shRNA, recombinant plasmid, vector and application for interfering with FIBCD1 expression

Abstract

The present invention discloses shRNA, recombinant plasmids, vectors, and applications for interfering with FIBCD1 expression, belonging to the field of biomedical engineering technology. The shRNA is shRNA1 or shRNA2; the DNA sequence corresponding to shRNA1 is shown in SEQ ID NOs. 1-2; the DNA sequence corresponding to shRNA2 is shown in SEQ ID NOs. 3-4. The present invention's research found that FIBCD1 is highly expressed in the amygdala region, playing a key role in the development and progression of PTSD and being an adverse factor. To address this, shRNA1 and shRNA2 were designed, using adeno-associated viruses as vectors. By knocking out FIBCD1 in the amygdala region, it was found that it could reverse PTSD-like symptoms caused by SPS&S, and could have a significant anti-PTSD effect.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedical engineering, and particularly relates to a shRNA, a recombinant plasmid, a vector and applications thereof for interfering with FIBCD1 expression. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Post-traumatic stress disorder (PTSD) is an adverse psychological reaction to traumatic exposure and is considered a typical disorder associated with traumatic exposure. Traumatic exposure encompasses unavoidable social factors such as violence and conflict, natural disasters, and other factors. Currently, PTSD has become a major public health challenge. Medication is a common treatment for PTSD, and common medications such as paroxetine and sertraline are FDA-approved for PTSD intervention. These medications alleviate depressive symptoms by increasing serotonin levels, but long-term use can cause serious side effects such as suicidal tendencies, vomiting, and insomnia. Therefore, the development of side-effect-free medications is crucial for the treatment of PTSD.

[0004] With the advancement of genetic engineering research, scientists have shown keen interest in using it to develop drugs. Scientists directly manipulate target genes to produce drugs that target specific diseases or pathological processes. This highly targeted production method not only improves drug efficacy but also reduces unwanted side effects. The resulting genetically engineered drugs generally have enhanced safety and stability. Short hairpin RNA (shRNA) can be transcribed and produced within cells, binding to its target, thereby regulating the expression of the target gene. Existing genetically engineered drugs often use shRNA to regulate target genes, thereby achieving therapeutic effects. However, no shRNA has been reported to treat PTSD. Summary of the Invention

[0005] In order to address the deficiencies of the prior art, the inventors, after long-term technical and practical exploration, provide a shRNA, a recombinant plasmid, a vector and applications for interfering with FIBCD1 expression.

[0006] Fibrinogen C domain-containing protein 1 (FIBCD1) has been identified as a chitin-binding receptor in mammals and is involved in immune responses. FIBCD1 is highly expressed in the human respiratory tract, gastrointestinal tract, testes, placenta, and brain. Previous studies have shown that FIBCD1 is associated with cancer, with its overexpression being associated with poor prognosis in gastric cancer and hepatocellular carcinoma, and can also affect brain neurodevelopment. However, the role of FIBCD1 in PTSD has not been reported. This study employed the currently recognized in vivo PTSD model, SPS&S, to examine FIBCD1 expression in brain regions highly associated with PTSD (the hippocampus, amygdala, and prefrontal cortex) in SPS&S mice. Elevated FIBCD1 expression was found in the amygdala of PTSD mice, suggesting that FIBCD1 may be closely associated with PTSD. Immunofluorescence and Western blot techniques were used to investigate the mechanism of action of FIBCD1 in the amygdala of PTSD mice. The present invention found that FIBCD1 is highly expressed in the amygdala region, which plays a key role in the occurrence and development of PTSD and is an adverse factor. Inhibiting FIBCD1 as a target and its protein and function can play a good anti-PTSD effect, and has great potential in the treatment of PTSD, drug screening, and other aspects.

[0007] To address this issue, the inventors designed a series of shRNAs that interfere with FIBCD1 expression, using AAV adeno-associated virus as a vector to knock down FIBCD1 in the amygdala brain region, and screened their effects through Western blot experiments. Western blot experiments verified that shRNA1 and shRNA2 had the effect of interfering with FIBCD1 expression. The most effective shRNA1 sequence was then selected for subsequent experiments. In open field experiments, elevated plus maze experiments, and conditioned fear memory experiments, the anxiety-like behavior and fear memory of mice were tested. It was found that knocking down FIBCD1 in the amygdala region using shRNA1 could reverse PTSD-like symptoms caused by SPS&S, achieving the treatment of PTSD. Based on the above research results, the present invention was completed.

