Engineered liver-specific enhancers and uses thereof
By designing engineered enhancers and liver-specific core promoters that contain specific transcription factor DNA binding sites, the synthetic promoters are solved, and the problem of insufficient packaging capacity of rAAV vectors is significantly improved, and the efficiency of gene therapy is reduced and the risk of immune response is reduced.
Patent Information
- Application Number
- CN202480004409.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-06-29
- Filing Date
- 2024-05-10
- Publication Date
- 2025-05-30
AI Technical Summary
The existing rAAV vector has limited packaging capacity and cannot effectively package the target gene greater than 5.0kb, resulting in inefficiency of gene therapy, and the large injection of rAAV vector may trigger an immune response.
An engineered enhancer containing specific transcription factor DNA binding sites was designed to bind liver-specific core promoters to construct synthetic promoters to improve the expression level of therapeutic genes in the liver.
By using engineered enhancers and liver-specific core promoters, the expression activity and protein levels of the FVIII-SQ gene in Huh7 cells and FVIII-deficient mice were significantly improved, the efficiency of gene therapy was enhanced, and the need for rAAV vector dose was reduced.
Smart Images

Figure BDA0005359634220000161 
Figure HDA0005359634230000011 
Figure HDA0005359634230000012
Abstract
Description
[0001] Related applications
[0002] This application claims priority to PCT application PCT / CN2023 / 093398, filed on May 11, 2023, and U.S. application 63 / 510,993, filed on June 29, 2023, the entire contents of which are incorporated herein by reference in their entirety. Technical Field
[0003] The present invention generally relates to biotechnology, and more particularly to gene expression regulation, gene therapy, and medicine. More specifically, disclosed herein are engineered liver-specific enhancers and their applications. Background Art
[0004] Recombinant AAV (rAAV) vectors are typically produced by replacing the viral coding sequence of an adeno-associated virus (AAV) with the target gene. rAAV vectors are considered the most promising viral vectors for treating genetic diseases. However, rAAV has a limited packaging capacity of less than 5.0 kb. If the target gene is larger than 5.0 kb, the rAAV vector cannot be fully packaged within the AAV capsid, making it ineffective for gene therapy.
[0005] The rAAV vector typically consists of an expression cassette for the therapeutic gene and two ITRs. The expression cassette includes a promoter, the target gene (transgene), and a polyA sequence. The shortest polyadenylation sequence currently available is approximately 50 bp. The two ITRs, each 145 bp long, are located at either end of the expression cassette and serve as packaging signals that must be incorporated into the rAAV vector. Therefore, the total length of the therapeutic gene expression cassette is approximately 4.71 kb.
[0006] Some DNA fragments encoding therapeutic genes are too large for rAAV packaging capabilities. A small promoter size is crucial to keep the expression cassette within efficient packaging. Furthermore, a liver-specific promoter capable of driving robust gene expression can ensure both safety and efficacy, as large injections of rAAV vectors can lead to adverse immune responses. Therefore, short, strong, liver-specific promoters are urgently needed for rAAV gene therapy for hemophilia A.
[0007] Furthermore, while some DNA fragments encoding therapeutic genes are small enough for efficient packaging, the corresponding proteins are less active, requiring large amounts of rAAV vectors to be injected into patients to produce sufficient protein. Injecting large amounts of rAAV vectors can lead to adverse immune responses. Therefore, the development of effective, specific promoters and enhancers is needed to boost the activity of therapeutic genes. Summary of the Invention
[0008] The present invention provides an engineered liver-specific enhancer, a synthetic promoter comprising the enhancer, an expression vector containing the synthetic promoter, and uses thereof to meet the needs in the art, such as treating various genetic diseases or disorders.
[0009] In one aspect, the present invention provides engineered enhancers comprising DNA binding sites for one or more transcription factors, wherein the transcription factors are selected from the group consisting of HNF-4α, HNF-3β, D-site binding protein (DBP), CCAAT enhancer binding protein alpha / beta (C / EBP-α / β), and hepatocyte nuclear factor 1 alpha / beta (HNF-1α / β).
[0010] In some embodiments, the DNA binding sites of HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β comprise the nucleotide sequences of SEQ ID NOs: 4-8, respectively.
[0011] In some embodiments, the engineered enhancer comprises a nucleic acid sequence of SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:12, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:3, 9 or 12.
[0012] In another aspect, the present invention provides a synthetic promoter comprising the nucleic acid sequence of an engineered enhancer and a core promoter disclosed herein.
[0013] In some embodiments, the core promoter is a liver-specific promoter.
[0014] In some embodiments, the liver-specific promoter is the human alpha-1 antitrypsin (hAAT) promoter.
[0015] In some embodiments, the human alpha-1 antitrypsin (hAAT) promoter comprises the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, or has at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 1 or 2.
[0016] In some embodiments, the synthetic promoter comprises SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 14, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 10, 13 or 14.
[0017] In another aspect, the present invention provides an expression vector comprising a synthetic promoter disclosed herein operably linked to a gene of interest. In some embodiments, the expression vector is a plasmid, a recombinant retroviral vector, a recombinant lentiviral vector, a recombinant adenoviral vector, or a recombinant adeno-associated viral vector (rAAV).
[0018] In another aspect, the present invention provides a method of treating a genetic disease or disorder in a subject in need thereof, comprising administering to the subject an expression vector disclosed herein, thereby expressing the therapeutic protein in the liver of the subject.
[0019] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.
[0020] In some embodiments, the genetic disease or disorder associated with the liver is selected from the group including but not limited to hereditary cholestasis, hemophilia A, hemophilia B, phenylketonuria, hereditary hemochromatosis, tyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinic aciduria, liver cancer, glycogen storage diseases, urea cycle disorders, Crigler-Najjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome-1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation defects, glycogen storage disease type 1A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythropoietic protoporphyria, Gaucher disease, familial hypercholesterolemia, ornithine, and transcarbamylase deficiency.
[0021] In another aspect, the present invention provides the use of an engineered enhancer, or a synthetic promoter, or an expression vector for enhancing the expression level of a transgene in hepatocytes.
[0022] In another aspect, the present invention provides use of an engineered enhancer, or a synthetic promoter, or an expression vector, or a pharmaceutical composition in the preparation of a medicament for a genetic disease or disorder associated with the liver.
[0023] In another aspect, the present invention provides a kit comprising the engineered enhancer, or synthetic promoter, or expression vector, or pharmaceutical composition disclosed herein.
[0024] In some embodiments, the kit further comprises instructions for using the kit.
[0025] These and other features, aspects and advantages of the present invention will become better understood with reference to the following description and appended claims. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] The present invention will now be described by way of non-limiting examples and with reference to the following drawings, in which:
[0027] Figure 1Figure 1 is a diagram of regulatory elements used to drive transgene overexpression in rAAV vectors. Enh, enhancer; Pro, promoter; Int, intron; pA, polyadenylation; HCR, complementary sequence of the partial coding sequence (CDS) of the hepatic control region HCR-1; Ex, proximal element X located in the 5' untranslated region (5'UTR) of the human SERPINA1 (encoding human alpha-1 antitrypsin) genome; HEx, 66 bp combined enhancer containing HCR and Ex; HLP, 252 bp, positive control synthetic promoter; hAAT, 219 bp hAAT (human alpha-1 antitrypsin) promoter; hAATs, 94 bp hAAT promoter.
[0028] Figure 2 Figure 1 shows the engineered enhancers Es, E2, and Em. Transcription factor binding sites (TFBS) ①-⑤ were obtained from JASPAR. TFBS ①-⑤ refer to the DNA binding sites for HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β transcription factors, respectively. Es, a 54bp enhancer designed to contain a combination of TFBSs ①-⑤; Es-2, a 52bp enhancer, similar to Es, but with one thymine and one adenine deleted at the 5' and 3' ends of the HNF-3β transcription factor binding site, respectively (⑥); E2, a 111bp enhancer containing Es and Es-2; Em, another 54bp enhancer designed to contain the DNA binding site shown in the figure, with ⑦ similar to ⑤, except that the seventh base, guanine, is converted to cytosine.
[0029] Figure 3Figure 1 shows a synthetic promoter used to drive overexpression of FVIII-SQ or luciferase in an rAAV vector. HCR, complementary sequence to the partial coding sequence (CDS) of the hepatic control region HCR-1; Ex, proximal element X located in the 5' untranslated region (5'UTR) of the human SERPINA1 (encoding human α-1 antitrypsin) genome; HLP, 252 bp, positive control synthetic promoter; HEx, 66 bp combined enhancer containing HCR and Ex; hAATs, 94 bp hAAT promoter; HEx-hAATs, 177 bp synthetic promoter containing the 94 bp phAAT promoter and the 66 bp HEx enhancer; Es, 54 bp enhancer containing a combination of DNA binding sites for five transcription factors; Es-2, 52 bp enhancer, similar to Es but with a thymine deletion at the 5' and adenine deletion at the 3' and 5' ends of the HNF-3β transcription factor binding site, respectively. Es-hAATs, a 164bp synthetic promoter containing a 94bp human α-1 antitrypsin short core promoter and a 54bp enhancer Es; E2-hAATs, a 215bp synthetic promoter containing a 94bp human α-1 antitrypsin short core promoter, a 54bp enhancer Es and a 52bp enhancer Es-2; Em, another 54bp enhancer; Em-hAATs, a 164bp synthetic promoter containing a 94bp human α-1 antitrypsin short core promoter and a 54bp enhancer Em.
