An mRNA vaccine and its construction method

Abstract

This application belongs to the field of biotechnology and discloses an mRNA vaccine, which is an mRNA vaccine encapsulated with LNP. The mRNA is designed based on the gene sequence of the avian influenza H5N6 strain. The mRNA vaccine disclosed in this application is an mRNA vaccine obtained by LNP encapsulation. Encapsulation allows the vaccine to more accurately reach its site of action. At the same time, the mRNA part of the vaccine is designed based on the gene sequence of the avian influenza H5N6 strain. Furthermore, this application found through challenge tests that the mRNA vaccine not only has good humoral immunity but also good cellular immunity.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to an mRNA vaccine and a method for constructing the same. Background Technology

[0002] Avian influenza is a zoonotic disease caused by influenza A viruses. Based on viral pathogenicity, it can be divided into highly pathogenic and low pathogenic avian influenza. Highly pathogenic avian influenza is mainly caused by H5 and H7 subtypes of AIV, leading to high morbidity and mortality rates in animals, causing significant harm to the poultry industry. The H5 subtype of AIV continues to evolve and recombine. Since 2014, the H5N6 subtype strain has gradually become dominant. Currently, the main evolutionary branches of the H5 subtype avian influenza virus are 2.3.4.4b and 2.3.4.4h. mRNA vaccines introduce mRNA containing encoding antigen proteins into the body, where it is directly translated to form the corresponding antigen proteins, thereby inducing a specific immune response and achieving a preventative immunization effect.

[0003] Chinese patent application 202310509346.3 discloses an avian influenza virus mRNA vaccine, its preparation method, and its application. The mRNA vaccine includes a T7 promoter, a 5' untranslated region, a codon-optimized HA antigen-encoding gene, a 3' untranslated region, and a polyadenylate; wherein the amino acid sequence encoded by the codon-optimized HA antigen-encoding gene is shown in SEQ ID NO. 7 and / or SEQ ID NO. 10.

[0004] Animal studies in this protocol showed that the avian influenza mRNA vaccine has a good protective effect against avian influenza strains. Individual administration of the mRNA vaccine provides 100% protection against heterologous avian influenza strains. Furthermore, sequential immunization using the mRNA vaccine and the HA subunit vaccine in this protocol demonstrated that sequential immunization is as effective as individual immunization with the mRNA vaccine. Further observation of paragraph 94 of the protocol's instructions reveals that the strain and vaccine used in this protocol are both the H5 subtype avian influenza virus A / chicken / Guangdon g / D889 / 2015(H5N1) strain. However, this protocol did not verify its cellular immunity capabilities.

[0005] The problem this application aims to solve is: how to provide an mRNA vaccine that can activate multiple immune pathways. Summary of the Invention

[0006] The purpose of this application is to provide an mRNA vaccine for immunizing against H5N6 avian influenza, which not only has good humoral immunity but also excellent cellular immunity.

[0007] To achieve the above objectives, this application discloses an mRNA vaccine, wherein the mRNA vaccine is an mRNA vaccine encapsulated with LNP;

[0008] Furthermore, the mRNA portion of the mRNA vaccine was designed using the gene sequence of the avian influenza H5N6 strain.

[0009] Preferably, the mRNA portion is designed based on the gene sequence of the 2, 3, 4, and 4h branch strains of avian influenza H5N6.

[0010] Preferably, the preparation process of the mRNA moiety includes the following steps:

[0011] Step 1: Codon optimization was performed on the gene sequence of the 2, 3, 4, and 4h branch strains of avian influenza H5N6 to obtain Sequence 1, the nucleotide sequence of which is shown in SEQ ID NO: 1;

[0012] Step 2: Using human β-globin as the 5'UTR and two tandem human β-globins as the 3'UTR, synthesize with the sequence obtained in step 1 and ligate it into the plasmid to obtain a plasmid carrying sequence 1.

