Molecular markers tightly linked to wheat coleoptile length under alkali stress and their application

By developing KASP-2A, a molecular marker with a long and tightly linked colloid sheath under wheat alkali stress, and using the KASP labeling primer set for PCR amplification and fluorescence signal analysis, the problem of long positioning of wheat colloid sheath was solved, and rapid and accurate identification of alkali-resistant traits was achieved, improving wheat breeding efficiency and reducing costs.

CN120174148BActive Publication Date: 2025-08-08LUDONG UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510648461.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-20
Publication Date
2025-08-08
Estimated Expiration
2045-05-20

AI Technical Summary

Technical Problem

In the prior art, there are few studies on the long positioning of wheat dregs under alkali stress, which leads to difficulty in identifying alkali-resistant traits in wheat breeding, affecting breeding efficiency and cost.

Method used

KASP-2A, a molecular marker closely linked to the length of the colloid sheath under wheat alkali stress, was developed, and PCR amplification was performed using the KASP marker primer set to judge the genotype of the wheat variety through fluorescence signal analysis, and quickly identify whether there are genes that increase the length of the colloid sheath.

Benefits of technology

It has achieved rapid and accurate identification of long traits of long traits of wheat varieties under alkaline stress, reducing the workload of phenotype identification, improving breeding efficiency and saving costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174148B_ABST
    Figure CN120174148B_ABST
Patent Text Reader

Abstract

The present invention discloses a molecular marker tightly linked to wheat coleoptile length under alkaline stress and its application, belonging to the field of wheat molecular biotechnology and breeding technology. The molecular marker is KASP-2A, which can be amplified by two forward primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 and a rear primer shown in SEQ ID NO: 3. The molecular marker KASP-2A is tightly linked to the single nucleotide polymorphism (SNP) site AX-108780339, which is located on wheat chromosome 2A and has a physical position of 700893662 in the Chinese Spring reference genome sequence RefSeq v2.1, with a genotype of A / G. The present invention is beneficial in that the molecular marker KASP-2A can quickly and accurately determine whether a wheat variety (line) has a QTL related to coleoptile length under alkaline stress.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a molecular marker and an application thereof, in particular to a molecular marker tightly linked to wheat coleoptile length under alkali stress and an application thereof in wheat assisted breeding and genetic improvement, belonging to the field of wheat molecular biotechnology and breeding technology. Background Art

[0002] Land salinization, as one of the abiotic stresses that affects the normal growth and development of crops, has a significant impact on wheat yield and quality. Soil alkalinization can cause adverse stress on plants, disrupting their internal homeostasis and causing nutrient deficiency symptoms, wilting, and even death. Wheat is more sensitive to stress during the budding stage than at other stages. Growth and development during the budding stage can affect subsequent growth stages and ultimately yield. Wheat alkali tolerance is a quantitative trait controlled by multiple genes, and the mechanism of alkali tolerance is complex. Discovering new alkali-tolerant genetic loci in wheat and its related species and applying them to breeding has become the most economical, effective, and safe method for breeding alkali-tolerant wheat varieties.

[0003] As an embryonic structure unique to monocots, the coleoptile plays a key morphological protective role during seed germination. Studies have shown that wheat varieties that grow well under stress exhibit more stable coleoptile length. This length can be used as a criterion for identifying alkali tolerance during the germination period. Wheat coleoptile length is a quantitative trait controlled by multiple genes, with a relatively complex genetic background and significant environmental influences. Therefore, understanding the genetic basis of wheat coleoptile length, its growth regulatory mechanisms, and the application of molecular markers have become key research areas for wheat genetic improvement and breeding. Genome-wide association studies (GWAS) systematically identify quantitative trait loci (QTLs) significantly associated with target traits by scanning natural populations for genome-wide molecular markers and integrating them with multi-environment phenotypic data for modeling. These studies have become a core strategy for dissecting the genetic architecture of complex agronomic traits. GWAS, based on the principle of linkage disequilibrium, can not only reveal the allelic variation of major genes but also analyze the additive effects of minor polygenes, offering significant advantages for in-depth exploration of crop genetic resources and molecular design breeding.

[0004] There are a lot of research reports on the growth and physiological response mechanism of coleoptiles, but there are few reports on the growth positioning of wheat coleoptiles under alkaline stress. Summary of the Invention

[0005] The purpose of the present invention is to provide a molecular marker tightly linked to the coleoptile length of wheat under alkali stress and its application, and to detect whether wheat varieties (lines) have genes that increase coleoptile length by obtaining the molecular marker tightly linked to the coleoptile length of wheat under alkali stress, so as to accelerate the breeding process of new high-yield wheat varieties.

