Application of targeted CCDC25 gene in preparation of medicine for preventing and treating tumor bone marrow metastasis related complications

Through drugs targeting the CCDC25 gene, especially the use of CCDC25 inhibitors and CRISPR/Cas9 technology, the problem of thrombocytopenia related to tumor bone marrow metastasis was solved, and the effect of improving hematopoietic function and platelet production was achieved.

CN120242017APending Publication Date: 2025-07-04SUN YAT SEN UNIVERSITY CANCER CENTER (CANCER HOSPITAL AFFILIATED TO SUN YAT SEN UNIVERSITY CANCER RESEARCH INSTITUTE OF SUN YAT SEN UNIVERSITY) +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510371565.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-27
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

The prior art has not yet effectively solved the complications related to tumor bone marrow metastasis, especially thrombocytopenia. The existing chemotherapy methods have the problem of myelosuppression, which limits the application of chemotherapy, and lacks targeted treatment methods for CCDC25.

Method used

Develop drugs targeting the CCDC25 gene, including CCDC25 inhibitors such as gRNA, shRNA, siRNA, miRNA, cDNA, antisense RNA/DNA, small molecule compounds and protein molecules, and knockout through CRISPR/Cas9 technology or the use of CCDC25 specific antibodies, inhibit the expression of CCDC25 to improve the hematopoietic function in the bone marrow.

Benefits of technology

It effectively improves thrombocytopenia caused by tumor bone marrow metastasis, protects the differentiation and maturation of hematopoietic stem cells to megakaryocytes by targeting the CCDC25 gene, reverses the inhibitory effect of neutrophil extracellular traps on megakaryocytes, and improves platelet generation ability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005331489950000041
    Figure BDA0005331489950000041
  • Figure BDA0005331489950000051
    Figure BDA0005331489950000051
  • Figure BDA0005331489950000061
    Figure BDA0005331489950000061
Patent Text Reader

Abstract

The invention discloses an application of a drug targeting a CCDC25 gene in preparation of a drug for preventing and / or treating tumor bone marrow metastasis related complications. The invention finds that CCDC25 is associated with the occurrence of tumor bone marrow metastasis related complications for the first time, and participates in the occurrence of tumor bone marrow metastasis related thrombocytopenia in the bone marrow metastasis process. After the CCDC25 is knocked out or subjected to targeted inhibition, differentiation of hematopoietic stem cells in bone marrow to megakaryocytes and the capability of mature megakaryocytes to generate platelets are effectively protected, which indicates that the knockout of the CCDC25 effectively improves thrombocytopenia caused by tumor bone marrow metastasis, which indicates that the CCDC25 can be used as a target for preventing and / or treating thrombocytopenia related to bone marrow metastasis. And the application value in research and development of medicines for treating thrombocytopenia related to bone marrow metastasis is great.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of medicine, and particularly to the use of a drug targeting the CCDC25 gene in the preparation of a drug for preventing and treating complications related to tumor bone marrow metastasis. Background Art

[0002] Bone marrow metastasis is a common advanced complication of various malignant tumors including breast cancer, lung cancer and lymphoma. Bone marrow metastasis can be accompanied by the appearance of various complications. Common bone marrow metastasis complications include osteolytic lesions at the metastatic site, neurological symptoms and various hematopoietic system disorders, among which thrombocytopenia that is difficult to correct has received the most attention.

[0003] Thrombocytopenia refers to a patient's circulating platelet count < 100×10 9 per L, which is one of the main causes of death in clinically advanced cancer patients. Advanced cancer patients often show severe thrombocytopenia that is difficult to be corrected by drugs. The decrease in the number and impaired function of platelets often lead to bleeding in multiple sites including the brain and lungs in cancer patients.

