A broad-spectrum protective antigen of avibacterium paragallinarum and use thereof

Abstract

The application discloses a broad-spectrum protective antigen of avian pathogenic bacterium and application thereof, and belongs to the field of poultry infectious disease prevention and control. The application provides application of avian pathogenic bacterium protein p1 in preparation of a broad-spectrum protective antigen protein of avian pathogenic bacterium, and the amino acid sequence of the avian pathogenic bacterium protein p1 is shown as SEQ ID No. 1. The protective antigen protein has strong immunogenicity and reactivity, and a subunit vaccine prepared by using the antigen protein can provide 90% protection rate of chickens to A, B and C three serotypes of avian pathogenic bacterium, and can effectively prevent infection of the avian pathogenic bacterium.

Description

TECHNICAL FIELD

[0001] The present application relates to a broad-spectrum Avibacterium paragallinarum protective antigen and its application, belonging to the field of poultry infectious disease prevention and control. BACKGROUND

[0002] Chicken infectious coryza is an acute respiratory disease caused by Avibacterium paragallinarum, mainly manifested as inflammation of the nasal cavity and sinuses, facial swelling, which can cause poor growth in growing chickens, decreased egg production in laying hens, and increased mortality. The disease is widespread in the world, causing serious economic losses to the poultry industry.

[0003] Under the background of reducing and eliminating antibiotics, vaccine immunization has become the main strategy for the prevention and control of IC. In the 1960s, Japanese scholars first prepared an inactivated vaccine of A-type Avibacterium paragallinarum. With the isolation and prevalence of C-type strains, a bivalent (A+C) inactivated vaccine was also developed and marketed. In recent years, A, B, and C serotypes have all been prevalent in China, and a trivalent (A+B+C) inactivated vaccine has been widely used in many farms. However, traditional whole-bacterium inactivated vaccines lack cross-protection between different serotypes, and often cause severe stress reactions after vaccination. Secondly, due to the mismatch between vaccine strains and prevalent strains, bacterial mutations, and other reasons, cases of immunization failure frequently occur in the clinic. Therefore, there is an urgent need for a chicken infectious coryza vaccine with broad-spectrum protective effect and small side effects. SUMMARY

[0004] The purpose of the present application is to provide the application of Avibacterium paragallinarum protein p1 in the preparation of Avibacterium paragallinarum protective antigen protein, and the Avibacterium paragallinarum subunit vaccine and polyclonal antibody prepared based on the above-mentioned Avibacterium paragallinarum protective antigen protein.

[0005] Technical scheme: The present application provides the application of Avibacterium paragallinarum protein p1 in the preparation of broad-spectrum Avibacterium paragallinarum protective antigen protein, and the amino acid sequence of the Avibacterium paragallinarum protein p1 is shown as SEQ ID No. 1.

[0006] SEQ ID NO.1: MKLACPLNFPLKTTALLVISVCSSKALYAEEISSSTEYMAVLPTIDVVTTQETANTKGYVGYEEAQATRNLLTIKEMPQTIDVINIQKNKNYGTNDLSSILEGNAGVDATYDMRGENIYLRGFQADANDIYRDGIRESGQVRRSTANIERVEILKGPSSILYGRSNGGGVINMVSKFANFTTSRNIGVTYGSWNSRSVNLDVNQKINENVAVRLTSELSAAEAYRYGVRSKGRMFSPSISLQSDDGRLQWVGQYTYDYQWRIPDRNPAKSVYDEMGIGYRNSFFRDGDYVDDKLQVWRSDLKYFINDQWLVNWQLAYRQADQDFDHYFAGTYSATDKTLKQSYAWQKTRNKTFTNNITFNGEFDTASLKHKVTIGLDYSQEERHPILAVLRNQKIDPFLSRYQWPARQHPNATVNNRHKAYSTGIFVQDLISLTDNVKVLLGGRYDFYRFNSTNIKQERRDTKGHSFSPNVGVVWEVTPEHTLYASFNRSFSPYGGRSYLGISTDQKDVFNASPEYNQQYEVGIKSDWFNRTLTTTLSAYQLERRNIRYRPNKDILDVWAVRGKDQSKGVELSLLGQLAPKWYIRSSVGWMVAKIKEDKQNPQNNNRTLNNTGNFTSNLFVRYVPVEKFYLETGLTHLGKRYYFNGNQQTILPSFTRVDAMVGYNLNPVNITFAVSNLFNKTYWRSDSMPGNPRSFNLRLTYMF。

[0007] Furthermore, the gene sequence encoding the Avibacterium paragallinarum protein p1 is shown in SEQ ID No.2.