[0013] Step 3: Linearize the plasmid obtained in Step 2 into a DNA fragment, followed by in vitro transcription, capping, and tailing reactions to obtain the mRNA portion. The nucleotide sequence of the mRNA portion is shown in SEQ ID NO: 2.

[0014] Preferably, in the in vitro transcription process of step 3, all uracil in the mRNA portion is replaced with pseudouracil.

[0015] Preferably, the LNP is prepared by mixing ionizable lipids, phospholipids, PEGylated lipids, and steroid lipids;

[0016] The ionizable lipid is D-Link-MC3;

[0017] The phospholipid is selected from at least one of distearyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, and lauroyl phosphatidylcholine;

[0018] The PEGylated lipid is selected from at least one of dimyristoylglycerol-polyethylene glycol, distearylglycerol-polyethylene glycol, distearylphosphatidylethanolamine-polyethylene glycol, and dimyristoylamino-polyethylene glycol;

[0019] The steroid lipids are selected from at least one of cholesterol, stigmasterol, campesterol, and β-sitosterol.

[0020] Preferably, the molar ratio of the ionizable lipids, phospholipids, PEGylated lipids, and steroid lipids is 45-55:8-12:1-2:35-40.

[0021] In addition, this application also discloses a method for constructing the above-mentioned mRNA vaccine, which involves designing an mRNA portion using the gene sequence of the avian influenza H5N6 strain, and then encapsulating the mRNA portion using LNP to obtain the mRNA vaccine.

[0022] The beneficial effects of this application are as follows: The mRNA vaccine disclosed in this application is an mRNA vaccine obtained through LNP encapsulation. Encapsulation allows the vaccine to more precisely reach its target site. Furthermore, the mRNA portion of this vaccine is designed based on the gene sequence of the avian influenza H5N6 strain. Moreover, this application has found through challenge tests that this mRNA vaccine not only possesses good humoral immunity but also induces CD4+. + T cells, CD8 + T cell expression and CD4 + and CD8 + Cellular immunity co-expressed by T cells. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the structure of mRNA;

[0024] Figure 2 Electrophoresis diagram of linearized plasmid;

[0025] Figure 3 This is a Western blot (WB) result image of transfected 293T cells. Figure 3 M stands for Marker. Figure 3 1 is a positive control. Figure 3 2 is a negative control. Figure 3 Sample 3 in the middle is an mRNA sample;

[0026] Figure 4 This is a WB result image of DF-1 transfected cells; Figure 4 M stands for Marker. Figure 4 1 is a negative control. Figure 4 2 is a positive control. Figure 4 Sample 3 in the middle is an mRNA sample;

[0027] Figure 5 The image shows the results of mRNA transfection of 293T cells in the IFA test;

[0028] Figure 6 This is a diagram showing the results of mRNA transfection of DF-1 cell samples in the IFA test;

[0029] Figure 7 This serves as a negative control in the IFA test.

[0030] Figure 8The image shows the particle size distribution results of the mRNA-LNP complex.

[0031] Figure 9 CD3+ levels were observed in the PBS group, commercial vaccine group, and 225-LNP group (mRNA-LNP) on day 14. + / C D4 + Horizontal comparison chart;

[0032] Figure 10 CD3+ levels were observed in the PBS group, commercial vaccine group, and 225-LNP group (mRNA-LNP) on day 14. + / CD8α + Horizontal comparison chart;

[0033] Figure 11 CD4 counts in the PBS group, commercial vaccine group, and 225-LNP group (mRNA-LNP) on day 14 + / CD8α + Horizontal comparison chart;

[0034] Figure 12 CD3+ in the PBS group, commercial vaccine group, and 225-LNP group (mRNA-LNP) on day 21 + / CD4 + Horizontal comparison chart;

[0035] Figure 13 CD3+ in the PBS group, commercial vaccine group, and 225-LNP group (mRNA-LNP) on day 21 + / CD8α + Horizontal comparison chart;