[0004] At present, there is no exact and effective diagnosis and treatment method for tumor bone marrow metastasis and its related complications. At present, the main clinical method is to use combination chemotherapy to remove metastatic tumors in the bone marrow and reconstruct the bone marrow microenvironment. However, common chemotherapy drugs represented by gemcitabine, platinum compounds and pyrimidine analogs often accompany severe bone marrow suppression, which limits the application of chemotherapy in bone marrow metastasis. In addition, researchers have also tried to use drugs such as denosumab to inhibit osteoclast activation and thus reduce the metastasis of tumors to bone and bone marrow. However, none of the above methods can effectively inhibit tumor bone marrow metastasis and reduce the occurrence of bone marrow metastasis-related complications, which limits the translation of the above methods to the clinic.

[0005] CCDC25 is a transmembrane protein located on the cell plasma membrane and is expressed in multiple organs. At present, there are few studies on CCDC25 in the fields of tumors and treatment-related organ damage. Summary of the Invention

[0006] Therefore, the purpose of the present invention is to provide the use of a drug targeting the CCDC25 gene in the preparation of a drug for preventing and / or treating complications related to tumor bone marrow metastasis.

[0007] In the first aspect of the present invention, there is provided the use of a drug targeting the CCDC25 gene in the preparation of a drug for preventing and / or treating complications related to tumor bone marrow metastasis.

[0008] As used herein, the term "treatment" means and includes improving, alleviating and / or therapeutic use and results, or any combination thereof.

[0009] As used herein, the term "prevention" does not refer to or require absolute or complete prevention (i.e., 100% prophylactic or protective use or result). As used herein, "prevention" refers to the administration of a compound or composition that reduces or lessens the severity of a specific disease, symptom, or disorder described herein; reduces or lessens the likelihood of experiencing a specific disease, symptom, or disorder described herein; or delays the onset or recurrence of a specific disease, symptom, or disorder described herein; or the use and result of any combination of the above.

[0010] In some embodiments of the present invention, the drug targeting the CCDC25 gene is a CCDC25 inhibitor.

[0011] In some embodiments of the present invention, the CCDC25 inhibitor is selected from at least one of gRNA, shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, small molecule compounds, and protein molecules.

[0012] In some embodiments of the present invention, the protein molecule is selected from at least one of peptides and antibodies.

[0013] In some embodiments of the present invention, the protein molecule is a CCDC25-specific antibody.

[0014] In some embodiments of the present invention, the CCDC25-specific antibody includes a CCDC25 neutralizing antibody.

[0015] In some embodiments of the present invention, the sequence of the gRNA is shown as at least one of SEQ ID NO: 1 to SEQ ID NO: 4.

[0016] In the present invention, gRNA is used in combination with CRRSPR / Cas9 to achieve the purpose of gene knockout.

[0017] Furthermore, the CCDC25 inhibitor further includes a gRNA used when knocking out the CCDC25 gene in the animal cell or in the animal body by using the CRISPR / Cas9 technology, or a DNA molecule capable of transcribing the gRNA, or an expression cassette, an expression vector, or a recombinant cell containing the DNA molecule. Of course, it may also include the Cas9 protein or an expression vector for expressing the Cas9 protein.

[0018] Tumor bone marrow metastasis refers to a tumor-related disease mainly manifested by hematopoietic dysfunction caused by malignant tumors originating from tissues outside the bone marrow metastasizing to the bone marrow through blood circulation and other pathways. The main difference from bone metastasis is that its metastatic lesions often colonize in the medullary cavity, and its prominent complication is mainly hematopoietic dysfunction rather than the osteoporosis manifestation often accompanied by bone metastasis. Clinically common malignant tumors prone to bone marrow metastasis include prostate cancer, breast cancer, lung cancer, kidney cancer, rectal cancer, pancreatic cancer, gastric cancer, colon cancer, ovarian cancer, etc. Bone marrow metastasis often occurs in the early stage of the malignant tumor course and has a significant negative impact on the prognosis of tumor patients.

[0019] In some embodiments of the present invention, the tumor bone marrow metastasis-related complications include thrombocytopenia.

[0020] In some embodiments of the present invention, the drug further comprises a pharmaceutically acceptable excipient.

[0021] In some embodiments of the present invention, the pharmaceutically acceptable excipients include, but are not limited to, fillers, binders, lubricants, solvents, disintegrants, buffers, preservatives, solubilizers, surfactants, and osmotic pressure regulators.