[0006] In order to achieve the above objectives, the present invention adopts the following technical solutions:

[0007] A molecular marker tightly linked to wheat coleoptile length under alkali stress is disclosed. The molecular marker is KASP-2A, which can be amplified by two forward primers represented by SEQ ID NO: 1 and SEQ ID NO: 2 and one rear primer represented by SEQ ID NO: 3. The molecular marker KASP-2A is tightly linked to the SNP site AX-108780339, which is located on wheat chromosome 2A, has a physical position of 700893662 in the Chinese Spring reference genome sequence RefSeq v2.1, and has a genotype of A / G.

[0008] The application of the aforementioned molecular marker KASP-2A, which is tightly linked to wheat coleoptile length under alkali stress, in identifying the wheat coleoptile length trait and in breeding wheat with a gene for increasing coleoptile length.

[0009] The present invention is beneficial in that:

[0010] (1) The molecular marker KASP-2A provided by the present invention can quickly and accurately determine whether a wheat variety (line) has a QTL related to sheath length under alkaline stress, providing an excellent gene resource and selection tool for molecular breeding of wheat yield traits;

[0011] (2) The molecular marker KASP-2A provided by the present invention is used in wheat molecular breeding, which can greatly reduce the workload of phenotypic identification and can be used in the wheat bud stage, thus saving breeding costs and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the genotyping result of 96 random wheat accessions based on the molecular marker KASP-2A, where red indicates GG, black indicates no signal detected, purple indicates a signal but no clear typing, and blue indicates AA;

[0013] Figure 2 This is a graph showing the results of a single marker analysis of coleoptile length for all 305 wheat samples based on the molecular marker KASP-2A. *** indicates extremely significant differences (P<0.001). DETAILED DESCRIPTION

[0014] The present invention will be described in detail below with reference to the accompanying drawings and embodiments.

[0015] 1. Hydroponic culture and phenotypic identification of natural populations in different experimental environments

[0016] Thirty seeds with full grains were selected from each line of a natural wheat population (305 samples) and evenly arranged.

[0017] Hydroponic cultivation was performed under alkali treatment (0.15 wt% Na₂CO₃) and control conditions (deionized water) at 23°C with a 16-h / 8-h light / dark cycle. Coleoptile length (SHL) was measured on day 8. This experiment was repeated three times, with the three replicates under alkali treatment designated as Environment E1, Environment E2, and Environment E3.

[0018] Method for measuring coleoptile length: Use a ruler with an accuracy of 0.01 cm to measure the length of wheat seeds from the base of the coleoptile to the top of the coleoptile. Measure 10 plants for each line and take the average value.

[0019] 2. Obtaining SNP sites

[0020] The six groups of coleoptile length phenotypic values obtained from a natural wheat population (305 accessions) under control conditions and alkali treatments were used to calculate the best linear unbiased estimator (BLUE) of each trait under three replicates of control conditions and alkali treatments using the R package lme4.

[0021] Based on the natural population 55K chip, genome-wide association analysis was performed using the BLINK model of the R package GAPIT. The results showed that under alkali treatment, a SNP site significantly associated with coleoptile length was detected on wheat chromosome 2A. It was stably detected in the three environments of E1, E2, and E3. Compared with the Chinese Spring reference genome sequence RefSeq v2.1, the SNP site was AX-108780339, located on wheat chromosome 2A, with a physical position of 700893662 and a genotype of A / G. P - Values are shown in Table 1.

[0022] Table 1 Results of genome-wide association analysis of AX-108780339

[0023]

[0024] Note: ** indicates P <0.01, * indicates P <0.05.

[0025] 3. Develop molecular markers and design corresponding primers

[0026] Today, competitive allele-specific PCR (KASP) molecular marker-assisted selection breeding can select for target traits at the DNA level, which not only produces stable results and reduces the cost of phenotypic evaluation, but also improves wheat breeding efficiency.