[0036] Figure 14 CD4 counts in the PBS group, commercial seedling group, and 225-LNP group (mRNA-LNP) on day 21 + / CD8α + Horizontal comparison chart;

[0037] Figure 15 CD3 counts in the PBS group, commercial seedling group, and 225-LNP group (mRNA-LNP) on day 28 + / CD4 + Horizontal comparison chart;

[0038] Figure 16 CD3 counts in the PBS group, commercial seedling group, and 225-LNP group (mRNA-LNP) on day 28 + / CD8α + Horizontal comparison chart;

[0039] Figure 17 CD4 counts in the PBS group, commercial seedling group, and 225-LNP group (mRNA-LNP) on day 28+ / CD8α + Horizontal comparison chart;

[0040] Figure 18 This is a schematic diagram of pathological sections from the PBS group.

[0041] Figure 19 for Figure 18 A magnified view of a portion of the image;

[0042] Figure 20 This is a schematic diagram of pathological sections of a commercial vaccine group.

[0043] Figure 21 for Figure 20 A magnified view of a portion of the image;

[0044] Figure 22 This is a schematic diagram of pathological sections from the mRNA-LNP vaccine group.

[0045] Figure 23 for Figure 22 A magnified view of a portion of the image. Detailed Implementation

[0046] The present invention will now be clearly and completely described in conjunction with embodiments thereof. It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0047] The raw material information during the experiment is as follows:

[0048] H5N6 subtype 2, 3, 4, and 4h branch strains: preserved and provided by the Key Laboratory of Infectious Diseases, College of Veterinary Medicine, South China Agricultural University;

[0049] PUC57 plasmid: purchased from Suzhou Hongxun Biotechnology Co., Ltd.;

[0050] M13-47: Synthesized by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.;

[0051] mRNA-R: synthesized by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.;

[0052] HEK-293T cells: preserved and provided by the Key Laboratory of Infectious Diseases, College of Veterinary Medicine, South China Agricultural University; DF-1 cells: preserved and provided by the Key Laboratory of Infectious Diseases, College of Veterinary Medicine, South China Agricultural University.

[0053] Example 1

[0054] 1.1 Establishment of PUC57 plasmid

[0055] Influenza strains from the H5N6 subtype 2, 3, 4, and 4h branches were selected, and the HA fragment was sequenced and optimized to obtain sequence one (the nucleotide sequence of sequence one is shown in SEQ ID NO: 1).

[0056]

[0057] The 5'UTR uses a human β-globin sequence (the nucleotide sequence of the 5'UTR is shown in SEQ ID NO: 3), the 3'UTR uses two tandem human β-globin sequences (the nucleotide sequence of the 3'UTR is shown in SEQ ID NO: 4), the T7 promoter (shown in SEQ ID NO: 8) protects the bases (CGCC, GGG, CC, GTG; Kozak sequence (shown in SEQ ID NO: 9) BamHI restriction site: GGATCC, the sequence was synthesized by Suzhou Hongxun Biotechnology Co., Ltd. (the nucleotide sequence of the synthesized sequence is shown in SEQ ID NO: 5), and the synthesized sequence was ligated into the PUC57 plasmid.

[0058] T7 promoter (shown as SEQ ID NO: 8): TAATACGACTCACTATAGG

[0059] Protected bases: CGCC, GGG, CC, GTG

[0060] Kozak sequence (SEQ ID NO: 9): GCCACCATGG

[0061] BamHⅠ restriction site: GGATCC

[0062]

[0063] 1.2 Construction of mRNA

[0064] The plasmid was linearized into DNA fragments using M13-47 and mRNA-R primers (e.g., ...). Figure 2 As shown in the diagram, in vitro transcription, capping, and tailing reactions were performed using a kit, followed by purification to obtain mRNA (the nucleotide sequence of the mRNA is shown in SEQ ID NO: 2); the structural diagram of the mRNA is shown in the diagram. Figure 1 As shown.