[0030] Figures 4A-4B The activity of liver-specific core promoters was demonstrated. Huh7 cells were transfected with different rAAV vector plasmids in 12-well plates. Cell supernatants were collected 48 hours after transfection, and FVIII-SQ activity and protein levels were measured by APTT and ELISA. HLP, 252 bp, is a positive control synthetic promoter; HEx, a 66 bp combined enhancer containing HCR and Ex; HCR, a complementary sequence to the partial coding sequence (CDS) of the hepatic control region HCR-1; for example, the proximal element X is located in the 5' untranslated region (5'UTR) of the human SERPINA1 (encoding human alpha-1 antitrypsin) genome; hAAT, a 219 bp hAAT (human alpha-1 antitrypsin) promoter; hAATs, a 94 bp hAAT promoter; and HEx-hAATs, a 177 bp synthetic promoter with the enhancer HEx. Figure 4A The activity of FVIII-SQ in Huh7 cells transfected with different plasmids is shown. Figure 4B The protein levels of FVIII-SQ in Huh7 cells transfected with different plasmids are shown. Two-sided Student's t-test was used, and *P < 0.05, **P < 0.01, ***P < 0.001, and ns indicate no significant difference (between HLP and other promoter groups).
[0031] Figures 5A-5D Showing the effect of engineered enhancer on hAATs promoter. Figure 5A The activity of FVIII-SQ in Huh7 cells was shown. Figure 5B This figure shows the protein levels of FVIII-SQ in Huh7 cells. Transcription factor binding sites (TFBS) were obtained from JASPAR. Huh7 cells were transfected with various rAAV vector plasmids in 12-well plates. Cell supernatants were collected 48 hours after transfection, and FVIII-SQ activity and protein levels were measured by APTT and ELISA. HLP, 252 bp, positive control synthetic promoter; E2, 111 bp enhancer containing Es and Es-2; Es, 54 bp enhancer bound to the transcription factor DNA binding site; Es-2, 52 bp enhancer, similar to Es, but lacking one thymine and one adenine at the 5' and 3' ends of the HNF-3β transcription factor binding site, respectively; hAATs, 94 bp human α-1 antitrypsin promoter; Es-hAATs, 164 bp synthetic promoter with enhancer Es; E2-hAATs, 215 bp synthetic promoter containing a 94 bp short human α-1 antitrypsin promoter and enhancers Es and Es-2. Figure 5C The activity of FVIII-SQ was demonstrated in FVIII-deficient mice. Figure 5D Figure 5. Protein levels of FVIII-SQ in FVIII-deficient mice. Approximately 8-10 weeks of age, FVIII-deficient mice were injected with various rAAV vector plasmids via hydrodynamic injection. Plasma was collected 48 hours after injection, and FVIII-SQ activity and protein levels were measured by APTT and ELISA. Two-sided Student's t-tests were used. *P < 0.05, **P < 0.01, ***P < 0.001, and ns indicate nonsignificant differences (between the HLP and other promoter groups or between other two promoter groups).
[0032] Figure 6The effects of different enhancers on the hAAT promoter are shown. Different rAAV vector plasmids were transfected into Huh7 cells in 12-well plates. Cells were harvested 24 hours after transfection to measure luciferase activity. HLP (252 bp), a positive control synthetic promoter; HEx-hAATs (177 bp synthetic promoter with a 66 bp enhancer, HEx); Es-hAATs (164 bp synthetic promoter containing a 94 bp human α-1 antitrypsin short promoter and a 54 bp enhancer, Es); E2-hAATs (215 bp synthetic promoter containing a 94 bp human α-1 antitrypsin short promoter and a 54 bp enhancer, Es, and a 52 bp enhancer, Es-2); and Em-hAATs (164 bp synthetic promoter containing a 94 bp human α-1 antitrypsin short promoter and a 54 bp enhancer, Em). Two-sided Student's t-test was used, and *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, and ns indicate no significant difference (between HLP and other promoter groups or between other two promoter groups).
[0033] Implementation Method
[0034] In the Summary of the Invention and the Detailed Description sections above, as well as in the claims below, specific features of the present invention are mentioned. It should be understood that the disclosure of the present invention in this specification includes all possible combinations of these specific features. For example, when a specific feature is disclosed in the context of a specific aspect or embodiment of the present invention, or in the context of a specific claim, that feature can also be combined with other features and / or used in the context of other features to the extent possible. Specific aspects and embodiments of the present invention as well as general aspects and embodiments of the present invention.
[0035] Gene therapy is a promising approach for treating genetic diseases. In gene therapy, a target gene is introduced into one or more recipient cells. Expression of the introduced gene in these cells influences cellular function and produces a therapeutic effect in the subject. rAAV vectors are considered the most promising viral vectors for gene therapy. However, rAAV has a limited packaging capacity of less than 5.0 kb.
[0036] Including other essential elements, the space between the promoter and the therapeutic gene is approximately 4.71 kb. Therefore, a shorter promoter provides more space for the therapeutic gene. Furthermore, it is beneficial if the promoter is liver-specific, preventing it from driving gene expression in other organs and thus ensuring the safety of the treatment. Furthermore, it is even better if the promoter can drive strong gene expression, thus ensuring the efficacy of the treatment.
[0037] In a first aspect, the present invention provides engineered enhancers comprising DNA binding sites for one or more transcription factors.
[0038] As used herein, an "enhancer" is a nucleic acid sequence that increases the rate of transcription by increasing the activity of a promoter. An "engineered enhancer" refers to a non-naturally occurring artificial enhancer. An "engineered promoter" is sometimes referred to as an "artificial promoter" or "synthetic promoter."
[0039] Transcription factors are proteins that bind to specific DNA sequences and thereby control the transfer (or transcription) of genetic information from DNA to RNA. As used herein, "DNA binding site" refers to a specific DNA sequence to which a transcription factor binds.
[0040] In some embodiments, the transcription factor is selected from the group consisting of hepatocyte nuclear factor-4 alpha (HNF-4α), hepatocyte nuclear factor 3-beta (HNF-3β), D-site binding protein (DBP), CCAAT enhancer binding protein alpha (C / EBP-α), CCAAT enhancer binding protein beta (C / EBP-β), hepatocyte nuclear factor 1 alpha (HNF-1α), and hepatocyte nuclear factor 1 beta (HNF-1β).
[0041] HNF-4α is encoded by the HNF4A gene and is a nuclear transcription factor that binds to DNA as a homodimer. It controls the expression of multiple genes, including hepatocyte nuclear factor 1α, a transcription factor that regulates the expression of multiple hepatic genes.
[0042] HNF-3β is encoded by the FOXA2 gene and is a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators of liver-specific genes such as albumin and transthyretin.
[0043] DBP is a transcriptional activator that recognizes and binds to the sequence 5'-RTTAYGTAAY-3' found in the promoters of genes such as albumin, CYP2A4, and CYP2A5.
[0044] C / EBP-α contains a basic leucine zipper (bZIP) domain and recognizes CCAAT motifs in target gene promoters. It functions as a homodimer and as a heterodimer with CCAAT / enhancer binding proteins β and γ. The activity of this protein can regulate the expression of genes involved in cell cycle regulation and body weight homeostasis.
[0045] C / EBP-β is a bZIP transcription factor that binds to certain DNA regulatory regions as a homodimer. It can also form heterodimers with the related proteins C / EBP-α, C / EBP-δ, and C / EBP-γ.
[0046] HNF-1α, encoded by the HNF1A gene, is a transcription factor highly expressed in the liver and is involved in the regulation of the expression of multiple liver-specific genes.
[0047] HNF-1β is encoded by the HNF1B gene and is a protein of the basic helix-turn-helix family containing a homeobox. HNF1B protein is thought to form a heterodimer with another member of this transcription factor family, HNF-1α.
[0048] In some embodiments, the DNA binding sites of HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β comprise the sequences of SEQ ID NOs: 4-8, respectively.
[0049] SEQ ID NO: 4: HNF-4α transcription factor DNA binding site (TFBS);
[0050] TGGACTTTGCACT
[0051] SEQ ID NO:5: HNF-3β TFBS
[0052] TGTAACA
[0053] SEQ ID NO:6: DBP TFBS
[0054] ATTACGTAAC
[0055] SEQ ID NO:7: C / EBP-α / β TFBS
[0056] ATTGCACAAT
[0057] SEQ ID NO:8: HNF-1α / β TFBS
[0058] GTTAATGATAAC
[0059] In some embodiments, the engineered enhancer comprises the sequence of SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:12, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO:3, 9 or 12.
[0060] SEQ ID NO: 3: Es enhancer (54 bp)
[0061] TGGACTTTGCACTTGTAAACAATTACGTAACATTGCACAATGTTAATGATTAAC
[0062] The Es enhancer is 54 bp and contains DNA binding sites for HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β from the 5′ to the 3′ end.
[0063] SEQ ID NO:9:Em enhancer
[0064] TGGACTTTGCACTATTGCACAATTGTAAACAGTTAATCATTAACATTACGTAAC
[0065] The Em enhancer is 54 bp and contains HNF-4α, C / EBP-α / β, HNF-3β, HNF-1α / β (the seventh base guanine is converted to cytosine), and DBP from the 5′ end to the 3′ end.
[0066] SEQ ID NO: 12: Es-2 enhancer
[0067] TGGACTTTGCACTGTAAACATTACGTAACATTGCACAATGTTAATGATTAAC
[0068] The Es-2 enhancer is 52 bp and is similar to the Es enhancer, except that two nucleotides have been deleted from the Es-2 enhancer. Specifically, one thymine and one adenine have been deleted 5' and 3' to the HNF-3β transcription factor binding site, respectively.
[0069] In another aspect, the present invention provides a synthetic promoter comprising the nucleic acid sequence of an engineered enhancer and a core promoter disclosed herein.