[0022] In a second aspect of the present invention, there is provided a drug for preventing and / or treating tumor bone marrow metastasis-related complications, the drug comprising at least one of the gRNAs shown in SEQ ID NO: 1 to SEQ ID NO: 4, a DNA molecule encoding the gRNA, or an expression cassette, expression vector, or recombinant cell containing the DNA molecule.

[0023] In some embodiments of the present invention, the drug further comprises Cas9 protein.

[0024] In some embodiments of the present invention, the prevention and / or treatment includes:

[0025] (i) improving the differentiation of hematopoietic stem cells in the bone marrow into megakaryocytes;

[0026] (ii) improving the ability of mature megakaryocytes to produce platelets;

[0027] (iii) reversing the inhibitory effect of neutrophil extracellular traps (NET) on megakaryocyte differentiation and maturation; and

[0028] (iv) reversing the inhibitory effect of neutrophil extracellular traps (NET) on platelet production.

[0029] Neutrophil extracellular traps (NETs) can promote the metastatic spread of tumors in vivo through multiple mechanisms. Multiple factors, including surgery and infection, can induce NET formation and thus promote tumor metastasis to target organs. In the absence of infection or surgical intervention, tumor cells also have the ability to induce NET production.

[0030] In a third aspect of the present invention, there is provided the use of the CCDC25 gene as a drug target in screening drugs for preventing and / or treating complications related to tumor bone marrow metastasis; the drug is a drug that inhibits the expression of the CCDC25 gene, the drug has the function of preventing and / or treating complications related to tumor bone marrow metastasis, and the use is non-diagnostic and non-therapeutic.

[0031] In some embodiments of the present invention, the use includes screening of drug targets, screening of drugs, pharmacodynamic evaluation of drugs, and safety evaluation of drugs.

[0032] In some embodiments of the present invention, the complications related to tumor bone marrow metastasis include thrombocytopenia.

[0033] The beneficial effects of the present invention are as follows:

[0034] The present invention for the first time discovers that CCDC25 is associated with the occurrence of complications related to tumor bone marrow metastasis, and it is involved in the occurrence of thrombocytopenia related to tumor bone marrow metastasis during the process of bone marrow metastasis. After knocking out or targeting and inhibiting CCDC25, the differentiation of hematopoietic stem cells into megakaryocytes in the bone marrow and the ability of mature megakaryocytes to produce platelets are effectively protected, indicating that knocking out CCDC25 effectively improves thrombocytopenia caused by tumor bone marrow metastasis, suggesting that CCDC25 can be used as a target for preventing and / or treating thrombocytopenia related to bone marrow metastasis, and by targeting CCDC25, the effect of preventing and / or treating thrombocytopenia related to bone marrow metastasis can be achieved, which has great application value for the drug research and development of thrombocytopenia related to bone marrow metastasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The above and / or additional aspects and advantages of the present invention will become apparent and be readily understood from the following description of the embodiments in conjunction with the accompanying drawings, wherein:

[0036] Figure 1 Showing the effect of a drug or treatment method targeting CCDC25 in treating megakaryocytic thrombocytopenia caused by NETs; wherein Figure 1 A shows the effect of using a CCDC25 polyclonal neutralizing antibody to treat CCDC25 - / - mouse bone marrow intervened by NETs in inducing megakaryocyte formation in vitro; Figure 1 B shows the effect of using a CCDC25 polyclonal neutralizing antibody to treat CCDC25- / - Effect of mouse bone marrow on the proportion change of proplatelet-like structures (PPFs); Figure 1 C shows the role of using CCDC25 polyclonal neutralizing antibody to treat NET-intervened human bone marrow hematopoietic stem cells in vitro in inducing the differentiation of hematopoietic stem cells and improving the platelet-producing ability of mature megakaryocytes; Figure 1 D shows the effect of CCDC25 on megakaryopoiesis in the bone marrow cavity of mice in breast cancer bone metastasis. Detailed implementation manners

[0037] The concept of the present invention and the technical effects generated will be clearly and completely described below in conjunction with the embodiments to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts shall fall within the scope of protection of the present invention.