[0065] The nucleotide sequence of M13-47 is shown in SEQ ID NO: 6; the nucleotide sequence of mRNA-R is shown in SEQ ID NO: 7.

[0066]

[0067] The nucleotide sequence of the 5'UTR (SEQ ID NO: 3): ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC;

[0068] Nucleotide sequence of 3'UTR (SEQ ID NO: 4): GCTCGCTTTCTTGCTGTCCAA TTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGA TATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTAT TTTCATTGC;

[0069] The nucleotide sequence of M13-47 (SEQ ID NO: 6): AGGGTTTTCCCAGTCACG;

[0070] The nucleotide sequence of mRNA-R (SEQ ID NO: 7): TGACCATGATTACGCCCAC GCAATG.

[0071] In vitro transcription: All uracil (U) was replaced with pseudouracil (Ψ) to prevent the host immune system from recognizing the unmodified mRNA, thereby treating it as exogenous RNA, inducing an inflammatory response, and interrupting mRNA translation. Linearized plasmids were transcribed in vitro using the Vazyme T7 High Yield RNA Transcription Kit. All components were kept on ice, and the configuration is shown in Table 1.

[0072] Table 1

[0073]

[0074] After gently mixing the preparation system and incubating at 37°C for 2 hours, add 1 μL of DNase I to the reaction system and incubate at 37°C for 15 minutes to digest the transcribed template, followed by purification.

[0075] Capping: Capping and methylation were performed using a kit from Vazyme. The required amount of in vitro transcribed RNA product was transferred to a 1.5 mL centrifuge tube, heated at 65°C for 5 min to open the 5' higher-order structure, and then the centrifuge tube was placed on ice for 5 min. The preparation system is shown in Table 2.

[0076] Table 2

[0077]

[0078] Incubate at 37°C for 1 hour; purify and measure product concentration.

[0079] Tailing: Tailing was performed using a kit from Vazyme. All components were placed on ice, and the preparation systems are shown in Table 3.

[0080] Table 3

[0081]

[0082]

[0083] Incubate at 37°C for 3 hours; purify and measure product concentration.

[0084] Purification: The lithium chloride purification method was used to remove protein and most of the free nucleotides. The operation steps are as follows:

[0085] (1) Dilute the product with 30 μL of DEPC water;

[0086] (2) Add 30 μL of lithium chloride precipitation solution (7.5 M lithium chloride, 50 mM EDTA) and incubate at -20 °C for 30 min;

[0087] (3) Centrifuge at 12000 rpm for 15 min and discard the supernatant;

[0088] (4) Add 500 μL of pre-cooled 70% ethanol to wash the RNA precipitate, centrifuge at 15000 rpm for 15 min at 4℃, discard the supernatant, and repeat three times.

[0089] (5) After drying for 2 minutes, add 40 μL of DEPC water to dissolve the RNA precipitate. Make sure it is completely dissolved until there are no clumps. Measure the RNA concentration.

[0090] 1.3 WB and IFA experiments to verify protein expression

[0091] The above mRNA products were transfected into HEK-293T cells and DF-1 cells, and the procedure was as follows:

[0092] (1) Cells were cultured in DMEM medium (containing 10% fetal bovine serum). When the cells were in good growth condition, the cells were diluted to 2×10⁶ cells / mL. 5 The cells were evenly seeded at 1 / mL into 6-well plates (the 6-well plates seeded with HEK-293T cells were pretreated with 1% poly-L-lysine) and incubated in a cell culture incubator at 37°C and 5% CO2.

[0093] (2) After approximately 24 hours, when the cell density reaches 80%–90%, refer to Lipofectamine. TMAccording to the 2000Reagent instructions, add mRNA and transfection reagent in a 1:2 ratio, mix thoroughly, and incubate at room temperature for 20 minutes.

