotypes for body oblique length and can serve as important molecular markers for molecular-assisted breeding of body oblique length.

[0099] In the breeding of skew body length, the method of retaining individuals with superior genotypes and eliminating individuals with inferior genotypes at SNP1~SNP10 sites can be used to assist in improving the selection of skew body length and accelerate the progress of generational selection of skew body length.

[0100] Table 3 Association analysis between gene loci and body length traits (mean ± SD)

[0101]

[0102] Table 4 Association analysis between haplotype combinations of SNP5 and SNP6 and body length (mean ± standard deviation)

[0103]

[0104] Example 2 Verification of molecular marker-assisted breeding for plagioclase

[0105] At 60 days of age, genotype the chickens in the terminal paternal line A of Lihua Yellow-footed Chicken, and retain the dominant genotype individuals with larger body oblique length. The specific plan is as follows:

[0106] (1) At 60 days of age, 800 A-line roosters were blooded from their wing veins using a disposable syringe, and DNA was extracted using the phenol-chloroform method to extract the total genomic DNA of the tested chickens.

[0107] PCR amplification primers: DNA template sequence information was downloaded from the NCBI website, and primers for 10 SNP sites of related genes (rs312577341, rs313388213, rs730967108, rs315520013, rs317946632, rs315619998, rs317342517, rs313349990, rs731600098, and rs13792170) were designed using Primer Premier software. The relevant primer sequence information is shown in Table 5.

[0108] Table 5 Primer sequence information

[0109]

[0110] (2) PCR amplification, electrophoresis, and sequencing genotyping: PCR amplification products were analyzed by 1.5% agarose gel electrophoresis and sequenced for genotyping. Genotyping was performed on the male A line of Lihua Ephedra chickens, and individuals with the dominant genotype with a larger body length were retained.

[0111] PCR total reaction system 50 μL: DNA template 4 μL, dNTP (2 mmol / L) 2 μL, Mg 2+ (3 mmol·L -1 ) 0.6 μL, 1× PCR reaction buffer 5 μL, upstream and downstream primers (10 μmol·L -1 ) 1 μL each, Taq polymerase (1 U·μL -1 ) 2.5 μL, and add ultrapure water to 50 μL.

[0112] The PCR reaction procedure was as follows: initial denaturation at 95°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min. The PCR-amplified target fragments were detected by electrophoresis on a 1.5% agarose gel.

[0113] The PCR amplification products were sent to a sequencing company for sequence polymorphism detection. The nucleotide sequences of the PCR products at the 10 SNPs sites are shown below:

[0114] SNP1—G / A mutation at 59bp, PCR product length 220bp

[0115] AGGGAGTTCTGGATTCTTGCTAGAAATCATTATTCTCTTTTGAAACTTCTACATCTATK(G / A)TCTCCTAAGAAGTGTATGGAATGTTTTGTTTAAGAAATGTGCCACCTGTTGTGATCAGACATGCTGCCTGAAAAATGGAAATCGATTGATAAATTCAATATATCTAAATTCCTTCTTCCTTTGACTTTAAAATAAAATTAGGTCTCAATCTTTGGGTGTTG.

[0116] SNP2—A / G mutation at 161 bp, PCR product length 210 bp

[0117] CATTCCCCCTTGTCCTATCACTATCCACCCTTGTAAACAGACATTCCCTCTCCTGTTTATATGCTCCCTTCAAGTATTGGAAGGCCACAATAAGGTCTCCCCGGAGCCTTCTTTTCCAAGCTAAAAGACGAATCATACATCTTTTAAAAAAAGAGAACK(A / G)CAAACATCATGAGAAGGTGACCAATTTGGTGAGCAATTCCACCACAGAA.

[0118] SNP3—G / A mutation at 114 bp, PCR product length is 184 bp

[0119] GATGCTGGGGATGCTACTGTTCTAGGGGATCCTAGATCCTCTATAAAGGCGGTGAGACGGAAAGCCCAGCTGAAGTGCCTTTTATACCGGTGCACACAGCCTGAGTAATAAACAK(G / A)GACAAGTTGGAAACTGTGATGCACTTGGAAAGTTATGACCTTATTGCTATCACAGAAACATGGTGGGATG.