[0038] In addition, in order to better illustrate the present invention, numerous specific details are given in the following detailed implementation manners. Those skilled in the art should understand that the present invention can also be implemented without some specific details. In some embodiments, the raw materials, methods, means, etc. well-known to those skilled in the art are not described in detail to highlight the gist of the present invention.

[0039] The experimental materials and instrument information involved in the specific embodiments are as follows:

[0040] 1. Experimental animals

[0041] The experimental animals used in the following embodiments: wild-type mice were purchased from Guangdong Jicui Yakang Biotechnology Co., Ltd.; the breeding, reproduction, and use of mice followed the regulations of the Experimental Animal Management Committee of Sun Yat-sen University, and the relevant facilities have passed the international experimental animal AAALAC certification.

[0042] Example 1: Construction of CCDC25-eKO1 gene knockout mice

[0043] The construction method of CCDC25-eKO1 gene knockout mice has been recorded in the patent application of invention with publication number CN118717987A. The construction steps are as follows:

[0044] Name of the knocked-out gene (MGI number): CCDC25 (MGI: 1914429);

[0045] MGI website link of the knocked-out gene: http: / / www.informatics.jax.org / marker / MGI:1914429;

[0046] Knockout gene name (Ensembl): CCDC25 (ENSMUSG00000022035);

[0047] Knockout gene Ensembl website link: http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?db=core;g=ENSMUSG00000022035;r=14:65837302-65866604;t=ENSMUST00000022614;

[0048] Knockout target transcript (Ensembl ID): CCDC25-201 (ENSMUST00000022614.6);

[0049] Knockout target exon: exon 3;

[0050] 1) gRNA preparation: The sequences are shown in Table 1 below:

[0051] Table 1

[0052]

[0053]

[0054] 2) Genotyping of F0 generation mice

[0055] F0 generation mice were obtained by microinjection of fertilized eggs, and then the genotypes of F0 generation mice were identified by PCR.

[0056] The primer information is shown in Table 2 below:

[0057] Table 2

[0058] Primer Sequence (5'-3') Primer type P1 CGAACTCTTGGCAGGTCTGT (SEQ ID NO: 5) Forward P2 ATGCCCATTGGAGCCATGAA (SEQ ID NO: 6) Reverse

[0059] The reaction system is shown in Table 3 below:

[0060] Table 3

[0061] Reaction system Volume (μl) <![CDATA[ddH2O]]> 8 2×PCR Buffer 10 Primer P1 (10 pmol / μl) 0.5 Primer P2 (10 pmol / μl) 0.5 Genomic DNA 1 Total amount 20

[0062] 2×PCR Buffer: 2×Phanta Max Master Mix (Vazyme, Code No: P515-03)

[0063] The reaction conditions are shown in Table 4 below:

[0064] Table 4:

[0065] Step # Temperature (°C) Time Remarks 1 95 3 min - 2 95 15 sec - 3 61 15 sec - 4 72 1 min Repeat steps 2 - 4 for 35 cycles 5 72 5 min - 6 12 - Maintain temperature

[0066] Finally, F0 generation mice were obtained. The sequence of wild-type mice is as shown in SEQ ID NO: 9, and the sequence of mutant mice is as shown in SEQ ID NO: 10. The mutant type lacks 631 base pairs and inserts 1 base pair compared with the wild type.

[0067] 3) Obtaining F1 generation mice and genotyping

[0068] Positive F0 generation mice were selected to mate with wild-type C57BL / 6J mice, and the obtained F1 generation heterozygous mice were genotyped. The genotyping method was the same as that of F0 generation mice.

[0069] 4) Expansion of experimental mice

[0070] The obtained gene knockout heterozygous mice (CCDC25 + / - ) were divided into two parts: one part of the heterozygous mice mated with wild-type mice to expand the population and breed more heterozygous mice; one part of the heterozygous mice self-crossed, and gene knockout homozygous mice (CCDC25 + / - ) were obtained through PCR identification for verifying the gene knockout effect and subsequent phenotype analysis.