[0094] During the process, the 6-well plate was washed twice with PBS, Opti-MEM was added, and after incubation, the mRNA-liposome complex was added to the 6-well plate and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 hours.

[0095] Western blot (WB) can be used to verify the protein expression level after transfection. The procedure is as follows:

[0096] (1) 24 h after transfection, discard the culture medium, wash 3 times with PBS, add RIPA cell lysis buffer, scrape the cells from the 6-well plate with a cell scraper, collect them into a 1.5 mL centrifuge tube, and incubate on ice for 30 min for complete lysis.

[0097] (2) Centrifuge at 12000 rpm for 10 min at 4℃, aspirate the supernatant into a new centrifuge tube, and determine the protein concentration;

[0098] (3) Mix the protein sample with 0.25 times the volume of 5×SDS loading buffer and incubate in a metal bath at 100°C for 5 min to fully denature it;

[0099] (4) Prepare polyacrylamide electrophoresis buffer, add sample, electrophore at 80V for 30 min, then adjust voltage to 120V and electrophore for 1 h.

[0100] (5) Prepare the transfer buffer, cut the gel to an appropriate size, transfer the protein blot onto a nitrocellulose membrane (NC membrane), and perform electrophoresis at 200mA for 1 hour;

[0101] (6) Remove the NC membrane and place it in an incubation box containing 5% BSA. Incubate on a shaker at room temperature for 2 hours.

[0102] (7) Wash with TBST 3 times, 5 min each time, and incubate with primary antibody at 4℃ for 14±2 h;

[0103] (8) Wash with TBST 3 times, 5 min each time, add secondary antibody and incubate for 1 h at room temperature on a shaker;

[0104] (9) Wash with TBST 3 times, 5 minutes each time, and scan with an imager.

[0105] The Western blot results of HEK-293T cells transfected with HEK-293T cells are as follows: Figure 3As shown, M is the marker, lane 1 is the positive control, lane 2 is the negative control, and lane 3 is the mRNA product. The theoretical size of the target protein is approximately 68 kDa. Lane 3 shows a clear band at around 70 kDa, but the actual result is larger, possibly due to chemical modification. The results verify that the prepared mRNA can successfully express the correct protein in HEK-293T cells.

[0106] WB test results of DF-1 transfected cells are as follows Figure 4 As shown, M is the marker, lane 1 is the negative control, lane 2 is the positive control, and lane 3 is the mRNA product. The theoretical size of the target protein is approximately 68 kDa. Lane 3 shows a clear band at around 70 kDa, but the actual result is larger, possibly due to chemical modification. The results verify that the prepared mRNA can successfully express the correct protein in DF-1 cells.

[0107] IFA can be used to verify protein expression after transfection. The procedure is as follows:

[0108] (1) 24 h after transfection, discard the culture medium, wash 3 times with PBS, and fix with 4% paraformaldehyde for 15 min.

[0109] (2) Wash 3 times with PBS, add 0.5% Triton X-100, and infiltrate at room temperature for 20 min;

[0110] (3) Wash with PBS 3 times, add 5% BSA blocking solution, and block at room temperature for 1 hour;

[0111] (4) Wash 3 times with PBS, add primary antibody diluted 1:500, and incubate at 4°C for 12-16 h;

[0112] (5) Wash with PBS 3 times, add the diluted secondary antibody, incubate at room temperature for 1 hour, and observe using a fluorescence inverted microscope;

[0113] refer to Figure 5-7 The mRNA was able to correctly express the protein in both 293T cells and DF1 cells.

[0114] 1.4 mRNA was encapsulated using LNPs to obtain mRNA-LNP.