[0070] As used herein, a "synthetic promoter" is a section of DNA that comprises a combination of a core promoter and heterologous upstream regulatory elements (cis-motifs or transcription factor binding sites). "Synthetic promoters" are sometimes referred to as "engineered promoters" or "artificial promoters." The core promoter (also referred to as the minimal region) typically comprises the TATA box necessary for recruiting RNA polymerase II and assembling universal transcription factors to form a pre-initiation complex. Synthetic promoters may comprise, for example, regions of known promoters, regulatory elements, transcription factor binding sites, enhancer elements, repressor elements, and the like.
[0071] In some embodiments, the core promoter is a liver-specific promoter.
[0072] Liver-specific promoters drive transgene expression primarily in the liver but can also drive transgene expression in other tissues or organs where expression levels are lower. Using a liver-specific promoter in an expression cassette can limit unwanted transgene expression in other tissues and promote sustained transgene expression in the liver.
[0073] In some embodiments, the liver-specific promoter is the human alpha-1 antitrypsin (hAAT) promoter.
[0074] In humans, the SERPINA1 gene encodes hAAT, which is produced in the liver and then transported throughout the body via the blood. Therefore, the hAAT promoter is thought to drive gene expression specifically in the liver.
[0075] In some embodiments, the human alpha-1 antitrypsin (hAAT) promoter comprises the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, or has at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to the nucleic acid sequence of SEQ ID NO: 1 or 2.
[0076] SEQ ID NO: 1: hAAT promoter (219 bp)
[0077] TGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTACACTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGC
[0078] SEQ ID NO: 2: hAATs promoter (94 bp)
[0079] GTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGC
[0080] SEQ ID NO: 1 and SEQ ID NO: 2 each contain the upstream sequence of the human SERPINA1 gene. Promoters comprising the sequences of SEQ ID NO: 1 and SEQ ID NO: 2 are referred to as hAAT and hAATs, respectively. These promoters were selected for constructing synthetic promoters in some examples.
[0081] In some embodiments, the synthetic promoter comprises a nucleic acid sequence of SEQ ID NO: 10, SEQ ID NO: 13, or SEQ ID NO: 14, or a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 10, 13, or 14.
[0082] SEQ ID NO: 10: Es-hAATs synthetic promoter
[0083] TGGACTTTGCACTTGTAAACAATTACGTAACATTGCACAATGTTAATGATTAACTTAAGCGTCGACACGCGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGC
[0084] The Es-hAAT synthetic promoter is 164 bp long and consists of a 54 bp enhancer Es and a 94 bp promoter hAATs, connected by necessary enzyme digestion sites.
[0085] SEQ ID NO: 13: E2-hAATs synthetic promoter
[0086] TGGACTTTGCACTTGTAAACAATTACGTAACATTGCACAATGTTAATGATTAACTTAAGTGGACTTTGCACTGTAAACATTACGTAACATTGCACAATGTTAATGATTAACGTCGACACGCGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGC
[0087] The E2-hAATs synthetic promoter is 215 bp long and includes a 54 bp engineered enhancer Es, a 52 bp enhancer Es-2, and a 94 bp promoter hAAT connected by necessary enzyme digestion sites.
[0088] SEQ ID NO: 14: Em-hAATs synthetic promoter
[0089] TGGACTTTGCACTATTGCACAATTGTAAACAGTTAATCATTAACATTACGTAACTTAAGCGTCGACACGCGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGC
[0090] The Em-hAATs synthetic promoter is 164 bp long and consists of a 54 bp enhancer Em and a 94 bp promoter hAATs linked by necessary enzyme digestion sites.
[0091] In another aspect, the present invention provides an expression vector comprising a synthetic promoter disclosed herein operably linked to a gene of interest.
[0092] The term "operably linked" means that the regulatory sequences required for the expression of a coding sequence are placed at an appropriate position in the DNA molecule relative to the coding sequence to achieve the expression of the coding sequence.
[0093] In some embodiments, the expression vector is a plasmid, a recombinant retroviral vector, a recombinant lentiviral vector, a recombinant adenoviral vector, or a recombinant adeno-associated viral vector (rAAV).
[0094] Human adeno-associated virus (AAV) is a non-pathogenic parvovirus that replicates efficiently only in cells co-infected with a helper virus (usually adenovirus or herpes virus). The virus has a broad host range and can efficiently infect a variety of cell types in multiple animal species. Despite this, AAV has not yet been associated with any human or animal disease.
[0095] AAV binds to cells via heparan sulfate proteoglycan receptors. Once attached, AAV entry depends on the presence of a co-receptor, either the fibroblast growth factor receptor or the αvβ5 integrin molecule. In infected cells, the transferred AAV single-stranded DNA (ssDNA) is converted into a double-stranded transcription template. Cells infected with AAV and a helper virus will undergo efficient AAV replication before cell lysis, which is induced by the helper virus rather than the AAV. The helper virus encodes proteins or RNA transcripts that act as transcriptional regulators and participate in DNA replication or modify the cellular environment to allow efficient viral production.
[0096] Recombinant AAV (rAAV) vectors are typically generated by replacing viral coding sequences with the gene of interest. These vectors have been shown to be highly effective for gene transfer and expression in vitro and in vivo at many different sites. They consistently mediate stable expression and are safe for studies in the respiratory tract, central nervous system, skeletal muscle, liver, and eye. As the titer and purity of rAAV preparations increase, the efficiency of rAAV-mediated transduction also increases.
[0097] The inverted terminal repeats (ITRs) from the AAV genome are the only viral sequences required for cis-production of rAAV vectors. A recombinant construct containing two ITRs containing an approximately 5 kb gene expression cassette is converted into an ssDNA vector genome and packaged into AAV particles in the presence of the AAV rep and cap gene products and helper functions. Methods for the production and purification of rAAV are known in the art.
[0098] One of the target genes may be the FVIII gene, which is located on the X chromosome and encodes factor VIII (FVIII). FVIII is one of the main factors in the coagulation cascade. Loss-of-function mutations in FVIII cause a genetic disorder called hemophilia A (HA). HA occurs in 1 in 5,000 males.
[0099] A common treatment for HA is replacement therapy. Factor VIII concentrate is slowly dripped or injected into a patient's vein. These infusions help replace missing or low levels of FVIII in the patient's body. However, this replacement therapy can lead to the development of inhibitors to injected or acquired FVIII, resulting in its failure.
[0100] Another treatment for hemophilia A is gene therapy based on rAAV vectors. rAAV vectors allow for long-term, stable expression of transgenes in vivo for therapeutic purposes. The coding region of FVIII is 7035 bp long and can be divided into six domains: A1, A2, B, A3, C1, and C2. To efficiently package the rAAV vector into the adeno-associated virus (AAV) capsid, the expression cassette for the therapeutic gene that can be inserted into the rAAV vector is approximately 5 kb.
[0101] Due to limitations in AAV packaging capacity, the full-length FVIII coding region inserted into rAAV vectors cannot be packaged into AAV capsids. To address this issue, the FVIII coding region needs to be reduced. Previous studies have shown that the B domain of FVIII (908 amino acids) can be replaced by the SQ domain (14 amino acids) while retaining the coagulation function of the full-length FVIII protein. This engineered FVIII, termed FVIII-SQ, has six domains: A1, A2, SQ, A3, C1, and C2. The A1, A2, and SQ domains form the heavy chain of FVIII-SQ, while A3, C1, and C2 form the light chain. The nucleotide sequence encoding FVIII-SQ is 4374 bp, allowing it to be inserted into rAAV vectors for efficient packaging into AAV capsids. However, even when the expression cassette is approximately 5 kb, many packaged rAAV vectors are incomplete and defective, and these defective rAAV vectors fail to produce functional FVIII. To compensate for this, HA patients need to be injected with large amounts of rAAV vectors to produce sufficient functional FVIII. However, large injections of rAAV vectors may cause adverse immune responses in patients.
[0102] To overcome these shortcomings, the size of the promoter and polyA tail must also be minimized. In some embodiments, the synthetic promoters disclosed herein are used to drive expression of FVIII-SQ or other engineered FVIII fragments. Due to the smaller size of these synthetic promoters, expression cassettes have a higher packaging efficiency.
[0103] In another aspect, the present invention provides pharmaceutical compositions for delivering transgenes described herein to subjects (including human subjects). In some embodiments, the composition comprises any nucleic acid or vector described herein. In some embodiments, the pharmaceutical compositions disclosed herein comprise any vector disclosed herein and one or more pharmaceutically acceptable carriers. In some embodiments, the composition comprises any AAV vector described herein. In some embodiments, the pharmaceutical compositions disclosed herein comprise any AAV vector disclosed herein and one or more pharmaceutically acceptable carriers.
[0104] Although the descriptions of pharmaceutical compositions (e.g., AAV vectors) provided herein primarily relate to pharmaceutical compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other human animal, such as a non-human animal, such as a non-human mammal. Modifications of pharmaceutical compositions suitable for administration to humans to make the compositions suitable for administration to various animals are well known, and a veterinary pharmacologist of ordinary skill can design and / or perform such modifications simply by ordinary (if any) experimentation. Subjects to whom the pharmaceutical compositions are contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals, such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds, such as poultry, chickens, ducks, geese, and / or turkeys.
[0105] In some embodiments, the compositions will be administered to humans.
[0106] In another aspect, the present invention provides a method of treating a genetic disease or disorder in a subject in need thereof, comprising administering to the subject an expression vector disclosed herein, thereby expressing a therapeutic transgene in the liver of the subject.
[0107] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.
[0108] In some embodiments, the genetic disease or disorder associated with the liver is selected from the group including but not limited to hereditary cholestasis, hemophilia A, hemophilia B, phenylketonuria, hereditary hemochromatosis, tyrosinemia type 1, alpha-1 antitrypsin deficiency, argininosuccinic aciduria, liver cancer, glycogen storage diseases, urea cycle disorders, Crigler-Najjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome-1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation defects, glycogen storage disease type 1A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythropoietic protoporphyria, Gaucher disease, familial hypercholesterolemia, ornithine, and transcarbamylase deficiency.