[0008]

[0009] Furthermore, the broad-spectrum avian bacillus protective antigen protein is prepared by the following steps: amplifying the coding gene of the avian bacillus protective antigen protein; introducing the coding gene fragment into an expression vector to obtain a recombinant expression vector; introducing the recombinant expression vector into a protein expression host bacterium to obtain recombinant bacteria; culturing the recombinant bacteria; inducing protein expression; and purifying the protein to obtain the avian bacillus protective antigen protein.

[0010] Furthermore, the primer sequences used to amplify the coding gene of the protective antigen protein of *Avianobacter paragallinarum* are shown in SEQ ID No. 3-4.

[0011] SEQ ID No. 3: CTCGGATCCGAGGAAATTTCTTCATCAACAG.

[0012] SEQ ID No. 4: CGCGTCGACGAACATATACGTCAAACGCAAATT.

[0013] The present invention also provides a subunit vaccine of *Avianella paragallinarum*, the active ingredient of which includes a protective antigen protein of *Avianella paragallinarum* with an amino acid sequence as shown in SEQ ID No. 1.

[0014] Furthermore, the final concentration of the protective antigen protein of *Avianobacter paragallinarum* in the *Avianobacter paragallinarum* subunit vaccine is 500 μg / mL.

[0015] The present invention also provides a polyclonal antibody obtained by immunizing animals with the above-mentioned avian para-chicken bacillus subunit vaccine.

[0016] Furthermore, the immunization method used was as follows: animals were given a first immunization with a subunit vaccine of Avianella paragallinarum, followed by a booster immunization 2 weeks later. Each immunization was administered with 50 μg of vaccine per animal. Serum was collected 14 days after the booster immunization to obtain polyclonal antibodies.

[0017] Furthermore, the titer of the polyclonal antibody is 1:819200.

[0018] The present invention also provides the application of the above-mentioned polyclonal antibody in the preparation of drugs or preparations for inhibiting / disinfecting avian bacillus paragallinarum.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention provides an immunoprotective antigen protein against three serotypes of Avianobacterium paragallinarum, namely A, B, and C. The antigen protein has strong immunogenicity, and the subunit vaccine prepared using the antigen protein can provide chickens with a 90% protection rate against the three serotypes of Avianobacterium paragallinarum, namely A, B, and C, and can effectively prevent infection by Avianobacterium paragallinarum. Attached Figure Description

[0020] Figure 1 The map of the recombinant prokaryotic expression vector pET-32a-p1 constructed.

[0021] Figure 2 This is the PCR amplification result of the gene encoding the recombinant protein p1 of this invention. In the figure, M represents the DNA molecular weight standard, and 1 represents the target gene fragment.

[0022] Figure 3 This is an SDS-PAGE analysis diagram of the recombinant protein of this invention. M represents the protein molecular weight standard. 1: Whole cells after pET-32a-p1 induction. 2: Supernatant after pET-32a-p1 lysis. 3: Precipitate after pET-32a-p1 lysis.

[0023] Figure 4 This is an SDS-PAGE analysis chromatogram of the purified recombinant antigen protein of this invention. M represents the protein molecular weight standard. 1: Recombinant protein Ni column filter sample. 2: Recombinant protein Ni column wash sample. 3, 4: Recombinant protein Ni column elution samples.

[0024] Figure 5 These are the Western blot results of the immunoprotective antigen protein of this invention and positive serum for *Paragonimus paragallinarum*. Specifically, A represents the Western blot result of the immunoprotective antigen protein of this invention and positive serum for anti-*Paragonimus paragallinarum* type A. B represents the Western blot result of the immunoprotective antigen protein of this invention and positive serum for anti-*Paragonimus paragallinarum* type B. C represents the Western blot result of the immunoprotective antigen protein of this invention and positive serum for anti-*Paragonimus paragallinarum* type C. M represents the protein molecular weight standard. 1: p1 protein.

[0025] Figure 6 These are the results of in vitro bactericidal efficacy tests of the polyclonal antibody of the present invention. Wherein, A represents the bactericidal efficacy of the polyclonal antibody against type A *Avianobacterium paragallinarum*. B represents the bactericidal efficacy of the polyclonal antibody against type B *Avianobacterium paragallinarum*. C represents the bactericidal efficacy of the polyclonal antibody against type C *Avianobacterium paragallinarum*.