[0115] Preparation of relevant solutions: 20× Citric Acid-Sodium Citrate Buffer: Weigh 13.762g of citric acid and 10.146g of sodium citrate and add them to 30mL of DEPC-treated water. After complete dissolution, continue adding DEPC-treated water to 50mL, mix well, and dispense. 1×TE Buffer: Add 12.1g of Tris and 0.37g of EDTA to 800mL of deionized water, dissolve completely, and bring the volume to 1L. Filter sterilize using a 0.22μm filter. Dilute with DEPC-treated water at a ratio of 1:19 to prepare 1×TE Buffer. TE Buffer containing 2% Triton X-100: Take 10mL of 1×TE Buffer, add 200μL of Triton X-100, and mix well.

[0116] (2) LNP preparation: Ionizable lipids D-Link-MC3-DMA and PEG-DMG were diluted to 100 mM with pharmaceutical grade anhydrous ethanol, and DSPC and cholesterol were dissolved to 10 mM with pharmaceutical grade anhydrous ethanol. They were mixed sequentially according to the molar ratio of D-Link-MC3: distearate phosphatidylcholine (DSPC): cholesterol: dimyristoylglycerol-polyethylene glycol (PEG-DMG) of 50:10:38.5:1.5. Finally, pharmaceutical grade anhydrous ethanol was added to dilute the mixture to a 20 mg / mL solution, which was dispensed into brown glass bottles and stored in a -20℃ refrigerator for later use.

[0117] (3) LNP encapsulation: After thawing the mRNA product on ice, dilute it with 20× citrate-sodium citrate buffer and DEPC water to make a solution with pH=4 and concentration of 1 mg / mL. Use a microfluidic system to advance the LNP and mRNA solution (aqueous phase: ethanol phase = 1:1) at a rate of 1.5 mL / min to prepare the mRNA-LNP complex. Add the complex to 10 times the volume of PBS, mix by inverting, and then add it to an ultrafiltration tube. Centrifuge using a horizontal rotor centrifuge at 2500 rpm for 10 min at room temperature. After centrifugation, discard the lower layer liquid until the concentration is up to the required amount. Finally, wash off the particles adhering to the membrane with PBS.

[0118] Particle size detection:

[0119] The particle size of the mRNA-LNP complex was determined using a Malvern Zetasizer Nano ZS90 nanoparticle size potentiometer. 1 μL of the complex was added to 1 mL of PBS and mixed thoroughly. The mixture was then placed in a quartz cuvette, placed in the instrument, and the parameters were adjusted for detection and data recording.

[0120] Test results are as follows Figure 8As shown, the peak value is between 200 and 300 d.nm, which means the particle size is between 200 and 300 d.nm.

[0121] Encapsulation rate testing:

[0122] Take a portion of the sample and divide it into two aliquots. One aliquot is diluted with 1×TE Buffer, and the other aliquot is diluted with TE Buffer containing 2% Triton X-100. Add the samples to black 96-well plates, with three replicates per sample. Add 100 μL of the solution to each well, and then add 1×RiboGreen solution at a 1:1 ratio to the wells containing the sample. Incubate at room temperature in the dark for 5 min. Set the excitation wavelength of the multi-mode microplate reader to 485 nm and the emission wavelength to 528 nm to measure the sample fluorescence. Record the measurement results, measure the total RNA and free RNA concentrations according to the standard curve, and calculate the encapsulation efficiency. The calculation formula is shown in Equation 1.

[0123]

[0124] In Equation 1, A represents the concentration of free RNA;

[0125] B represents the total RNA concentration;

[0126] According to calculations, the encapsulation rate is 83.4%.

[0127] 1.5 Conduct animal experiments with chickens.

[0128] Twenty-four 2-week-old SPF chickens were randomly divided into three groups of eight each: one group received a PBS vaccine, one group received a commercial H5+H7 trivalent inactivated vaccine, and the remaining group received a 25 μg mRNA-LNP vaccine. Each group received 0.3 mL of vaccine per chicken via intramuscular injection into the pectoral cavity. A booster immunization was administered two weeks after the initial immunization, followed by a challenge 2 weeks later with a challenge dose of 10 μg mRNA-LNP. 6 EID 50 / 0.1mL / bird, the challenge strain (A / duck / Shandong / 225 / 2023(H5N6)) was administered via nasal route. Morbidity and mortality were recorded 14 days after challenge, and the chickens were euthanized.