[0109] In some embodiments, the methods provided herein can be used to treat a genetic disease or disorder in a subject in need thereof, comprising administering to the subject an expression vector disclosed herein, thereby expressing a therapeutic transgene in the subject's liver.
[0110] In another aspect, the present invention provides a variety of kits for conveniently and / or effectively practicing the methods of the present disclosure. Typically, the kit will contain sufficient amounts and / or quantities of components to allow the user to perform multiple treatments on a subject and / or conduct multiple experiments.
[0111] Any pharmaceutical composition or carrier of the present disclosure may be included in a kit. In some embodiments, the kit may also include reagents and / or instructions for producing and / or synthesizing the compounds and / or pharmaceutical compositions disclosed herein. In some embodiments, the kit may also include one or more buffers. In some embodiments, the kit of the present disclosure may include components for preparing protein or nucleic acid arrays or libraries, and therefore may include, for example, solid supports.
[0112] In certain embodiments, the kit components can be packaged in an aqueous medium or in a lyophilized form. The container means of the test kit generally includes at least one vial, test tube, flask, bottle, syringe or other container means, into which the components can be placed and appropriately divided. When there are more than one kit components (labeling reagent and label can be packaged together), the test kit generally can also include a second, third or other additional container, in which the additional components can be placed separately. In some embodiments, the test kit can also include a second container means for accommodating sterile, pharmaceutically acceptable buffers and / or other diluents. In certain embodiments, various combinations of components can be included in one or more vials. The test kit of the present disclosure can also generally include a device for accommodating compounds and / or pharmaceutical compositions (e.g., proteins, nucleic acids) of the present disclosure, as well as any other reagent containers for the tight confines of commercial sales. Such containers can include injection or blow molding plastic containers in which the desired vials are retained.
[0113] In some embodiments, the kit components are provided in the form of one or more liquid solutions. In some embodiments, the liquid solution is an aqueous solution, particularly a sterile aqueous solution. In some embodiments, the kit components can be provided in the form of a dry powder. When the reagents and / or components are provided in dry powder form, such powder can be reconstituted by adding a suitable volume of solvent. In some embodiments, it is contemplated that the solvent can also be provided in another container means.
[0114] In some embodiments, the kit can include instructions for using the kit components as well as any other reagents not included in the kit. The instructions can include variations that can be implemented.
[0115] definition
[0116] The terminology used herein is for the purpose of describing the particular situation only and is not intended to be limiting. As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent the terms "includes," "comprising," "having," or variations thereof are used in the detailed description and / or claims, these terms are intended to be inclusive in a manner similar to the term "comprising."
[0117] As used herein, the term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as limitations of the measurement system. For example, "approximately" can mean within 1 or more than 1 standard deviation, depending on the practice of a given value. When specific values are described in this application and claims, unless otherwise indicated, the term "about" should be assumed to mean an acceptable error range for the specific value.
[0118] As used herein, the terms "individual," "patient," or "subject" are used interchangeably. None of these terms require or are limited to situations where supervision (e.g., continuous or intermittent) is performed by a health care worker (e.g., a physician, registered nurse, nurse practitioner, physician assistant, orderlies, or hospice workers).
[0119] 5' and / or 3': Nucleic acid molecules (such as DNA and RNA) are said to have a "5' end" and a "3' end" because the mononucleotide reaction produces polynucleotides in such a way that the 5' phosphate of one mononucleotide pentose ring is linked to its adjacent 3' oxygen via a phosphodiester bond in one orientation. Thus, one end of a linear polynucleotide is referred to as the "5' end" when the 5' phosphate of the polynucleotide is not linked to the 3' oxygen of a mononucleotide pentose ring. The other end of the polynucleotide is referred to as the "3' end" when the 3' oxygen of the polynucleotide is not linked to the 5' phosphate of another mononucleotide pentose ring. Internal nucleic acid sequences can also be said to have both 5' and 3' ends, even though the 5' phosphate of one mononucleotide pentose ring is linked to its adjacent 3' oxygen.
[0120] In linear or circular nucleic acid molecules, discrete internal elements are referred to as "upstream" or "downstream" 5' or 3' elements. For DNA, this terminology reflects the 5' to 3' direction of transcription along the DNA strand. Promoter and enhancer elements direct transcription of linked genes and are typically located 5' or upstream of the coding region. However, enhancer elements can function even when located 3' from the promoter element and coding region. Transcription termination and polyadenylation signals are located 3' or downstream of the coding region.
[0121] The term "promoter region" or "promoter" refers to a region of DNA that directs / initiates transcription of a nucleic acid (e.g., a gene). Promoters include essential nucleic acid sequences near the transcription start site. Typically, promoters are located near the genes they transcribe. Promoters also optionally include distal enhancer or repressor elements, which can be located up to several thousand base pairs from the transcription start site. Tissue-specific promoters are promoters that direct / initiate transcription primarily in a single type of tissue or cell. For example, a liver-specific promoter is a promoter that directs / initiates transcription to a greater extent in liver tissue than in other tissue types.
[0122] Enhancer: A nucleic acid sequence that increases the rate of transcription by increasing promoter activity.
[0123] As is well known in the art, most eukaryotic genes contain exons and introns. The term "exon" refers to a nucleic acid sequence found in genomic DNA that is predicted by bioinformatics and / or confirmed by experiments to provide a continuous sequence for a mature mRNA transcript. The term "intron" refers to a nucleic acid sequence found in genomic DNA that is predicted and / or confirmed not to form a mature mRNA transcript but to be "spliced out" during transcript processing.
[0124] The term "vector" refers to a small carrier DNA molecule into which a DNA sequence can be inserted for introduction into a host cell and replication therein. An "expression vector" is a specialized vector that contains a gene or nucleic acid sequence with the necessary regulatory regions required for expression in a host cell.
[0125] The term "operably linked" refers to placing regulatory sequences required for expression of a coding sequence at appropriate positions in a DNA molecule relative to the coding sequence to achieve expression of the coding sequence. This same definition sometimes applies to the arrangement of a coding sequence and transcriptional control elements (e.g., promoters, enhancers, and termination elements) in an expression vector. This definition also sometimes applies to the arrangement of nucleic acid sequences of a first and a second nucleic acid molecule in which a hybrid nucleic acid molecule is produced.
[0126] As used herein, the term "identical percentage" is used to refer to the comparison between nucleic acid or amino acid sequence in this article. It is defined as the percentage of the nucleotide or amino acid residue identical with the nucleotide or amino acid residue in the specific sequence in the candidate sequence after the alignment sequence and, if necessary, introducing a gap to realize maximum percentage sequence identity. Conventionally, a computer program for comparing nucleic acid or amino acid sequence is used to compare nucleic acid and amino acid sequence, thereby defining the difference between the two. The comparison of nucleic acid or amino acid sequence can be carried out in the various ways within the scope of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for measuring the comparison, including realizing any algorithm required for maximum comparison on the full length of the sequence compared.
[0127] Sequence identity: The identity or similarity between two or more nucleic acid sequences, or two or more amino acid sequences, expressed as the identity or similarity between the sequences. Sequence identity can be measured as a percentage identity; the higher the percentage, the more similar the sequences are. Sequence similarity can be measured as a percentage similarity (taking into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences have a relatively high degree of sequence identity / similarity when aligned using standard methods. This homology is more pronounced when orthologous proteins or cDNAs are derived from more closely related species (e.g., human and mouse sequences) than from more distantly related species (e.g., human and nematode sequences).
[0128] The term "nucleotide" as used herein generally refers to a base-sugar-phosphate combination. Nucleotide may include synthetic nucleotides. Nucleotide may include synthetic nucleotide analogs. Nucleotide may be a monomeric unit of a nucleic acid sequence (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)). The term nucleotide may include ribonucleoside triphosphates, adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP) and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP or derivatives thereof. Such derivatives may include, for example, [αS] dATP, 7-deaza-dGTP and 7-deaza-dATP, as well as nucleotide derivatives that confer nuclease resistance to nucleic acid molecules containing them. The term nucleotide as used herein may refer to dideoxyribonucleoside triphosphates (ddNTP) and derivatives thereof. Illustrative examples of dideoxyribonucleoside triphosphates may include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP and ddTTP. Nucleotide can be unlabeled or detectably labeled by well-known technology.Can also be labeled with quantum dots.Detectable label can include, for example, radioisotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels.The fluorescent label of nucleotide can include but is not limited to fluorescein, 5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N, N, N', N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxyl-X-rhodamine (ROX), 4-(4'dimethylaminophenylazo) benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, cyanine and 5-(2'-aminoethyl) aminonaphthalene-1-sulfonic acid (EDANS).Specific examples of fluorescently labeled nucleotides can include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP, available from Perkin Elmer (Foster City, CA); FluoroLink deoxynucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5-dUTP are available from Amersham, Arlington, MD. Heights, Ill.; fluorescein-15-dATP, fluorescein-12-dUTP, tetramethyl-rhodamine-6-dUTP, IR770-9-dATP, fluorescein-12-ddUTP, fluorescein-12-UTP, and fluorescein-15-2′-dATP were purchased from Boehringer Mannheim, Indianapolis, IN; and chromosome-labeled nucleotides, BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, CascadeBlue-7-UTP, Cascade Blue-7-dUTP, fluorescein-12-UTP, fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine Green-5-UTP, Rhodamine Green-5-dUTP, Tetramethylrhodamine-6-UTP, Tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP and Texas Red-12-dUTP are available from Molecular Probes, Eugene, Oreg. Nucleotides can also be labeled or marked by chemical modification. Chemically modified mononucleotides can be biotin-dNTPs. Some non-limiting examples of biotinylated dNTPs can include biotin-dATP (e.g., biotin-N6-ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).