[0026] Figure 7 The results show the bacterial shedding levels in the test chickens after challenge. A represents the bacterial shedding level of *Avianobacterium paragallinarum* type A after challenge. B represents the bacterial shedding level of *Avianobacterium paragallinarum* type B after challenge. C represents the bacterial shedding level of *Avianobacterium paragallinarum* type C after challenge.

[0027] Figure 8 Clinical symptom scores were assigned to the experimental chickens after challenge with *Avianobacterium paragallinarum* type A. Score A represented the clinical symptom score of the experimental chickens after challenge with *Avianobacterium paragallinarum* type B. Score C represented the clinical symptom score of the experimental chickens after challenge with *Avianobacterium paragallinarum* type C.

[0028] Figure 9 The clinical symptom scoring criteria are as follows: 1:1 points, mild symptoms (mild facial swelling); 2:2 points, moderate symptoms (moderate facial swelling); 3:3 points, severe symptoms (severe facial swelling). Detailed Implementation

[0029] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0030] Example 1: Construction of the recombinant prokaryotic expression vector pET-32a-p1

[0031] 1. PCR amplification of the p1 nucleic acid sequence

[0032] The gene coding sequence of the immune protective antigen protein p1 is shown in Seq ID No.1.

[0033] Upstream and downstream primers were designed according to the base sequence of the p1 coding gene (Seq ID No. 2), and BamHI and SalI restriction sites were introduced into the upstream and downstream primers, respectively. The primer sequences are shown in Seq ID Nos. 3-4. The primers were synthesized by Nanjing Genscript Biotech Co., Ltd.

[0034] PCR amplification was performed using genomic DNA of Avian bacillus paragallinarum 2019 / JS80 as a template.

[0035] Table 1 Reaction System

[0036]

[0037] PCR reaction procedure: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 5 min, 56℃ annealing for 30 s, 72℃ extension for 2 min, for 30 cycles; then 72℃ extension for 2 min, and storage at 4℃. PCR products were identified by 1% agarose gel electrophoresis, and the target band was recovered using a DNA gel recovery kit from Beijing Kangwei Century Biotechnology Co., Ltd.

[0038] 2. Enzyme digestion and recovery of PCR products

[0039] The PCR products were digested with restriction endonucleases Sal I and BamHI.

[0040] Table 2 Enzyme digestion system

[0041]

[0042] Reaction conditions: 37℃ for 2 hours.

[0043] After separating all enzyme digestion products by 1% agarose gel electrophoresis, DNA fragments were recovered using the DNA gel recovery kit from Beijing Kangwei Century Biotechnology Co., Ltd., following the instructions in the kit's manual. The recovered target DNA fragments can be used immediately or stored at -20℃ for later use.

[0044] 3. Enzyme digestion and recovery of expression vectors

[0045] The expression vector pET-32a (purchased from Novegen, catalog number 69015) was double-digested with restriction endonucleases Sal I and BamHI, and then recovered by agarose gel electrophoresis.

[0046] 4. Ligation of the target fragment to the vector

[0047] The target DNA fragment recovered and purified in step 2 and the expression vector pET-32a fragment recovered and purified in step 3 were ligated to obtain the recombinant plasmid pET-32a-p1.

[0048] Table 3 Connection System

[0049]

[0050] Connection conditions: 25℃ for 2 hours.

[0051] 5. Transform and screen clones

[0052] Take 50 μL of Escherichia coli Trans1-T1 competent cells and 5 μL of the ligation product obtained in step 4. Add the cells to the competent cells, incubate on ice for 30 min, heat shock at 42℃ for 30 s, incubate on ice again for 3 min, add 400 μL of antibiotic-free LB medium, and culture at 37℃ with shaking for 1 h. Centrifuge at 5000 r / min for 4 min, discard the supernatant, resuspend the cells in 100 μL of medium, spread them on LB agar plates containing 50 μg / ml ampicillin, and incubate at 37℃ for 12 h.