[0071] The primers used for PCR identification are shown in Table 5 below:

[0072] Table 5

[0073] Primer Sequence (5'-3') P1 CGAACTCTTGGCAGGTCTGT (SEQ ID NO: 5) P2 ATGCCCATTGGAGCCATGAA (SEQ ID NO: 6) P3 TCTATCTACCTGCTGCCTAT (SEQ ID NO: 7) P4 TGTATTGACACTTGGCAGTT (SEQ ID NO: 8)

[0074] The reaction system is shown in Table 6 below:

[0075] Table 6

[0076]

[0077] The reaction program is shown in Table 7 below:

[0078] Table 7

[0079]

[0080] For wild-type mice (WT): A single 1675bp fragment was obtained by PCR with P1 and P2; A 310bp fragment could be obtained with P3 and P4; For heterozygous mice (CCDC25 + / - ): Two fragments of 1045bp and 1675bp were obtained by PCR with P1 and P2; A 310bp fragment could be obtained with P3 and P4; For homozygous mice (CCDC25 - / - ): A single 1045bp fragment was obtained by PCR with P1 and P2; No band could be obtained with P3 and P4.

[0081] Example 2: Role of targeting CCDC25 gene in treating megakaryocytic thrombocytopenia caused by NETs

[0082] Preparation of mouse-derived NETs: C57BL / 6J mice aged 5 - 8 weeks were euthanized and the lower limbs of the mice were separated to collect mouse bone marrow cells. The bone marrow cells were resuspended in complete medium and phorbol 12-myristate 13-acetate (PMA, Merck, Cat#P8139-1MG) was added. The concentration of PMA was adjusted to 500 nmol / L. After 12 h of induction, the supernatant was removed, and the viscous substance at the bottom of the culture dish was resuspended with normal saline. The cell precipitate was removed by centrifugation at 1000 g for 10 minutes, and the supernatant was collected as the NET mixture.

[0083] Preparation of human-derived NETs: Peripheral venous blood samples from healthy human donors (collected from Sun Yat-sen Memorial Hospital, aged 25 - 30 years old) were collected. Human peripheral blood lymphocyte separation medium (Tianjin Haoyang, Cat#LTS1077) was used to centrifuge at 800 g for 30 minutes to separate neutrophils. The cell precipitate was collected, and the neutrophils were resuspended in complete medium and phorbol 12-myristate 13-acetate (PMA, Merck, Cat#P8139-1MG) was added. The concentration of PMA was adjusted to 500 nmol / L. After 12 h of induction, the supernatant was removed, and the viscous substance at the bottom of the culture dish was resuspended with normal saline. The cell precipitate was removed by centrifugation at 1000 g for 10 minutes, and the supernatant was collected as the NET mixture.

[0084] (1) In vitro induction of mouse bone marrow-derived megakaryocytes and observation of platelet formation: CCDC25 - / - The mice were euthanized and the lower limbs of the mice were separated to collect mouse bone marrow cells. To induce the differentiation of hematopoietic stem cells in the bone marrow into megakaryocytes and produce platelets, the bone marrow cells were resuspended in IMDM medium (ThermoFisher, Cat#12440053) containing 10% fetal bovine serum (NEWZERUM, Cat#FBS-CS500) and 1% penicillin / streptomycin (GIBCO, Cat#15140122), and recombinant murine thrombopoietin (Yeasen Biotechnology Co., Ltd., Cat#92611ES10, 100 ng / mL) was added. Induction was continued for 5 days to promote the generation of megakaryocytes and platelets. In the NET treatment group, NET was added during the induction process and the concentration was adjusted to 10 μg / mL for intervention. In the antibody intervention group, NET (10 μg / mL) and CCDC25 polyclonal neutralizing antibody (10 μg / mL) (Wuhan Dai'an Biotechnology Co., Ltd., Cat#33358) were added during the induction process for treatment; The experimental grouping of mouse bone marrow cells is shown in Table 8 below.