[0129] 1.6 Evaluation of Immunization Efficacy

[0130] Flow cytometry detection of CD3 in peripheral blood lymphocytes of chickens in each group + CD4 + Levels of CD3 in chicken peripheral blood lymphocytes + CD8α + Levels and CD4 levels in chicken peripheral blood lymphocytes + With CD8α + Coexistence level, test results as follows Figure 9-17 As shown;

[0131] refer to Figure 9-17 It can be seen that the single positive level (CD3) in the PBS group + CD4 + Horizontal or CD3 + CD8α + Level) and double positive level (CD4) + CD8α + The levels of immune cells fluctuated slightly over 2-4 weeks; therefore, the levels of immune cells in the PBS-injected group did not show a significant trend.

[0132] Further observation of the commercial seedling group revealed that its single-positive level (CD3) + CD4 + Horizontal or CD3 + CD8α + The CD4 level gradually increases over time, while the CD4 level (double positive) gradually increases. + CD8α + The level of seropositivity (SNS) showed a slight fluctuation. This indicates that, on the one hand, commercial vaccines can stimulate strong cellular immunity compared to the PBS group, but as time goes on, the level of double seropositivity becomes relatively stable.

[0133] Simultaneous observation of the mRNA-LNP group revealed that it not only showed an advantage over the vaccine group in terms of single seropositivity, but also exhibited a higher level of double seropositivity in the second week, even reaching nearly three times the level of the commercial vaccine. This demonstrates that mRNA-LNP can rapidly stimulate the body's double seropositivity level within a short period, and that the mRNA-LNP group can enhance CD4+ immunity over time. + CD8α + The state of coexistence remains at a high level;

[0134] It is evident that the mRNA-LNP group not only demonstrates an advantage over commercial vaccines at the single-positive level, but also at the double-positive level, especially in the short-term enhancement of double-positive levels. Therefore, mRNA-LNP can stimulate CD4+ activation in a short period of time. + CD8α + The coexistence of T cells in cellular immunity enables highly efficient cellular immunity through multiple pathways.

[0135] The serum neutralizing antibody titer was detected by the HI method, and the test results are shown in Table 4.

[0136] Table 4

[0137]

[0138] Results analysis:

[0139] As can be seen from Table 4, although the antibody titer of the LNP vaccine group was slightly weaker than that of the commercial vaccine group after the first immunization, the antibody titer showed a certain advantage after the second immunization.

[0140] It is evident that the humoral immunity of the LNP vaccine group is comparable to that of the commercial vaccine group, and that a second immunization provides even better humoral immunity.

[0141] On the third day after the viral challenge, nine chickens were euthanized, with three chickens in each group, and pathological sections were prepared to observe the pathological changes in the lungs.

[0142] refer to Figure 18-19 PBS group: The lung tissue parenchyma consists of various branches of the bronchi, atrial chambers, and respiratory capillaries. The respiratory capillaries are connected to the atrial chambers, and the flattened epithelial cells on their surface form the respiratory surface. The respiratory capillaries are surrounded by a large number of capillaries. Numerous bronchial hemorrhages are visible (yellow arrows); a small number of inflammatory cell foci are seen in the secondary bronchial mucosa (blue arrows); there is extensive atrial dilation (black arrows); occasional punctate necrosis (black arrows) with nucleus fragmentation; and vascular congestion is common (orange arrows). Figure 18 The black box in the middle indicates the zoomed-in view position;