[0053] 6. Enzyme digestion identification of recombinant plasmids

[0054] Single colonies grown on the plate were picked and inoculated into LB liquid medium containing 50 μg / mL ampicillin, and cultured at 37℃ and 220 rpm for 12 h with shaking. Using the bacterial culture as a template, *S. tag* and *T7ter* (sequences shown in SEQ ID No. 5-6, SEQ ID No. 5: GAACGCCAGCACATGGAC, SEQ ID No. 6: TGCTAGTTATTGCTCAGCGG) were used as primers for bacterial PCR identification. Positive clones were identified by agarose gel electrophoresis. Positive clones with the correct band size were collected, and recombinant plasmids were extracted using a plasmid extraction kit from Beijing Kangwei Century Biotechnology Co., Ltd. The recombinant plasmids were identified by digestion with Sal I and BamHI. The presence of bands of the expected size for both the target fragment and the vector fragment after digestion indicated a correct recombinant plasmid. The correctly identified recombinant plasmids were then sent for sequencing. The pattern of the recombinant vector pET-32a-p1 is shown below. Figure 1 As shown. PCR identification results are as follows. Figure 2 As shown.

[0055] 7. Construction of expression bacteria

[0056] Take 50 μL of competent BL21(DE3) cells and add 0.5 μL of the correctly identified recombinant plasmid pET-32a-p1 to the competent cells and mix well. Incubate on ice for 30 min, then heat shock at 42℃ for 90 s, followed by another 3 min on ice. Add 400 μL of antibiotic-free LB medium and incubate at 37℃ with shaking for 1 h. Centrifuge at 5000 rpm for 4 min, discard the supernatant, resuspend the cells in 100 μL of medium, and spread on LB agar plates containing 50 μg / ml ampicillin. Incubate at 37℃ for 12 h. Pick single colonies from the plates and culture them for identification by bacterial PCR. Correctly identified recombinant bacteria are mixed with 60% glycerol at a 3:1 ratio and stored at -70℃.

[0057] Example 2: Expression of the target gene in Escherichia coli and purification of the recombinant protein

[0058] 1. Induced expression of recombinant proteins

[0059] Positive clones containing the recombinant plasmid pET-32a-p1 were inoculated into 5 mL of LB broth containing 50 μg / mL ampicillin and cultured overnight at 37°C with shaking. Then, they were inoculated into 5 mL of ampicillin-resistant LB broth at a 1:100 ratio and cultured. When OD... 600 When the concentration reaches 0.4, add IPTG to a final concentration of 1 mmol / L and continue culturing for 5 hours.

[0060] 2. SDS-PAGE electrophoresis analysis of the expression product

[0061] Collect the bacterial cells after induction at 12000 r / min for 10 min, sonicate for 10 min, centrifuge to separate the supernatant and precipitate, add 6×SDS buffer to each, and boil for 10 min to obtain the SDS-PAGE samples.

[0062] Electrophoresis was performed at a constant voltage of 200V for 90 minutes. After electrophoresis, the gel was removed, stained with Coomassie Brilliant Blue for 2 hours, and then destained with destaining solution until the background was clear.

[0063] The results are as follows Figure 3 As shown, E. coli containing positive recombinant plasmids were induced with 1 mmol / L IPTG at 37℃ for 5 h. SDS-PAGE analysis showed that the target protein band appeared at the expected position and was consistent with the expected protein size. The recombinant protein p1 was expressed in both the supernatant and the precipitate.

[0064] 3. Large-scale preparation and purification of recombinant proteins

[0065] The frozen recombinant expression bacteria were inoculated into ampicillin-resistant liquid LB medium at a ratio of 1:100 and cultured overnight. After overnight culture, they were inoculated into 800 mL of ampicillin-resistant liquid LB medium at the same ratio and cultured for about 3 hours. When OD 600 When the concentration reaches 0.4, add IPTG to a final concentration of 1 mmol / L for 5 h of induction. After induction, centrifuge at 8000 rpm for 10 min, discard the supernatant, resuspend the bacterial cells in PBS, sonicate for 30 min, and centrifuge at 8000 rpm for 10 min. Dissolve the precipitate in LE Buffer overnight at 4°C. Purify the supernatant after inclusion body dissolution using a nickel affinity chromatography column. The specific procedure is as follows: Add 1 mL of medium to the column and allow it to settle freely. Drain the stock solution, add 4 column volumes of equilibration buffer to equilibrate the chromatography medium, add the sample to the equilibrated Ni-NTA resin and allow it to flow out slowly (this step can be repeated 2-3 times if necessary), wash the packing material with equilibration buffer, and elute the target protein with different concentrations of imidazole. Collect the eluent and then perform SDS-PAGE electrophoresis for detection. Figure 4 As can be seen, there are bands at the predicted size locations of the target protein.

[0066] Example 3 Characterization of recombinant antigen protein

[0067] 1. Analyze the reactivity of recombinant antigen proteins using Western blot.