[0120] SNP 4-34bp G / A mutation, PCR product length 240 bp

[0121] GCCTGTTGCTCTCCATTGATTGCAGAAAGCACTK(G / A)TGTGAAACTACCTGAATTGTACTGATGGCAAAGAGAACTCAGCGTGGTTTTAACCCATATCTACCCTGACCATGCTTTAACCCAGACAATTCATGAGCACAGCATTAATTACAGGCCAAAGAGCAGTGCCAGCAGGCAGACAATCTGGCCGTGTGCTTTCATGGATAAGACTATGTTATAATATGTGTATGCTGCTGTGTGCCACT。

[0122] SNP5 - T / C mutation at 74 bp, PCR product length is 230 bp

[0123] TGAGGCAAGATCAAGTGCAGCATAAAAACTAGTCTGAAAGCTCTCAACCTCCAGTTGGATGTTGGGAAAAAATK(T / C)CTTCTCTGAAAGAGTGGTCACACGCTGGAATGGGCTTCCCAGGGAGGTGGTGGGGTCACCATCTCTGGAGGTTTTCAAGAAATGTGTAAATGTGGTAGTAAGGGACATGGTTTAGCAGGGAAATATTGGTGGTAGGTGAATGGTTGGACTGGATGA。

[0124] SNP6 - G / C mutation at 110 bp, PCR product length is 192 bp

[0125] AAATGGGCCAGTGTTTTCAGCTTATTTTGAGTTTCCCGTATTGGATTACCAGTTGCTGTTGGTTACTTACTTTGAAGAGGTCTTTCTTGCTGAAATTGCCCATGAAACAK(G / C)CTAAGTCTCTGATTTTGTGAATTATATCTTAGTGCAACCTTTCTCGATGATTGAGTTGCTGGCCTTGCTCAGACTTGCCTTC。

[0126] SNP7 - T / C mutation at 92 bp, PCR product length is 238 bp

[0127] TTCTGTAAGCCTGCATACTGTTTATTCCTTACAGTGTAAAAAAAACCTTTTCTTTCCGACATTGCAGTTTCAGAGCTATTTCGGTCTTTCAK(T / C)CCTCATCCCCTGTGAGAAAGAAAGGTGGGAACAGAAGAAAACTTTTTTCCCTCTTCCGTACTTTAGAGAATTCTCCTGCTGAAGGGTTCTTCCTTTTTCTTACCAGCTCCATAGGAATCTGGCTAATTTCTACAGTGCAGCATCCG。

[0128] SNP8 - C / T mutation at 82 bp, PCR product length is 223 bp

[0129] AGGACGGTTGGAATCTGATGGTCCTTGAGGTTCCTTCTAATCCAAGTCGTTCTATGACTCTCCATTATAAGAATTTTAGCCK(C / T)ATCTCTTTGTTTCATGTCCTGTGTATATTCTAGTATTACAGGCTTTTTTGTGTTCTTTTTTTTCCCCCCTTACTATTTACCTTCTCATGTTTTACTCCATAGATGCTCTCATCTTAATTACAGTCAACCAAACTTCCATGC。

[0130] SNP9 - A / G mutation at 77 bp, PCR product length is 246 bp

[0131] TGCAGAAGGATGCAGAGAGAAATAAAAGCAGGAAGAATGTTTGAGGTCAAAAACTTGAAAAAATTCAGCATTGTATK(A / G)TATGTCTTTAGATATTTATTCAAATTATGTAAGGGAAAAAATTGGACAAAACCACTCAGTACATAAGATCTACCACCTGATACTCTTTTCATCATGATTTATACAGATATACACCTAAAACTTTCTCTTCTCCTATAAAGATCTACATTTTGCCCAAGACTAATCTTCC。

[0132] SNP10 - C / T mutation at 51 bp, PCR product length is 229 bp

[0133] TGGGGGAGATGAAAACAGCTCCTCTATTTAGGACTTTTATCAGGCCTGK(C / T)CCAGGAATCTCAACAGGAGCAGCTATAGAGGCATGTGGTGAGCACTACAGAAACTACAGATACTGAAAACAGGAAAAGATGAGACTTCTAACACAGAGACATAGAACCACAAATCTGTTAAGGATGGAAAAGACTTAGACAATCATCTAGTCCAACCGTTCACCTGCCACCAATATCA.

[0134] Note: The K marked in the above sequence is the mutation site, and the mutated bases in brackets are allele mutations.