[0085] Table 8. Experimental grouping of mouse bone marrow cells

[0086]

[0087] Note: All mouse experiments were performed with 3 biological replicates

[0088] At the end stage of culture, megakaryocytes were collected and enriched, and proplatelet formation was observed. The cells were covered with pre-cooled 4% paraformaldehyde (asegene, Cat#430012) and treated at room temperature for 15 minutes to fix the cell samples. The paraformaldehyde was washed away, and the samples were covered with a 5% bovine serum albumin (asegene, Cat#43035-100) solution and incubated at room temperature for 30 minutes to block non-specific binding. Then, CD41 / Integrinα2b polyclonal antibody (primary antibody, Wuhan Sanying Biotechnology Co., Ltd., Cat#24552-1-AP, 1:100) was used to incubate overnight at 4°C to label mouse megakaryocytes. The primary antibody was washed away with PBS solution, and then donkey anti-rabbit IgG (H+L) fluorescent secondary antibody (Thermo Fisher, Cat#A21206, 1:200) was used to incubate at room temperature for 1 hour to conjugate with the CD41 primary antibody. The cell nuclei were labeled with DAPI (asegene, Cat#p005906, 10 μg / mL). The secondary antibody was washed away, and the samples were sealed with glass coverslips. The cells were imaged using a Zeiss LSM800 confocal microscope, and the number and morphological changes of megakaryocytes were analyzed

[0089] The proportion of megakaryocytes with proplatelet structures (PPF) in different treatment groups was counted within the field of view of the microscope. Megakaryocytes with significantly pseudopod-like structures formed on the cell membrane were defined as megakaryocytes producing proplatelet-like structures. The definition refers to Bhatlekar, Seema et al. “Anti-apoptotic BCL2L2 increases megakaryocyte proplatelet formation in cultures of human cord blood.” Haematologica vol.104, 10 (2019): 2075-2083

[0090] (2) In vitro induction of human bone marrow hematopoietic stem cells and observation of megakaryocyte differentiation and platelet formation: Collect bone marrow aspirates from patients (from the Sun Yat-sen University Cancer Center, see Table 9 below) and isolate CD34 + hematopoietic stem cells using CD34 +Hematopoietic stem cells were resuspended in SFEM medium (Stemcell, Cat#09600) containing 1% penicillin / streptomycin and human thrombopoietin (Peprotech, Cat#300 - 18 - 10UG, 50 ng / mL) was added to induce megakaryopoiesis. Hematopoietic stem cells isolated from each patient were induced for 7 days under the condition of 50 ng / mL human thrombopoietin to form primitive megakaryocytes. The primitive megakaryocytes were collected and grouped, and then, according to the conditions in Table 10, human thrombopoietin (50 ng / mL) was continuously supplemented and induced for another 6 days to harvest megakaryocytes at the end - stage of induction. Biological replicates were performed on 3 independent patient bone marrow biopsy samples. Among them, the NET treatment group was intervened with NET (10 μg / mL) during the induction process, and the antibody intervention group was treated with NET (10 μg / mL) and CCDC25 polyclonal neutralizing antibody (10 μg / mL) (Wuhan Dai'an Biotechnology Co., Ltd., Cat#33358) during the induction process; the experimental grouping of patients' hematopoietic stem cells is shown in Table 10 below.

[0091] Table 9. Patient information providing bone marrow aspirate

[0092]

[0093] Table 10. Experimental grouping of patients' hematopoietic stem cells

[0094] Patient experimental grouping Blank control group NET treatment group Antibody intervention group Human thrombopoietin + + + NET - + + CCDC25 polyclonal neutralizing antibody - - +

[0095] Megakaryocytes were collected and enriched at the end - stage of induction, and proplatelet formation was observed. The specific slide - making steps were the same as above. The cell samples were fixed with pre - cooled 4% paraformaldehyde. The primary antibody used was CD41 / Integrinα2b polyclonal antibody (Wuhan Sanying Biotechnology Co., Ltd., Cat#24552 - 1 - AP, 1:100) to label human megakaryocytes, the secondary antibody used was donkey anti - rabbit IgG (H + L) fluorescent secondary antibody (Thermo Fisher, Cat#A21206, 1:200), and the cell nucleus was labeled with DAPI (asegene, Cat#p005906, 10 μg / mL). The cells were imaged using a Zeiss LSM800 confocal microscope and the number and morphological changes of megakaryocytes were analyzed. Fields of the same magnification were selected to count the proportion of megakaryocytes with proplatelet - like structures.