[0068] Inactivated vaccines were prepared using standard strains of Avianella paragallinarum 221 (serum type A), Spross (serum type B), and H-18 (serum type C) to immunize SPF chickens and obtain positive sera for types A, B, and C. These were then used as primary antibodies, and the reactivity of the purified p1 protein was verified by Western blotting.

[0069] The results showed that the p1 protein could react with positive sera of avian paraguinea (serotypes A, B, and C), indicating good reactivity. Figure 5 ).

[0070] 2. Preparation of recombinant protein polyclonal antibodies

[0071] (1) Vaccine preparation and immunization test

[0072] Preparation of recombinant antigen protein vaccine: Recombinant antigen protein p1 and white oil adjuvant were mixed and emulsified at a ratio of 1:2, and the concentration of recombinant antigen protein p1 in the mixed vaccine was 500 μg / mL.

[0073] Immunization method: Sixty 21-day-old SPF chickens (purchased from Boehringer Ingelheim Viton Biotechnology Co., Ltd.) were equally divided into a p1 immunization group and a control group. The p1 immunization group received a subunit vaccine (50 μg / chicken) via intramuscular injection in the leg. Two weeks later, a booster immunization (50 μg / chicken) was administered. Blood was collected from the wing vein 14 days after the booster immunization to separate serum and obtain polyclonal antibodies.

[0074] (2) Determination of polyclonal antibody titer

[0075] The antibody titer generated after immunization with p1 protein was determined by indirect ELISA. The protein was diluted to 1 μg / mL using coating buffer. After assembling the ELISA plate, 100 μL of antigen protein was added to each well, and the plate was incubated overnight at 4°C. 100 μL of PBST was added to each well, and the plate was shaken for 5 min, repeated three times. Then, 100 μL of 5% skim milk was added to each well, and the plate was incubated at 37°C for 2 h. The skim milk was discarded, and the plate was washed three times with PBST. 100 μL of serum was added to each well, and the plate was incubated at 37°C for 1 h. The liquid in the wells was then discarded, and the plate was washed three times with PBST. 100 μL of enzyme-labeled secondary antibody (HRP-rabbit anti-chicken) diluted 1:5000 was added. The plate was incubated at 37°C for 1 h. The secondary antibody was removed, and the plate was washed three times with PBST. After patting dry, 100 μL of TMB substrate solution was added to each well, and the plate was incubated at 37°C in the dark for 15 min. After adding 50 μL of stop solution to each well, immediately read the OD using a microplate reader. 450 The results showed that the titer of the polyclonal antibody of this invention was 1:819200, and it was named p1 polyclonal antibody.

[0076] Example 4 Serum sterilization experiment

[0077] Avian bacilli 2024JS01 (serum type A), 2019JS31 (serum type B), and 2023JS02 (serum type C) were cultured to the logarithmic growth phase, and the bacterial suspension was diluted to 10⁻⁶ with culture medium. 5 CFU / mL. Positive sera (A, B, and C serotypes), negative sera (A, B, and C serotypes), and p1 polyclonal antibody were inactivated at 56°C for 30 min. Then, 190 μL of each was added to a 1.5 mL EP tube, followed by 10 μL of a 10 CFU / mL solution. 5 CFU / mL of *Avianobacter paragallinarum* serotypes A, B, and C were mixed and incubated at 37°C for 30 min. Then, 190 μL of negative serum or PBS was added, and the mixture was incubated at 37°C for 60 min. 100 μL of the solution was spread onto a TSA plate, with each dilution performed in triplicate. The cells were counted after 12 h of incubation. *Avianobacter paragallinarum* positive serum served as a positive control, and *Avianobacter paragallinarum* negative serum served as a negative control. The experiment was repeated three times. Results are as follows: Figure 6 As shown, the polyclonal antibody of the present invention has a bactericidal efficiency of 63.65% against type A avian bacillus, a bactericidal efficiency of 60% against type B avian bacillus, and a bactericidal efficiency of 69.8% against type C avian bacillus.

[0078] Example 5: Subunit Vaccine Immunization Challenge Protection Test

[0079] 1. Challenge test

[0080] Two weeks after booster immunization, experimental chickens were challenged with avian paraguinea bacteria strains 2024JS01 (serum type A), 2019JS31 (serum type B), and 2023JS02 (serum type C), respectively. The challenge dose was 10... 6 CFU / bird, challenged via nasal drops. Chickens were observed for one week post-challenge, and clinical symptoms (nasal discharge, facial swelling, etc.) were recorded to assess the immunoprotective efficacy of the subunit vaccine. Results are shown in Table 4. Within 7 days post-challenge, only one chicken in each of the three immunization groups developed symptoms of infectious coryza, and its score was lower than that of the control group. Figure 7 The scoring criteria are as follows: Figure 9 .