[0135] (3) Method for measuring body oblique length at 60 days of age: Use a tape measure to measure the distance between the shoulder joint and the ischial tuberosity on the same side. All body oblique length measurements are made by the same person, and the measured parts are basically the same.

[0136] (4) Molecular marker-assisted breeding of obliquely long bodies

[0137] The AA genotype at SNP1, the AA and GA genotypes at SNP2, the GG genotype at SNP3, the AA and GA genotypes at SNP4, the CCCC genotype resulting from the linkage of SNP5 and SNP6, the CC genotype at SNP7, the CC genotype at SNP8, the AA genotype at SNP9 and the CC genotype at SNP10 are the dominant genotypes for body oblique length and can serve as important molecular markers for molecular-assisted breeding of body oblique length.

[0138] In molecular marker-assisted breeding of body skew length, the method of retaining individuals with superior genotypes at SNP1~SNP10 sites and eliminating individuals with inferior genotypes can assist in improving the selection of body skew length and accelerate the progress of generational selection of body skew length.

[0139] The molecular marker-assisted breeding verification experiment on the body slant length of the 5th and 6th generations of the terminal paternal line A of the Lihua Yellow-footed Chicken showed that the operation is simple and can improve the body slant length more quickly. As shown in Table 6, after two generations of breeding, the body slant length of roosters in the 5th generation increased by 2.09mm compared with the 4th generation, and the 6th generation increased by 1.77mm compared with the 5th generation, with an average increase of 1.93mm per generation. Compared with the 2nd to 4th generations, the body slant length of each generation increased by about 0.75mm, the body slant length of the 5th and 6th generations increased significantly, the coefficient of variation also decreased significantly, and the uniformity was significantly improved, which accelerated the progress of body slant length breeding.

[0140] Table 6 Results of body oblique length measurement in different generations of Lihua Ephedra chicken strain A

[0141]

[0142] Measurement age: 60 days

[0143] Example 3 Verification of molecular marker-assisted breeding for plagioclase

[0144] At 77 days of age, 950 roosters of the 503 line, a medium-speed yellow-feathered broiler specialized strain of Hesheng Food Group, were genotyped, and individuals with a dominant genotype with a larger body oblique length were retained. The specific protocol and primer sequences are described in Example 2.

[0145] In molecular marker-assisted breeding of body skew length, the method of retaining individuals with superior genotypes at SNP1~SNP10 sites and eliminating individuals with inferior genotypes can assist in improving the selection of body skew length and accelerate the progress of generational selection of body skew length.

[0146] Molecular marker-assisted breeding was used to verify the body skew length of the 6th and 7th generations of the 503 line. As shown in Table 7, after two generations of breeding, the body skew length of roosters in the 6th generation increased by 2.20 mm compared with the 5th generation, and the 7th generation increased by 2.03 mm compared with the 6th generation, with an average increase of 2.12 mm per generation. Compared with the 3rd to 5th generations, the body skew length of each generation increased by about 0.95 mm. The body skew length of the 6th and 7th generations increased significantly, the coefficient of variation also decreased significantly, and the uniformity was significantly improved, which accelerated the progress of body skew length breeding.

[0147] Table 7 Results of body skew length measurement of Hesheng medium-speed yellow-feathered broiler 503 line in different generations

[0148]