[0129] The terms "polynucleotide," "oligonucleotide," and "nucleic acid" are used interchangeably to refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof, in mononucleotide, dinucleotide, or multi-stranded form. A polynucleotide can be exogenous or endogenous to a cell. A polynucleotide can be present in a cell-free environment. A polynucleotide can be a gene or a fragment thereof. A polynucleotide can be DNA. A polynucleotide can be RNA. A polynucleotide can have any three-dimensional structure and can perform any function, known or unknown. A polynucleotide can contain one or more analogs (e.g., altered backbones, sugars, or nucleobases). If present, the nucleotide structure can be modified before or after polymer assembly. Some non-limiting examples of analogs include: 5-bromouracil, peptide nucleic acids, xenologous nucleic acids, morpholinos, locked nucleic acids, diol nucleic acids, threose nucleic acids, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g., rhodamine or fluorescein linked to a sugar), thiol-containing nucleotides, biotin-linked nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, quercetin, and wyosine. Non-limiting examples of polynucleotides include coding or non-coding regions of a gene or gene fragment, loci defined by linkage analysis (locus), exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, cell-free polynucleotides, including cell-free DNA (cfDNA) and cell-free RNA (cfRNA), nucleic acid probes and primers. The nucleotide sequence may be interrupted by non-nucleotide components.
[0130] Recombinant: A recombinant nucleic acid molecule is a molecule having a non-naturally occurring sequence, e.g., comprising one or more nucleic acid substitutions, deletions, or insertions, and / or having a sequence that is produced by the artificial combination of two otherwise separate sequence segments. This artificial combination can be achieved by chemical synthesis or, more commonly, by the artificial manipulation of separate nucleic acid segments, e.g., through genetic engineering techniques.
[0131] cDNA (complementary DNA): A DNA fragment lacking internal noncoding regions (introns) and regulatory sequences that control transcription. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells. cDNA may also contain untranslated regions (UTRs), which are responsible for the translational control of the corresponding RNA molecule.
[0132] As used herein, the term "gene" refers to nucleic acid (e.g., DNA, such as genomic DNA and cDNA) and its corresponding nucleotide sequence involved in encoding RNA transcripts. The term used herein for genomic DNA includes intervening non-coding regions and regulatory regions, and may include 5' and 3' ends. In some applications, the term encompasses transcribed sequences, including 5' and 3' untranslated regions (5'-UTR and 3'-UTR), exons, and introns. In some genes, the transcribed region will include an "open reading frame" encoding a polypeptide. In some applications of the term, a "gene" only includes the coding sequence (e.g., "open reading frame" or "coding region") necessary for encoding a polypeptide. In some cases, a gene does not encode a polypeptide, such as ribosomal RNA genes (rRNA) and transfer RNA (tRNA) genes. In some cases, the term "gene" includes not only transcribed sequences, but also non-transcribed regions, including upstream and downstream regulatory regions, enhancers, and promoters. A gene may refer to an "endogenous gene" or a natural gene in its natural position in the genome of an organism. A gene may refer to an "exogenous gene" or a non-natural gene. Non-natural genes can refer to genes that are not typically found in host organisms, but are introduced into host organisms by gene transfer. Non-natural genes can also refer to genes that are not in their natural position in the genome of an organism. Non-natural genes can also refer to naturally occurring nucleic acids or polypeptide sequences (e.g., non-natural sequences) that comprise mutations, insertions, and / or deletions.
[0133] Transcription factors (TFs) are proteins that bind to specific DNA sequences and thereby control the transfer of genetic information from DNA to RNA (or transcription). TFs, alone or in complex with other proteins, perform this function by promoting (as activators) or blocking (as repressors) the recruitment of RNA polymerase (the enzyme that transcribes genetic information from DNA into RNA) to specific genes. The specific DNA sequences to which TFs bind are called response elements (REs) or regulatory elements. Other names include cis-elements and cis-acting transcriptional regulatory elements.
[0134] Gene therapy: The introduction of a heterologous nucleic acid molecule into one or more recipient cells, where expression of the heterologous nucleic acid in the recipient cells affects the function of the cells and produces a therapeutic effect in the subject. For example, the heterologous nucleic acid molecule may encode a protein that affects the function of the recipient cells.
[0135] Inverted terminal repeats (ITRs): Symmetrical nucleic acid sequences within the adeno-associated virus (AAV) genome that are required for efficient replication. ITR sequences are located at both ends of the AAV DNA genome. They serve as origins of replication for viral DNA synthesis and are essential cis-acting components for the generation of AAV integrating vectors.
[0136] Control: Reference standard.
[0137] Hemophilia: A blood clotting disorder caused by a defect in the activity of a clotting factor, which reduces hemostasis. Severe forms occur when the concentration of clotting factor is less than approximately 1% of the normal concentration in healthy subjects. In some subjects, hemophilia is due to a genetic mutation that impairs the expression of the clotting factor. In other cases, hemophilia is an autoimmune disease called acquired hemophilia, in which the subject develops antibodies against the clotting factor, resulting in reduced hemostasis.
[0138] Hemophilia A is caused by a deficiency of functional clotting factor VIII, while hemophilia B is caused by a deficiency of functional clotting factor IX. These disorders, caused by gene mutations, are inherited as sex-linked recessive traits, with the defective gene located on the X chromosome, making the disease typically seen only in males. The severity of symptoms varies depending on the disorder, with severe forms becoming apparent early in life. Bleeding is a hallmark of the disorder, often occurring during male infant circumcision. Other bleeding symptoms may develop when the infant becomes active. Mild cases may go unnoticed until later in life, following surgery or trauma. Internal bleeding can occur anywhere, and joint bleeding is common.
[0139] As used herein, "FVIII deficiency" includes a lack of coagulation activity caused by defective FVIII production, insufficient or absent FVIII production, or partial or complete inhibition of FVIII by inhibitors. Hemophilia A is a FVIII deficiency disorder caused by a defective X-linked gene and the absence or deficiency of the FVIII protein it encodes.
[0140] When the terms "derivative," "variant," and "fragment" are used herein with respect to polypeptides, they refer to polypeptides that are related to the wild-type polypeptide, for example, by amino acid sequence, structure (e.g., secondary and / or tertiary structure), activity (e.g., enzymatic activity), and / or function. Derivatives, variants, and fragments of a polypeptide may comprise one or more amino acid variations (e.g., mutations, insertions, and deletions), truncations, modifications, or a combination thereof, compared to a reference polypeptide.
[0141] As used herein, "diluent" refers to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable. For example, a diluent can be used to increase the bulk of an active drug whose mass is too small for manufacture and / or administration. It can also be a liquid used to dissolve a drug to be administered by injection, ingestion, or inhalation. A common form of diluent in the art is a buffered aqueous solution, such as, but not limited to, phosphate-buffered saline, which simulates the composition of human blood.
[0142] The term "pharmaceutical composition" refers to a mixture of an expression vector disclosed herein or an rAAV vector disclosed herein with other chemical components, such as a diluent or carrier. The pharmaceutical composition facilitates administration of the compound to an organism. The pharmaceutical composition will typically be tailored to the specific intended route of administration. The pharmaceutical composition is suitable for human and / or veterinary use.
[0143] The pharmaceutical compositions described herein can be administered to human patients themselves, or in the form of pharmaceutical compositions in which they are mixed with other active ingredients, such as in combination therapy, or with carriers, diluents, excipients, or combinations thereof. Appropriate formulation depends on the route of administration chosen.
[0144] As used herein, "excipient" refers to an inert substance added to a pharmaceutical composition to provide the composition with, but not limited to, bulk, consistency, stability, binding ability, lubrication, disintegration ability, etc. "Diluent" is a type of excipient.
[0145] As used herein, the term "treatment" refers to an approach to obtaining a beneficial or desired result, including but not limited to a therapeutic benefit and / or a prophylactic benefit. For example, treatment may comprise administering a system or cell population disclosed herein. A therapeutic benefit may refer to any treatment-related improvement or effect on one or more diseases, conditions, or symptoms being treated. For prophylactic benefit, a composition may be administered to a subject at risk for developing a particular disease, condition, or symptom, or to a subject reporting one or more physiological symptoms of a disease, even though the disease, condition, or symptom may not yet manifest.
[0146] The term "effective amount" or "therapeutically effective amount" refers to an amount of a composition (e.g., a composition comprising an rAAV vector) sufficient to produce the desired activity upon administration to a subject in need thereof. The term "therapeutically effective" can refer to an amount of a composition sufficient to delay the manifestation of, prevent the progression of, alleviate, or reduce at least one symptom of a condition treated by the methods of the present disclosure.
[0147] A "therapeutic effect" may occur if the condition being treated changes. This change may be positive or negative. For example, a "positive effect" may correspond to an increase in the number of activated T cells in a subject. In another example, a "negative effect" may correspond to a decrease in the number or size of tumors in a subject. A "change" in the condition being treated may refer to a change of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 25%, 50%, 75% or 100% in the condition. The change may be based on an improvement in the severity of the condition being treated in an individual, or based on a difference in the frequency of improvement of the condition in a population of individuals to which treatment is administered and to which treatment is not administered. Similarly, the methods of the present disclosure may comprise administering a "therapeutically effective" amount of cells to a subject. The term "therapeutically effective" should be understood to have a definition corresponding to "having a therapeutic effect."