[0008] In order to achieve the above object, the technical solution of the present invention is:

[0009] The first aspect of the present invention provides a shRNA that interferes with FIBCD1 expression, wherein the shRNA is shRNA1 or shRNA2;

[0010] The DNA sequence corresponding to the shRNA1 is shown in SEQ ID NO.5-6;

[0011] The DNA sequence corresponding to the shRNA2 is shown in SEQ ID NO 8-9.

[0012] In some embodiments of the present invention, the Gene ID of FIBCD1 is 84929.

[0013] The second aspect of the present invention provides a recombinant plasmid containing the above-mentioned shRNA that interferes with FIBCD1 expression.

[0014] The third aspect of the present invention provides a vector comprising the above-mentioned shRNA that interferes with FIBCD1 expression or the above-mentioned recombinant plasmid.

[0015] In some embodiments of the present invention, the vector is obtained by effectively linking the above-mentioned shRNA to an adeno-associated virus vector.

[0016] In some embodiments of the present invention, the adeno-associated virus (AAV) vector is pHBAAV-U6-MCS-CMV-EGFP.

[0017] A fourth aspect of the present invention provides use of the aforementioned shRNA, the aforementioned recombinant plasmid, or the aforementioned vector in the preparation of a product for treating post-traumatic stress disorder.

[0018] In some embodiments of the present invention, the product is a drug.

[0019] In some embodiments of the present invention, the dosage form of the drug includes one of a liquid dosage form and a solid dosage form.

[0020] In some embodiments of the present invention, the liquid dosage form includes any one of an injection, a solution, a suspension, an emulsion, and an aerosol, and the solid dosage form includes any one of a tablet, a capsule, and a powder.

[0021] The beneficial effects of the present invention are:

[0022] The present invention has found that FIBCD1 is highly expressed in the amygdala region, which plays a key role in the occurrence and development of PTSD and is an unfavorable factor; FIBCD1 can be used as a therapeutic target for PTSD, and reducing its expression can resist the occurrence and progression of PTSD. To this end, the present invention has designed a series of shRNAs that interfere with the expression of FIBCD1. The present invention uses adeno-associated viruses containing shRNA1 or shRNA2 to knock out FIBCD1 in the amygdala region and found that it can reverse the PTSD-like symptoms caused by SPS&S, play a good anti-PTSD role, and achieve the treatment of PTSD. The shRNA that interferes with the expression of FIBCD1 provided by the present invention has great potential in the treatment of PTSD, drug screening, and other aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0024] Figure 1 The sequencing results of m-FIBCD1 shRNA1 (A), m-FIBCD1 shRNA2 (B), and m-FIBCD1 shRNA3 (C) in Example 1 of the present invention are shown;

[0025] Figure 2 is the standard curve in Example 1 of the present invention;

[0026] Figure 3 Schematic diagram of the procedure for constructing the SPS&S animal model in Example 1 of the present invention;

[0027] Figure 4 Western blot analysis of the expression of FIBCD1 in the amygdala (A), hippocampus (B), and prefrontal cortex (C) in Example 1 of the present invention, ***P<0.001;

[0028] Figure 5 This is a diagram of behavioral timelines and stereotactic injection of adeno-associated virus (AAV)-shRNA into the amygdala and detection of knockdown effects in Example 1 of the present invention, ***P<0.001; wherein, A is a flow chart for detecting anxiety-like behavior in mice, B is a schematic diagram of the AAV injection site, the circled area in the figure is the amygdala site, where the high fluorescence intensity indicates that the virus was injected into the amygdala site, C is Western blot detection of shRNA1 interference efficiency, D is Western blot detection of shRNA2 interference efficiency, and E is Western blot detection of shRNA3 interference efficiency;