[0027] To further validate and utilize the previously identified SNP site (AX-108780339) and develop KASP markers, a KASP marker primer set was designed using the Wheat Alliance based on the AX-108780339 site variation and the Chinese spring wheat reference genome sequence RefSeq v2.1. The KASP marker primer set consists of two forward primers (Allele X and Allele Y) and one back primer (Common), including:

[0028] Allele X is a single-stranded DNA molecule with the following nucleotide sequence:

[0029] GAAGGTGACCAAGTTCATGCTGCCGATGCAGTTCACTATCCT (SEQ ID NO: 1);

[0030] Allele Y is a single-stranded DNA molecule with the following nucleotide sequence:

[0031] GAAGGTCGGAGTCAACGGATTCCGATGCAGTTCACTATCCC (SEQ ID NO: 2);

[0032] Common is a single-stranded DNA molecule with the following nucleotide sequence:

[0033] CCCATATGTGAGCTGCACTTGGTTA (SEQ ID NO: 3).

[0034] 4. Genotyping of natural wheat populations using the molecular marker KASP-2A

[0035] 1. PCR amplification

[0036] PCR amplification was performed using the genomic DNA of 305 wheat varieties as templates using the aforementioned KAPS marker primer set (Allele X, Allele Y, and Common). The PCR reaction system and PCR amplification procedure are as follows:

[0037] PCR reaction system: 0.8 μL DNA template, 0.8 μL 2× KASP Master Mix, and 0.022 μL KASP Assay Mix. KASP Assay Mix was prepared as follows: 12 μL of 100 μM Allele X, 12 μL of 100 μM Allele Y, and 30 μL of 100 μM Common, then bring the volume to 100 μL with 10 mM Tris-HCl.

[0038] PCR amplification program: heat activation at 95°C for 15 min; denaturation at 95°C for 20 s, annealing and extension at 65-55°C for 60 s, 10 cycles, decreasing the temperature by 0.6°C per cycle; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, 30 cycles.

[0039] 2. Fluorescence signal scanning and analysis

[0040] The fluorescence signal of the PCR amplification product of the wheat to be tested was collected using a multifunctional microplate reader (PHERAstar, MG LABTECH, Germany). The fluorescence signal was analyzed using SNPviewer. The genotype of the wheat to be tested at the AX-108780339 locus was determined based on the analysis results of the software (red / blue / purple / black). The specific determination method is as follows:

[0041] (i) If the software analysis result is red, the genotype of the wheat to be tested at the AX-108780339 locus is GG;

[0042] (ii) If the software analysis result is blue, the genotype of the wheat to be tested at the AX-108780339 locus is AA;

[0043] (iii) If the software analysis result is purple, it means there is a signal but no clear classification;

[0044] (iv) If the analysis result of the software is black, it means that no signal is detected.

[0045] 96 wheat varieties (lines) were randomly selected from 305 wheat varieties and the genotyping results based on the molecular marker KASP-2A are shown in Figure 1 The results showed that the genotyping results based on the molecular marker KASP-2A were good.

[0046] In addition, comparison found that the genotyping results based on the molecular marker KASP-2A were consistent with the genotyping results based on the wheat 55K chip, indicating that the KASP marker (KASP-2A) was successfully developed and can be further used in breeding material detection.

[0047] 5. Association analysis between molecular marker KASP-2A and coleoptile length

[0048] In three replicates under alkali treatment, 305 accessions of wheat natural population were genotyped using molecular marker KASP-2A, and the differences in coleoptile length between different genotypes were analyzed. The results of single marker analysis of coleoptile length based on molecular marker KASP-2A in 305 accessions in three replicates are shown in Figure 2 .

[0049] The results showed that the GG genotype could significantly increase the coleoptile length compared with the AA genotype, and this result was verified in three replicates under alkali treatment.

[0050] The above results prove that the molecular marker KASP-2A is a molecular marker tightly linked to wheat coleoptile length and can be effectively used in the molecular marker-assisted selection breeding program for wheat coleoptile length.

[0051] It should be noted that the above embodiments are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. A person skilled in the art would be able to make other variations or modifications based on the above description. It is not possible to enumerate all embodiments here. Any obvious variations or modifications arising from the technical solution of the present invention remain within the scope of protection of the present invention.

Claims

1. Use of a molecular marker tightly linked to wheat coleoptile length under alkali stress in identifying wheat coleoptile length traits or breeding wheat with a gene for increasing coleoptile length, characterized in that: The molecular marker is KASP-2A, which can be amplified by two forward primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 and one rear primer shown in SEQ ID NO:

3. The molecular marker KASP-2A is tightly linked to the SNP site AX-108780339. The SNP site AX-108780339 is located on wheat chromosome 2A, has a physical position of 700893662 in the Chinese Spring reference genome sequence RefSeq v2.1, and has a genotype of A / G.