[0096] Results: Treatment with CCDC25 polyclonal neutralizing antibody in vitro during the induction of megakaryocytes from mouse bone marrow effectively reversed the impairment of megakaryocyte platelet - producing ability caused by NET treatment ( Figure 1A); To verify a similar effect in human patients, megakaryocytes generated from human bone marrow hematopoietic stem cells were treated with a CCDC25 polyclonal neutralizing antibody in vitro, which also effectively reversed the inhibition of hematopoietic stem cell differentiation and the impairment of mature megakaryocyte platelet production ability caused by NET treatment. Figure 1 C); In isolated mouse bone marrow cells, the proportion of megakaryocytes with proplatelet-like structures (Proplatelet formation, PPF) in total megakaryocytes was significantly decreased after NET treatment. However, treatment with a polyclonal CCDC25 neutralizing antibody effectively reversed the decrease in the PPF proportion caused by NET treatment, and there was no significant difference compared with the group without NET treatment. Figure 1 B); The above results suggest that targeting the CCDC25 gene effectively inhibits the negative effect of NET on megakaryocyte platelet production.

[0097] Example 3: Role of targeting the CCDC25 gene in the treatment of bone marrow metastasis-related thrombocytopenia

[0098] (1) For wild-type mice and CCDC25 gene knockout mice, a mouse breast cancer bone marrow metastasis model was established by injecting breast cancer cells into the mouse heart. The specific method is as follows: Resuscitate and culture the breast cancer cell line E0771-luc cell line with a luciferase expression system transfected into C57BL / 6J mouse background, and prepare CCDC25 - / - mice and wild-type (WT) mice at 6-8 weeks old. Anesthetize the mice by intraperitoneal injection, fix the mice on the operating table, shave the chest skin, disinfect the injection site with 75% ethanol. Take the left side 1-2 mm away from the midpoint of the line connecting the xiphoid process to the suprasternal notch as the intracardiac injection site. Use an insulin needle to aspirate the tumor cell suspension, insert the needle vertically along the puncture point and inject 100 μL of the E0771-luc cell suspension at a concentration of 1×10 6 cells / mL. After all the liquid is injected, slowly withdraw the needle and use a sterile cotton ball to stop bleeding stably. Disinfect the chest skin with 75% ethanol again, then place the mice on a warming pad to maintain body temperature, and put them back into the cage for feeding and observe the mouse status regularly after they wake up.

[0099] (2) Observe tumor bone marrow metastasis under in vivo imaging:

[0100] Anesthetize the mice with isoflurane (Rewod, Cat#R510-22-10), inject the luciferase substrate (Promega, Cat#P1043, 10 mg / mL, 100 μL / mouse) into the mouse abdominal cavity. Use an in vivo imaging system (IVIS Spectrum, PerkinElmer, USA) to detect the signal of tumor metastasis foci in the lower limbs of the mice, and use Living Image 4.4 software to perform quantitative analysis and statistics on the bioluminescence images.

[0101] (3) Evaluation of megakaryopoiesis in vivo by immunohistochemical staining of bone marrow sections