[0149] Age at measurement: 77 days

[0150] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0151] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0152] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. Application of a reagent for detecting a combination of SNP molecular markers in the assisted breeding of yellow-footed chickens with oblique length, characterized in that: The SNP molecular marker combination includes the following 10 SNP sites, SNP1 to SNP10: SNP1 corresponds to position 170308954 of the positive strand of chromosome 1 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, which is a G or A polymorphism and is numbered rs312577341; SNP2 corresponds to position 170818085 of the positive strand of chromosome 1 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, which is an A or G polymorphism and is numbered rs313388213; SNP3 corresponds to position 171080256 of the positive strand of chromosome 1 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, which is a G or A polymorphism with the number rs730967108; SNP4 corresponds to position 171097585 of the positive strand of chromosome 1 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, which is a G or A polymorphism and is numbered rs315520013; SNP5 corresponds to position 16584961 on the positive strand of chromosome 4 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI. It is a T or C polymorphism with the number rs317946632; SNP6 corresponds to position 16586062 on the positive strand of chromosome 4 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI. It is a G or C polymorphism and is numbered rs315619998; SNP7 corresponds to position 16615516 of the positive strand of chromosome 4 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI. It is a T or C polymorphism and is numbered rs317342517; SNP8 corresponds to position 30317358 of the positive strand of chromosome 7 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI. It is a C or T polymorphism and is numbered rs313349990; SNP9 corresponds to position 30409526 of the positive strand of chromosome 7 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, which is an A or G polymorphism and is numbered rs731600098; SNP10 corresponds to position 8736360 of the positive strand of chromosome 11 in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI. It is a C or T polymorphism and is numbered rs13792170; The dominant genotype of SNP1 is AA, the dominant genotype of SNP2 is AA and GA, the dominant genotype of SNP3 is GG, the dominant genotype of SNP4 is AA and GA, the dominant genotype produced by linkage of SNP5 and SNP6 is CCCC, the dominant genotype of SNP7 is CC, the dominant genotype of SNP8 is CC, the dominant genotype of SNP9 is AA, and the dominant genotype of SNP10 is CC; the chickens to be selected for breeding with the dominant genotype are individuals with relatively long body length.

2. A breeding method for increasing the oblique length of the yellow-footed chicken, characterized in that: The steps include: (1) Determining the genotype of the chicken to be bred, wherein the genotype is the genotype of the SNP molecular marker combination according to claim 1; (2) Select individuals with the AA dominant genotype at SNP1, the AA and GA dominant genotypes at SNP2, the GG dominant genotype at SNP3, the AA and GA dominant genotypes at SNP4, the CCCC dominant genotype resulting from the linkage of SNP5 and SNP6, the CC dominant genotype at SNP7, the CC dominant genotype at SNP8, the AA dominant genotype at SNP9, and the CC dominant genotype at SNP10.

3. The breeding method according to claim 2, characterized in that: In step (1), the method for determining the genotype of the chicken to be bred is: (1.1) Extract the total genomic DNA of the chicken to be tested; (1.2) Based on the SNP molecular marker combination, the target sequence is amplified by PCR using the corresponding primer pair, the sequence of the primer pair is: SNP1F: 5' AGGGAGTTCTGGATTCTTGCT3' SNP1R: 5' CAACACCCAAAGATTGAGACC3' SNP2F: 5'CATTCCCCCTTGTCCTATCA3' SNP2R: 5'TTCTGTGGTGGAATTGCTCA3' SNP3F: 5' GATGCTGGGGATGCTACTGT3' SNP3R: 5' CATCCCACCATGTTTCTGTG3' SNP4F: 5' GCCTGTTGCTCTCCATTGAT3' SNP4R: 5'AGTGGCACACAGCAGCATAC3' SNP5F: 5' TGAGGCAAGATCAAGTGCAG3' SNP5R: 5'TCATCCAGTCCAACCATTCA3' SNP6F: 5' AAATGGGCCAGTGTTTTCAG3' SNP6R: 5'GAAGGCAAGTCTGAGCAAGG3' SNP7F: 5' TTCTGTAAGCCTGCATACTG3' SNP7R: 5'CGGATGCTGCACTGTAGAAA3' SNP8F: 5' AGGACGGTTGGAATCTGATG3' SNP8R: 5'GCATGGAAGTTTGGTTGACTG3' SNP9F: 5' TGCAGAAGGATGCAGAGAGA3' SNP9R: 5'GGAAGATTAGTCTTGGGCAAA3' SNP10F: 5'TGGGGGAGATGAAAACAG3' SNP10R: 5'TGATATTGGTGGCAGGTGAA3'; (1.3) After sequencing the PCR amplification product, determine the genotype.

4. The breeding method according to claim 3, characterized in that: The nucleotide sequences of the PCR amplification products are shown in SEQ ID NO.1 to SEQ ID NO.10, and the lengths of the PCR products are 220 bp, 210 bp, 184 bp, 240 bp, 230 bp, 192 bp, 238 bp, 223 bp, 246 bp, and 229 bp.

Citation Information

Patent Citations

  • Molecular marker influencing oblique length of chicken body and application thereof

    CN111926086A

  • SNP (Single Nucleotide Polymorphism) site located on chromosome 7 and related to chicken growth traits and application

    CN116837110A