[0081] Table 4. Immunization protection rate of subunit vaccines

[0082]

[0083]

[0084] Table 4 lists the results of challenge experiments against different serotypes of *Avianobacter paragallinarum*. Chickens immunized with the subunit vaccine of this invention were challenged with three different serotypes of *Avianobacter paragallinarum* 14 days after the second immunization. All chickens in the non-immunized control group subsequently developed symptoms, with a protection rate of 0%. In the p1 subunit vaccine immunization group, only one chicken showed rhinitis symptoms after challenge, with a protection rate of 90%. Therefore, the subunit vaccine prepared using the immunoprotective antigen protein provided by this invention has a significant immunizing effect and provides broad-spectrum protection against the three serotypes of *Avianobacter paragallinarum*.

[0085] 2. Determination of bacterial shedding after challenge

[0086] Pharyngeal swabs were collected from each group of experimental chickens on days 3, 5, and 7 after challenge to determine the bacterial shedding. The HagA gene of *Avianella paragallinarum* (sequences shown in SEQ ID No. 7-8, SEQ ID No. 7: GTAGCGAAGCAGCCAACTTA, SEQ ID No. 8: TGGGTTCGCTTCACCATAAC) was amplified and ligated into the T3 vector (purchased from Beijing TransGen Biotech Co., Ltd., catalog number CT301-01) to construct the standard plasmid T3-HagA. The copy number was calculated using a formula after determining the concentration. The standard plasmid was then serially diluted, and different dilutions were used as templates for quantitative real-time PCR to construct a standard curve. The copy number was calculated using the formula Y = -0.3289*X + 10.15.

[0087] The collected swabs were placed in 1.5 mL EP tubes, followed by the addition of 1 mL sterile PBS. The mixture was vortexed, and 600 μL was then pipetted into a new EP tube. The tubes were centrifuged at 12000 rpm for 10 min, and 500 μL of the supernatant was discarded. The remaining 100 μL of liquid was boiled at 100 °C for 10 min, centrifuged at 12000 rpm for 10 min, and the supernatant was used as the template for quantitative PCR. The qPCR system was configured and the program designed according to Table 5. The results were compared with the standard curve to calculate the copy number of *Avianella paragallinarum* in the detected pharyngeal swabs.

[0088] Table 5 qPCR reaction system

[0089]

[0090]

[0091] The qPCR reaction program was as follows: 95℃ for 5 min; 95℃ for 10 s; 60℃ for 30 s; 95℃ for 15 s; 60℃ for 60 s; 95℃ for 15 s; and the number of cycles was 40.

[0092] The results are as follows Figure 8As shown, the bacterial shedding in all immunized groups was lower than that in the control group, and the bacterial shedding on day 5 was significantly lower than that in the control group.

[0093] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of *Avianobacter paragallinarum* protein p1 in the preparation of a broad-spectrum protective antigen protein of *Avianobacter paragallinarum*, characterized in that, The amino acid sequence of the *Avianobacter p1* protein is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that, The gene sequence encoding the *Avianobacter p1* protein is shown in SEQ ID No.

2.

3. The application according to any one of claims 1 to 2, characterized in that, The protective antigen protein of *Avianobacter paragallinarum* is prepared by the following steps: amplifying the coding gene of the protective antigen protein of *Avianobacter paragallinarum*; introducing the coding gene fragment into an expression vector to obtain a recombinant expression vector; introducing the recombinant expression vector into a protein expression host bacterium to obtain a recombinant bacterium; culturing the recombinant bacterium; inducing protein expression; and purifying the protein to obtain the protective antigen protein of *Avianobacter paragallinarum*.

4. The application according to claim 3, characterized in that, The primer sequences used to amplify the encoding gene of the broad-spectrum avian bacillus protective antigen protein are shown in SEQ ID No. 3-4.

5. A subunit vaccine against avian bacillus paragallinarum, characterized in that, Its active ingredient includes a broad-spectrum protective antigen protein of *Avianella paragallinarum* with an amino acid sequence as shown in SEQ ID No.

1.

6. The avian bacillus subunit vaccine according to claim 5, characterized in that, The final concentration of the broad-spectrum avian bacillus protective antigen protein in the avian bacillus subunit vaccine is 500 μg / mL.

Images