[0102] The mice were sacrificed and the long bones were collected. The tissue samples were fixed with pre-cooled 4% paraformaldehyde, and paraffin sections were prepared. The sections were melted at 65 °C, dewaxed with xylene (Guangzhou brand, Cat#GH003), and hydrated with gradient ethanol (absolute ethanol, 95% ethanol, 85% ethanol, 75% ethanol, 50% ethanol). Heat antigen retrieval was performed at 100 °C for 10 minutes in an antigen retrieval solution with a pH of 8.0 (Zhongshan Golden Bridge, Cat#ZLI-9067, 1:50). The sections were blocked with 5% bovine serum albumin (asegene, Cat#43035-100) solution at room temperature for 30 minutes to block non-specific binding. CD42a / GP9 polyclonal antibody (Wuhan Sanying Biotechnology Co., Ltd., Cat#14564-1-AP, 1:100) was used as the primary antibody and incubated overnight at 4 °C to label megakaryocytes in the bone marrow. The cells were labeled with DAPI and donkey anti-rabbit IgG (H+L) fluorescent secondary antibody (Thermo Fisher, Cat#A21206, 1:200). The tissue was imaged using a Zeiss LSM800 confocal microscope, and the number and morphological changes of megakaryocytes were analyzed.

[0103] Results: Knockout of the CCDC25 gene in mice effectively protected megakaryopoiesis in the bone marrow cavity after the occurrence of bone marrow metastasis in breast cancer. The number of megakaryocytes in the bone marrow cavity of CCDC25 gene knockout mice was comparable to that of mice without bone marrow metastasis and was significantly higher than that of wild-type mice with bone marrow metastasis ( Figure 1 D).

[0104] The embodiments of the present invention have been described in detail above in conjunction with the accompanying drawings. However, the present invention is not limited to the above embodiments. Various changes can be made without departing from the spirit of the present invention within the knowledge of those of ordinary skill in the art. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a drug targeting the CCDC25 gene in the preparation of a drug for preventing and / or treating complications related to tumor bone marrow metastasis; preferably, the complications related to tumor bone marrow metastasis include thrombocytopenia.

2. The use according to claim 1, characterized in that, The drug targeting the CCDC25 gene is a CCDC25 inhibitor.

3. The use according to claim 2, characterized in that, The CCDC25 inhibitor is selected from at least one of gRNA, shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, small molecule compounds, and protein molecules.

4. The use according to claim 3, characterized in that, The protein molecule is a CCDC25-specific antibody, and the CCDC25-specific antibody includes a CCDC25 neutralizing antibody.

5. The use according to claim 3, characterized in that, The sequence of the gRNA is shown as at least one of SEQ ID NO: 1 to SEQ ID NO:

4.

6. A drug for preventing and / or treating complications related to tumor bone marrow metastasis, the drug comprising a gRNA shown as at least one of SEQ ID NO: 1 to SEQ ID NO: 4, a DNA molecule encoding the gRNA, or an expression cassette, expression vector, or recombinant cell containing the DNA molecule; preferably, the complications related to tumor bone marrow metastasis include thrombocytopenia.

7. The drug according to claim 6, characterized in that, The drug further includes Cas9 protein.

8. Application of the CCDC25 gene as a drug target in the screening of drugs for preventing and / or treating complications related to tumor bone marrow metastasis; the drug is a drug that inhibits the expression of the CCDC25 gene, the drug has the function of preventing and / or treating complications related to tumor bone marrow metastasis, and the application is non-diagnostic and non-therapeutic; preferably, the complications related to tumor bone marrow metastasis include thrombocytopenia.

9. The application according to claim 8, characterized in that, The application includes screening of drug targets, screening of drugs, pharmacodynamic evaluation of drugs, and safety evaluation of drugs.

10. The use according to any one of claims 1-5, or the medicament according to claim 6 or 7, or the application according to claim 8 or 9, characterized in that, The prevention and / or treatment includes: (i) Improving the differentiation of hematopoietic stem cells in the bone marrow into megakaryocytes; (ii) Improving the ability of mature megakaryocytes to produce platelets; (iii) Reversing the inhibitory effect of neutrophil extracellular traps on megakaryocyte differentiation and maturation; and (iv) Reversing the inhibitory effect of neutrophil extracellular traps on platelet production.

Citation Information

Patent Citations

  • Luminous headcear

    US1914429A

  • Application of CCDC25 in prediction of breast cancer prognosis and inhibition of breast cancer distant organ metastasis

    CN111190007A

  • Application of CCDC25 inhibitor in preparation of medicine for preventing and / or treating myocardial infarction and / or myocardial ischemia reperfusion

    CN118717987A