[0143] refer to Figure 20-21 Commercial vaccine group: The lung tissue is composed of various branches of the bronchi, atrial chambers, and respiratory capillaries. The respiratory capillaries are connected to the atrial chambers, and the flattened epithelial cells on their surface form the respiratory surface. The respiratory capillaries are surrounded by a large number of capillaries. A small number of accessory bronchial hemorrhages can be seen (yellow arrows); a small number of inflammatory cell clusters can be seen in the primary bronchial mucosa (blue arrows); a small number of atrial dilations (black arrows); and vascular congestion is common (orange arrows). Figure 20 The black box in the middle indicates the zoomed-in view position;

[0144] refer to Figure 22-23 In the mRNA-LNP vaccine group: the lung tissue parenchyma consists of the various branches of the bronchi, atrial chambers, and respiratory capillaries. The respiratory capillaries are connected to the atrial chambers, and the flattened epithelial cells on their surface form the respiratory surface. The respiratory capillaries are surrounded by a large number of capillaries, and numerous atrial hemorrhages (yellow arrows) and extensive atrial dilation (black arrows) are visible. Vascular congestion is also common (orange arrows). Occasionally, inflammatory cell foci are seen around the atrial chambers (blue arrows). Figure 22 The black box in the middle indicates the zoomed-in view position;

[0145] In addition, all chickens in the PBS group died within 5 days after being challenged with SPF, while no chickens died in the commercial vaccine group or the mRNA-LNP vaccine group.

[0146] Meanwhile, anal and pharyngeal swabs were collected on days 3, 5, and 7 after the challenge, and chicken embryos were used for inoculation to detect whether there was in vitro virus shedding;

[0147] Oropharyngeal and cloacal swabs were collected from SPF chickens in the commercial vaccine group, mRNA-LNP vaccine group, and PBS group on days 3, 5, and 7 after further challenge infection. After processing, the swabs were inoculated into 9-11 day old chicken embryos to assess the in vitro virus shedding status of each group of SPF chickens. The test results showed that no virus shedding was detected in the commercial vaccine group and the mRNA-LNP vaccine group, while all surviving chickens in the PBS group showed virus shedding.

Claims

1. An mRNA vaccine, characterized in that, The mRNA part is designed according to the gene sequence of the avian influenza H5N6 strain, and then the mRNA part is encapsulated by LNP to obtain the mRNA vaccine; The preparation process of the mRNA part comprises the following steps: Step 1: codon optimization is performed on the gene sequence of the 2.3.4.4h branch strain of the avian influenza H5N6, to obtain sequence one, the nucleotide sequence of which is shown as SEQ ID NO: 1; Step 2: human beta globin is used as 5'UTR, and two tandem human beta globins are used as 3'UTR, and then sequence one obtained in step 1 is synthesized and connected to a plasmid to obtain a plasmid carrying sequence one; Step 3: the plasmid obtained in step 2 is linearized into a DNA fragment, and then in vitro transcription, capping and tailing reactions are performed to obtain the mRNA part, the nucleotide sequence of which is shown as SEQ ID NO: 2; In the in vitro transcription process of step 3, all uracils in the mRNA part are replaced with pseudo-uracils.

2. The mRNA vaccine according to claim 1, characterized in that, The LNP is prepared by mixing ionizable lipids, phospholipids, PEGylated lipids and steroid lipids; The ionizable lipid is D-Link-MC3; The phospholipid is at least one selected from the group consisting of distearoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine and lauroyl phosphatidylcholine; The PEGylated lipid is at least one selected from the group consisting of dimyristoylglycerol-polyethylene glycol, distearoylglycerol-polyethylene glycol, distearoyl phosphatidyl ethanolamine-polyethylene glycol and dimyristoyl amino-polyethylene glycol; The steroid lipid is at least one selected from the group consisting of cholesterol, stigmasterol, campesterol and beta-sitosterol; The molar ratio of the ionizable lipid, the phospholipid, the PEGylated lipid and the steroid lipid is 45-55:8-12:1-2:35-40.

Images