[0148] The following examples are presented to provide a person of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention and are not intended to limit the scope of what the inventors consider to be, nor are they intended to represent that the following experiments are all or the only experiments performed. Efforts have been made to ensure the accuracy of the numbers used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be taken into account. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric pressure. Example
[0149] Example 1. Design and acquisition of liver-specific enhancers and testing their effects on promoters
[0150] This example describes how to design and obtain liver-specific enhancers, and test their effects on promoters. Specifically, synthetic promoters (each consisting of a short core promoter and an engineered enhancer) were used to drive the expression of B-domain deleted FⅧ (FⅧ-SQ) in Huh7 cells and mice, or overexpression of luciferase in Huh7 cells. The activity and protein levels of FⅧ-SQ and luciferase activity were measured to compare the activity of synthetic promoters with different core promoter and enhancer combinations. The results showed that the synthetic promoter was shorter than the 252bp HLP liver-specific promoter, but had significantly higher promoter activity.
[0151] method
[0152] Specific enhancer design
[0153] The present invention selects and uses several transcription factors, including hepatocyte nuclear factor 1α / β (HNF-1α / β), HNF-3β, HNF-4α, CCAAT enhancer binding protein α / β (C / EBP-α / β) and D site binding protein (DBP).
[0154] In the present invention, the DNA binding sites of the aforementioned transcription factors (TFBSs) are combined and arranged to form a 54-bp engineered enhancer (Es, SEQ ID NO: 3), which is then added upstream of the core promoter to enhance transgene overexpression. The TFBS sequences for HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β used in the present invention are shown in SEQ ID NOs: 4-8, respectively.
[0155] Another 54 bp engineered enhancer (Em, SEQ ID NO: 9) was designed by rearranging the TFBS of the above transcription factors and replacing the seventh base guanine with cytosine in the TFBS sequence of HNF-1α / β.
[0156] A third enhancer, Es-2 (SEQ ID NO: 12), was designed. It is 52 bp in length and similar to the Es enhancer, except that two nucleotides were deleted from the Es-2 enhancer. Specifically, one thymine and one adenine were deleted at the 5' and 3' ends of the HNF-3β transcription factor binding site, respectively.
[0157] Obtaining liver-specific core promoter
[0158] The present invention takes into account the conservation of sequences between Homo sapiens and Mus musculus and the position of the TATA box relative to the transcription start site (TSS) when selecting a promoter.
[0159] Two core promoters, upstream sequences of the human SERPINA1 gene (encoding human α-1 antitrypsin, hAAT), designated the 219 bp hAAT promoter and the 94 bp hAAT promoter, were selected for in vitro construction of synthetic promoters. The 219 bp hAAT promoter (SEQ ID NO: 1) contains the complementary genomic sequence of Chr14:
[0160] 94388594-94388812 (NC_000014.9). The 94 bp hAAT promoter (SEQ ID NO: 2) contains the complementary genomic sequence of Chr14: 94388594-94388687.
[0161] Construction of rAAV vector plasmid
[0162] According to the reference (Blood. 2013 April 25; 121(17): 3335-3344.) and patent EP 2,698,163 B1, the liver-specific HLP promoter was selected as the positive control promoter. The HLP promoter was synthesized by GENERAL BIOSYSTEMS (Anhui, China) and cloned into the pUC-HLP plasmid.
[0163] The hAAT and hAAT promoters were obtained by polymerase chain reaction (PCR) using genomic DNA from Huh7 cells as a template. The HLP promoter was also obtained by PCR using the pUC-HLP plasmid as a template. After double digestion with Mlu I and Nhe I, these promoters were cloned into the rAAV vector backbone pssAAV-TTR-FVIII-SQ to construct recombinant vectors, including pssAAV-hAAT-FVIII-SQ, pssAAV-hAATs-FVIII-SQ, and pssAAV-HLP-FVIII-SQ. The pssAAV-TTR-FVIII-SQ plasmid expression vector contains the TTR promoter, introns, the FVIII-SQ coding sequence, and a polyA tail.
[0164] A single-stranded oligonucleotide containing a 54-bp engineered enhancer (Es) and several enzyme cleavage sites up to 90 nucleotides was synthesized by GENEWIZ (Suzhou, China). Its complementary oligonucleotide was also synthesized by GENEWIZ. These two oligonucleotides were combined to form a DNA fragment with cohesive ends containing Mlu I enzyme cleavage sites at both ends. This DNA fragment was then cloned into the pssAAV-hAATs-FVIII-SQ vector to generate the pssAAV-Es-hAATs-FVIII-SQ vector. The sequence of the Es-hAATs synthetic promoter is shown in SEQ ID NO: 10, which contains a 54-bp engineered enhancer (Es) and a 94-bp hAATs promoter.
[0165] Similarly, a fragment containing the 34 bp HCR (liver control region) and the 32 bp proximal enhancer element from the HLP promoter was cloned into the pssAAV-Es-hAATs-FVIII-SQ vector after double digestion with HindIII and AflII to construct the pssAAV-HEx-hAATs-FVIII-SQ vector. The sequence of the HEx-hAATs synthetic promoter is shown in SEQ ID NO: 11, which contains the 34 bp pHCR (liver control region), the 32 bp proximal enhancer element from the HLP promoter, and the 94 bp hAATs promoter.
[0166] SEQ ID NO:11-HEx-hAAT synthetic promoter
[0167] TGTTTGCTGCTTGCAATGTTTGCCCATTTTAGGGTGGACACAGGACGCTGT
[0168] GGTTTCTGAGCCAGGCTTAAGCGTCGACACGCGTGACCTTGGTTAATATTC
[0169] ACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACG
[0170] AGGACAGGGCCCTGTCTCCTCAGC
[0171] The DNA fragment of the engineered enhancer Es-2 (SEQ ID NO: 12, similar to Es, but with a thymine and an adenine deletion at the 5' and 3' ends of the HNF-3β transcription factor binding site, respectively) was formed by two complementary oligonucleotides synthesized by GENEWIZ. Subsequently, Es-2 was double-digested with AflⅡ and SalⅠ and cloned into
[0172] The pssAAV-Es-hAATs-FVIII-SQ vector was constructed within the pssAAV-Es-hAATs-FVIII-SQ vector backbone. The sequence of the E2-hAATs synthetic promoter is shown in SEQ ID NO: 13, which comprises an engineered enhancer Es, an engineered enhancer Es-2, and a 94 bp hAATs promoter.
[0173] The pssAAV-HLP-FVIII-SQ vector was digested with Mlu I and Nhe I, and the HLP fragment was cloned into the pssAAV-MSP-luciferase vector backbone. This was then digested with Hind III and Spe I to generate pssAAV-HLP-luciferase. The pssAAV-MSP-luciferase plasmid expression vector contains the MSP promoter, introns, the luciferase coding sequence, and a BGH polyA tail. Similarly, HindⅢ and NheⅠ were used to obtain HEx-hAATs, Es-hAATs and E2-hAATs fragments from pssAAV-HEx-hAATs-FⅧ-SQ, pssAAV-Es-hAATs-FⅧ-SQ and pssAAV-E2-hAATs-FⅧ-SQ, and the double-enzyme digested fragments were cloned into the pssAAV-MSP-luciferase vector backbone, and then digested with HindⅢ and SpeⅠ to obtain pssAAV-HEx-hAATs-luciferase, pssAAV-Es-hAATs-luciferase and pssAAV-E2-hAATs-luciferase vectors, respectively.
[0174] The DNA fragment of the engineered enhancer Em (SEQ ID NO:9) was formed from two complementary oligonucleotides synthesized by GENEWIZ. Em was then cloned into the pssAAV-Es-hAATs-luciferase vector backbone and double-digested with HindIII and AflII to generate the pssAAV-Em-hAATs-luciferase vector. The sequence of the Em-hAATs synthetic promoter is shown in SEQ ID NO:14, which contains the engineered enhancer Em and the 94-bp hAATs promoter.
[0175] All primers used for vector plasmid construction are listed in Table 1 (SEQ ID NO: 15-27).
[0176] Table 1. Primers for constructing core promoters and synthetic promoters
[0177]
[0178]
[0179] Figure 1 Diagram showing the positive control liver-specific promoter HLP (Blood. 2013 Apr 25;121(17):3335-3344) and the core promoter hAAT and hAATs used to drive FVIII-SQ overexpression in rAAV vector plasmids. Figure 2 Diagrams of the engineered enhancers Es, E2, and Em are shown. Figure 3 Diagrams of the HLP promoter and several synthetic promoters are shown.
[0180] Cell culture and transfection
[0181] Huh7 cells were obtained from ATCC and cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% FBS (fetal bovine serum) and 1% penicillin-streptomycin. The cells were incubated at 37° C. under 5% CO 2 .
[0182] Transfection was performed in 12-well plates. Briefly, Huh7 cells were grown overnight until the confluence was approximately 80%, and then a mixture of 0.5 μg of plasmid expressing FVIII-SQ or EGFP (enhanced green fluorescent protein) and 1.5 μL of PolyJet (SignaGen Laboratories, Maryland) was added to each cell. The manufacturer's protocol was followed exactly. Cells were transfected in duplicate with each plasmid constructed above. After 6-8 hours, the cells were gently rinsed with DPBS (Dulbecco's phosphate-buffered saline) and cultured in F12 medium. Supernatants were collected 48 hours after transfection, and the activity and protein levels of FVIII-SQ were measured by APTT and ELISA as described below.
[0183] Similarly, Huh7 cells were cultured overnight in 12-well plates for transfection with plasmids containing different promoters and luciferase coding sequences. Cells were transfected in triplicate with each plasmid. After 6-8 hours, the culture medium containing the transfection reagent and plasmids was removed, and fresh DMEM containing FBS and penicillin-streptomycin was added to the 12-well plates. Cells were collected 24 hours after transfection for measurement of luciferase activity.
[0184] APTT (one-stage activated partial thromboplastin clotting time)
[0185] For in vitro assays, ReFacto (Genetics Institute, Cambridge, MA) was serially diluted from 1 U / mL (200 ng / mL) in F12 medium at a dilution of 1 / 2 to 1 / 64 and used as a standard. ReFacto is a recombinant FVIII that can be used as a standard for APTT and ELISA. The culture F12 medium was collected from the above 12-well plate and centrifuged at 13,000 rpm for 5 minutes. The supernatant was then used as the sample. 50 μL of STA-PTT reagent (Diagnostica Stago, Asnieres, France) was added to enough STAGO cuvettes containing magnetic beads in each well. Thereafter, each diluted standard protein and each sample was added to different wells of a STAGO cuvette pre-filled with STA-PTT reagent. The mixture was incubated at 37°C for 170 seconds. Then 50 μL of 25 mM CaCl2 was added to initiate and measure the clotting time using a STAGO machine (Diagnostica Stago, Asnieres, France). The FVIII-SQ activity was calculated based on the standard curve.
[0186] For in vivo assays, plasma was collected from the retro-orbital venous plexus of mice by adding the blood sample to a 1.5 mL tube prefilled with the anticoagulant sodium citrate (final concentration 3.8%). The supernatant (mouse plasma) was then centrifuged at 2500 g for 15 minutes and transferred to a fresh tube. Plasma samples were diluted appropriately, and FVIII-SQ activity and protein levels were measured by APTT and ELISA.
[0187] ELISA (enzyme-linked immunosorbent assay)
[0188] In a 96-well plate, each well was coated with 100 μL of 2.5 ng / μL capture antibody PAH-FVIII-S (Haematologic Technologies, Essex) in coating buffer (containing 0.1 M sodium bicarbonate and carbonate, pH 9.6) at 4°C overnight. The wells were washed three times with 300 μL of PBST buffer (140 mM NaCl, 2.5 mM KCl, 8 mM Na₂HPO₄, 2 mM KH₂PO₄, and 0.05% Tween-20, pH 8.4) for 5 minutes each, followed by 300 μL of PBST buffer containing 3% BSA at room temperature for 2 hours. The wells were washed three times with PBST buffer, followed by the addition of 100 μL of standard or sample, and incubation at room temperature for 1.5 hours. A serial dilution of ReFacto (12.5 ng / mL, two-fold serial dilution to 0.1953 ng / mL) was used as a standard. After washing the wells three times with PBST buffer, 100 μL of 0.5 ng / μL biotinylated detection antibody GMA-8021 (Green Mountain Antibodies, Burlington) was added. The plate was incubated at room temperature for 1 hour. After washing three times, 100 μL of a 200-fold dilution of Streptavidin-HRP (CST, Boston) in PBST buffer containing 0.1% BSA was added to each well and incubated in the dark for 1 hour. The plate was then washed three times with PBST buffer and developed using 100 μL of KPL SureBlue TMB 1-Component Microwell Peroxidase Substrate (Seracare, Milford). Development was allowed to proceed at room temperature in the dark for 1-10 minutes, and 100 μL of 0.5 M H2SO4 was added to stop the color development. OD values were measured at 450 nm and 630 nm using a spectrophotometer. The amount of FVIII-SQ in the culture medium was calculated based on the standard curve.
[0189] Fluid power injection
[0190] FVIII-deficient mice, approximately 8-10 weeks old, were injected with different rAAV vector plasmids via hydrodynamic injection. Briefly, 2 mL of a mixture containing PBS and 100 μg of plasmid was gently injected into each mouse via the tail vein at a constant velocity. Three mice were treated per group. Plasma was collected 48 hours after injection, and FVIII-SQ activity and protein levels were measured by APTT and ELISA.
[0191] Luciferase assay
[0192] After removing DMEM, the transfected cells on the 12-well plate were gently rinsed with DPBS, and then the DPBS was removed and 100 μL of cell lysis buffer in the Firefly Luciferase Reporter Gene Assay Kit (Beyotime, Shanghai) was added to each well. After standing at room temperature for 5 minutes, the sample was transferred to an Eppendorf tube. After centrifugation at 4°C and 12,000 rpm for 2 minutes, the supernatant was transferred to a new tube. 30 μL of each sample was added to a 96-well white detection plate (Corning, New York) with 30 μL of substrate in the Firefly Luciferase Receptor Gene Assay Kit, and the mixture was used to detect luciferase activity by a Synergy H1 hybrid multifunctional microplate reader (BioTek, Winooski).
[0193] Schematic diagrams were created using Adobe Illustrator CS5. Statistical analysis was performed using GraphPad Prism 8.0.1. All data are reported as mean ± standard deviation. Significant differences in FVIII-SQ activity and protein levels between the HLP promoter and other promoter groups (or between two other promoter groups) were calculated using a two-tailed Student's t-test. Significant differences in luciferase activity between two promoter groups were also calculated using a two-sided Student's t-test.
[0194] result
[0195] Selection of liver-specific core promoter
[0196] The packaging capacity of rAAV vectors is limited, and the expression cassette containing conventional promoters and therapeutic FⅧ-SQ for the treatment of hemophilia A (HA) is too large to accommodate. Therefore, there is an urgent need for a small-sized promoter that can effectively drive FⅧ-SQ overexpression. It is well known that core promoters are usually not specific enough or too weak to drive transgene overexpression. The present invention first obtains a short liver-specific core promoter that maintains basal activity for transgene overexpression. The short liver-specific core promoter is then combined with various small enhancers to construct a synthetic promoter that drives strong gene expression.
[0197] In order to obtain a small, efficient and liver-specific promoter, the 219bp phAAT promoter (hAAT, SEQ ID NO: 1) and the 94bp hAATs promoter (hAATs, SEQ ID NO: 2) of the human SERPINA1 genome (encoding human α-1 antitrypsin, hAAT) were selected. These two promoters were cloned into the pssAAV-TTR-FⅧ-SQ rAAV vector plasmid to obtain pssAAV-hAAT-FⅧ-SQ and pssAAV-hAATs-FⅧ-SQ, respectively. According to the reference (Blood. 2013 Apr 25; 121 (17): 3335–3344.) and patent EP2698163A1, a hybrid liver-specific HLP promoter was selected with a length of 252bp, containing regulatory elements from the HCR (liver control region) and the human SERPINA1 genome sequence. In order to test whether the activity of hAATs promoter can be enhanced by enhancers, a
[0198] pssAAV-HEx-hAATs-FVIII-SQ contains the HEx-hAATs promoter (SEQ ID NO: 11), wherein HEx is a 66 bp hybrid enhancer derived from the HLP promoter (see Figure 1 , the figure shows HLP).
[0199] To examine the activities of hAAT, hAATs, and HEx-hAAT, different rAAV vector plasmids were prepared to place the FVIII-SQ gene under the control of hAAT, hAATs, HEx-hAAT, and HLP, respectively. These vectors were then transfected into Huh7 cells grown in 12-well plates. Cell supernatants were collected 48 hours after transfection, and FVIII-SQ activity and protein levels were measured using APTT and ELISA. The data are shown in Figure 4.
[0200] As shown in Figure 4, FVIII-SQ activity under the hAAT promoter was reduced compared to FVIII-SQ activity under the liver-specific HLP promoter (P = 0.0392). However, in Huh7 cells, FVIII-SQ protein levels under the hAAT promoter were comparable to those under the liver-specific HLP promoter (P = 0.3572). On the other hand, in Huh7 cells, FVIII-SQ activity (P = 0.0009) and protein levels (P = 0.0034) under the hAATs promoter were significantly lower than those under the liver-specific HLP promoter (P = 0.0009) and protein levels (P = 0.0034). Despite this, the data suggest that the hAATs promoter maintains basal activity driving FVIII-SQ expression. Interestingly, as shown in Figure 4, hAATs promoter activity was restored by the addition of HEx, suggesting that the hAATs promoter can be used to examine the effects of synthetic enhancers.
[0201] Effects of synthetic enhancers on the hAAT promoter
[0202] Several transcription factors, including HNF-1α / β, HNF-3β, DBP, HNF-4α, and C / EBP-α / β, have been reported to be transcriptional activators that control the expression of many liver-specific genes, such as albumin (ALB), transthyretin (TTR), and α-1 antitrypsin (AAT) genes. To investigate whether a synthetic enhancer formed by random combinations of transcription factor binding sites (TFBS) of HNF-1α / β, HNF-3β, DBP, HNF-4α, and C / EBP-α / β could enhance the activity of the hAATs promoter, a 54 bp enhancer, Es (Es, SEQ ID NO: 3), was designed and synthesized, which includes the DNA binding sites of HNF-4α, HNF-3β, DBP, C / EBP-α / β, and HNF-1α / β (see SEQ ID NO: 4). Figure 2 , above). Another 111 bp enhancer E2 was designed by adding a 52 bp enhancer Es-2 (similar to Es, but lacking a thymine and an adenine at the 5' and 3' ends of the HNF-3β transcription factor binding site, respectively) after Es (see Figure 2 , middle panel).
[0203] The Es-hAAT synthetic promoter and the E2-hAAT synthetic promoter were then created and their sequences are shown in SEQ ID NOs: 10 and 13, respectively. Different rAAV vector plasmids were prepared to place the FVIII-SQ gene under the control of the Es-hAATs promoter, the E2-hAATs promoter, or the HLP promoter. The different rAAV vector plasmids were transfected into Huh7 cells in 12-well plates. Cell supernatants were collected 48 hours after transfection, and the activity and protein levels of FVIII-SQ were measured by APTT and ELISA. The data are shown in Figure 2. Figure 5A and Figure 5B shown.
[0204] like Figure 5A As shown in Figure 3, the activity of FVIII-SQ driven by the Es-hAATs promoter was significantly higher than that driven by the hAATs promoter (P = 0.0016). Similarly, the protein level of FVIII-SQ driven by the Es-hAATs promoter was also significantly higher than that driven by the hAATs promoter (P = 0.0004, Figure 5B These data indicate that the enhancer Es significantly enhances hAAT promoter activity. Furthermore, under the control of the Es-hAAT synthetic promoter (SEQ ID NO: 10), FVIII-SQ activity (P = 0.0067) and protein levels (P = 0.0009) were approximately 2-fold higher than under the control of the HLP promoter, demonstrating the potent gene expression-enhancing ability of the enhancer Es.
[0205] like Figure 5A and Figure 5B As shown, the activity and protein level of FVIII-SQ driven by E2-hAAT promoter were significantly higher than those driven by hAAT promoter. Comparing the activity and protein level of FVIII-SQ, E2-hAATs promoter also showed stronger promoting activity than HLP promoter. However, the data showed that there was no significant difference in the activity of FVIII-SQ driven by Es-hAATs promoter and FVIII-SQ driven by E2-hAATs promoter, and the protein level of FVIII-SQ driven by E2-hAATs promoter was significantly lower than that driven by E2-hAATs promoter. FVIII-SQ driven by Es-hAAT promoter (P=0.0382, Figure 5B This observation is surprising. Figure 2 As shown in the middle figure, the E2 enhancer contains more transcription factor binding sites (TFBS) than the Es enhancer. Figure 5A The data in
[15] indicate that the addition of more TFBSs did not enhance the promoting activity of the E2 enhancer compared to the Es enhancer. In fact, a negative effect on the protein level of FVIII-SQ was observed using the E2-hAATs promoter compared to the Es-hAATs promoter ( Figure 5B).
[0206] In addition, in vivo validation was performed in FVIII-deficient mice. An rAAV vector plasmid carrying the FVIII-SQ gene under the control of the Es-hAATs promoter or the HLP promoter was injected into 8-10 week-old FVIII-deficient mice. Plasma was collected 48 hours after injection, and FVIII-SQ activity and protein levels were measured using APTT and ELISA. Data are shown in Figure 2. Figure 5C and Figure 5D shown.
[0207] like Figure 5C and Figure 5D As shown in Figure 3, the activity and protein level of FVIII-SQ driven by the Es-hAAT synthetic promoter in FVIII-deficient mice were higher than those driven by the Es-hAAT synthetic promoter. Figure 5A and Figure 5B The results in Huh7 cells were consistent with those shown in .
[0208] Comparison of different enhancers on hAATs promoter activity
[0209] The ITR in rAAV vectors can act as a weak promoter (J Biol Chem. 1993 Feb 15; 268(5): 3781-90.), therefore, the ATG trinucleotide in the enhancer or promoter sequence may disrupt the target protein. Therefore, another 54 bp engineered enhancer (Em, SEQ ID NO: 9) was designed by changing the combination of TFBS and replacing the seventh base guanine in the TFBS sequence of HNF-1α / β with cytosine to remove the ATG trinucleotide (see Figure 2 bottom group).
[0210] To examine the enhancing effects of different enhancers, synthetic promoters containing the hAAT promoter and enhancers HEx, Es, E2, or Em were constructed (see Figure 3 ). Different rAAV vector plasmids were made, and the luciferase gene was placed under the control of HEx-hAAT, Es-hAAT, E2-hAAT, Em-hAAT, and HLP, respectively. These vectors were then transfected into Huh7 cells grown on 12-well plates. Cells were collected 24 hours after transfection to measure luciferase activity. The data are shown in Figure 2. Figure 6 shown.
[0211] like Figure 6As shown, the luciferase activities driven by Es-hAATs and Em-hAATs were similar (P = 0.0652), indicating that the Em enhancer and the Es enhancer have similar enhancing activities in enhancing luciferase expression. Another observation was that the luciferase activities driven by the three synthetic promoters (Es-hAATs, E2-hAATs, and Em-hAATs) were significantly stronger than those driven by the HEx-hAATs promoter and the HLP promoter (P < 0.0001), indicating that the Es, E2, and Em enhancers can significantly enhance the promoting activity of the hAATs promoter.
[0212] Example 2. Treatment of patients with genetic diseases
[0213] Testing human patients for genetic diseases.
[0214] An expression vector is prepared comprising a synthetic promoter disclosed herein operably linked to a therapeutic transgene. Prior to use in treating human patients, the expression vector is tested for efficacy and safety in in vitro cell culture and in vivo animal models.
[0215] Example 3. Treatment of human hemophilia A patients using rAAV expression vectors
[0216] This example describes an exemplary method for clinically treating hemophilia A using rAAV vectors encoding FVIII-SQ.
[0217] An expression vector was prepared, comprising the synthetic promoter disclosed herein operably linked to FVIII-SQ. Prior to use in treating human patients, the efficacy and safety of the expression vector were tested in in vitro cell culture and in vivo animal models.
[0218] A patient diagnosed with hemophilia A is selected for treatment. A therapeutically effective amount of rAAV is administered to the patient. The rAAV can be administered intravenously. The appropriate therapeutic dose can be selected by a licensed physician.
[0219] In some cases, the therapeutically effective dose is 1×10 11 to 1×10 14 Virus particles (vp) / kg range, for example, about 1×10 11 vp / kg. In most cases, a single dose is administered to the patient. The subject's health can be monitored over time to determine the effectiveness of the treatment.
Claims
1. An engineered enhancer comprising one or more DNA binding sites for transcription factors, wherein the transcription factors are selected from the group consisting of HNF-4α, HNF-3β, D site binding protein (DBP), CCAAT enhancer binding protein α / β (C / EBP-α / β) and hepatocyte nuclear factor 1α / β (HNF-1α / β).
2. The engineered enhancer of claim 1, wherein the DNA binding sites of HNF-4α, HNF-3β, DBP, C / EBP-α / β and HNF-1α / β comprise the nucleic acid sequences of SEQ ID NOs: 4-8, respectively.
3. The engineered enhancer of any one of claims 1-2, wherein the engineered enhancer comprises a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 3, 9 or 12.
4. A synthetic promoter comprising the nucleic acid sequences of the engineered enhancer and core promoter according to any one of claims 1 to 3.
5. The synthetic promoter of claim 4, wherein the core promoter is a liver-specific promoter.
6. The synthetic promoter of claim 5, wherein the liver-specific promoter is the human alpha-1 antitrypsin (hAAT) promoter.
7. The synthetic promoter of claim 6, wherein the human alpha-1 antitrypsin (hAAT) promoter comprises a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 99% or 100% sequence identity to SEQ ID NO: 1 or 2.
8. The synthetic promoter of any one of claims 4-7, wherein the synthetic promoter comprises a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% identical to SEQ ID NO: 10, 13 or 14.
9. An expression vector comprising the synthetic promoter according to any one of claims 4 to 8.
10. The expression vector of claim 9, further comprising a transgene operably linked to the synthetic promoter of any one of claims 4-8.
11. The expression vector of claim 10, wherein the transgene encodes a therapeutic protein for treating a genetic disease or disorder related to the liver.
12. The expression vector according to claim 11, wherein the therapeutic protein is FVIII protein or a functional fragment thereof.
13. The expression vector according to any one of claims 9 to 12, wherein the expression vector is a plasmid, a recombinant retroviral vector, a recombinant lentiviral vector, a recombinant adenoviral vector or a recombinant adeno-associated viral vector (rAAV).
14. The expression vector of claim 13, wherein the expression vector is a rAAV vector.
15. A pharmaceutical composition comprising the engineered enhancer of any one of claims 1-3, or the synthetic promoter of any one of claims 4-8, or the expression vector of any one of claims 9-14, and a pharmaceutically acceptable carrier.
16. A method for treating a liver-related genetic disease or disorder in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the expression vector of any one of claims 9 to 14 or the pharmaceutical composition of claim 15.
17. The method of claim 16, wherein the subject is a mammal.
18. The method of claim 17, wherein the subject is a human.
19. The method of claim 16, wherein the liver-related genetic disease or disorder is selected from the group consisting of, but not limited to, hereditary cholestasis, hemophilia A, hemophilia B, phenylketonuria, hereditary hemochromatosis, tyrosinemia type 1, alpha-1 antitrypsin deficiency, arginine succinic aciduria, liver cancer, glycogen storage disease, urea cycle disorder, Crigler-Najjar syndrome, familial amyloid polyneuropathy, atypical hemolytic uremic syndrome-1, primary hyperoxaluria type 1, maple syrup urine disease, acute intermittent porphyria, coagulation defects, glycogen storage disease type A, homozygous familial hypercholesterolemia, organic aciduria, cystic fibrosis, erythropoietic protoporphyria, Gaucher disease, familial hypercholesterolemia, ornithine and transcarbamylase deficiency.
20. Use of the engineered enhancer according to any one of claims 1-3, or the synthetic promoter according to any one of claims 4-8, or the expression vector according to any one of claims 9-14 in enhancing the expression level of a transgene in hepatocytes, wherein the transgene is operably linked to the synthetic promoter.
21. Use of the engineered enhancer according to any one of claims 1-3, or the synthetic promoter according to any one of claims 4-8, or the expression vector according to any one of claims 9-14, or the pharmaceutical composition according to claim 15 in the preparation of a medicament for a genetic disease or disorder related to the liver.
22. A kit comprising the synthetic promoter according to any one of claims 4 to 8, or the expression vector according to any one of claims 9 to 14, or the pharmaceutical composition according to claim 15.
23. The kit of claim 22, further comprising instructions for using the kit.