[0029] Figure 6 The anxiety-like behavior of mice detected by the open field test and the elevated plus maze test in Example 1 of the present invention; *P<0.05, #P<0.05, ****P<0.0001, ####P<0.0001; wherein, A is the time spent exploring the central area of ​​the open field test, B is the number of times the central area is entered in the open field test, C is the total movement distance of the open field test, D is the proportion of time spent in the open arms of the elevated plus maze test, and E is the number of times the open arms are entered in the elevated plus maze test;

[0030] Figure 7 The fear memory of mice was detected by the situational fear experiment and the conditioned fear experiment in Example 1 of the present invention; #P<0.05, **P<0.01, ***P<0.001; wherein A is the flowchart of the fear memory experiment, B is the results of the situational fear experiment, and C is the results of the conditioned fear experiment;

[0031] Figure 8 This is the fear generalization experiment in Example 1 of the present invention to detect the generalization of fear memory in mice; * SPS&S+NC VS AAV-shNC, # SPS&S+AAV-shRNA1 VS SPS&S+AAV-shNC; #P<0.05, ***P<0.001, ****P<0.0001; wherein, A is the fear generalization experiment flow chart, B is the percentage of freezing time at each frequency in the fear generalization experiment, and C is the fear generalization experiment results;

[0032] Figure 9 The expression of TLR2-NFkB and inflammatory factors in the mouse amygdala detected by WB in Example 1 of the present invention; *P<0.05, #P<0.05, **P<0.01, ##P<0.01; wherein A represents the expression of TLR2 protein, B represents the expression of NFkB protein, C represents the expression of IL-6 protein, and D represents the expression of IL-1β protein;

[0033] Figure 10 The expression of IL-6 in the amygdala detected by immunofluorescence in Example 1 of the present invention; ***P<0.001, ##P<0.01; wherein A is IL-6 immunofluorescence staining of amygdala tissue, and B is IL-6 immunofluorescence intensity statistics;

[0034] Figure 11 The expression of c-Fos in the amygdala detected by immunofluorescence in Example 1 of the present invention; ****P<0.0001, ##P<0.01; wherein A is the immunofluorescence staining of NeuN and c-Fos, and B is the statistical analysis of the immunofluorescence intensity of c-Fos and NeuN co-staining;

[0035] Figure 12 This is a schematic diagram of the mechanism of action of the present invention. PTSD increases the expression of FIBCD1 on microglia in the amygdala region of mice, and promotes the secretion of inflammatory factors through the TLR2-NFkB signaling pathway. Increased IL-6 secretion leads to activation of amygdala neurons, thereby causing abnormal fear memory.

[0036] Figure 13 This is a spectrum of the recombinant plasmid used in Example 1 of the present invention. DETAILED DESCRIPTION

[0037] The present invention discloses shRNA, recombinant plasmids, vectors, and applications for interfering with FIBCD1 expression. Those skilled in the art can refer to the contents herein and appropriately modify the process parameters to achieve this. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0038] Explanation of terms:

[0039] EPM: elevated plus maze test.

[0040] OFT: open field test.

[0041] Contextual fear text: Situational fear experiment.

[0042] Conditioned fear text: Conditioned fear experiment.

[0043] CTL group: blank control group, i.e. control.

[0044] As mentioned above, there are no reports of shRNAs that have therapeutic effects on PTSD. In view of this, in a typical embodiment of the present invention, a shRNA that interferes with the expression of FIBCD1 is provided, wherein the shRNA is shRNA1 or shRNA2;

[0045] The DNA sequence corresponding to the shRNA1 is shown in SEQ ID NO.5-6;

[0046] The DNA sequence corresponding to the shRNA2 is shown in SEQ ID NO 8-9.

[0047] Wherein, the full name of FIBCD1 is Fibrinogen C Domain Containing 1 [ Homo sapiens (human)], Gene ID: 84929. It has been identified as a chitin-binding receptor in mammals and is involved in immune responses.

[0048] The present invention employed the currently recognized in vivo PTSD model, SPS&S, to examine FIBCD1 expression levels in brain regions highly associated with PTSD (hippocampus, amygdala, and prefrontal cortex) in SPS&S mice. Subsequently, anxiety-like behaviors and fear memory were assessed in the open field test, elevated plus maze test, and conditioned fear memory test. Immunofluorescence and Western blot techniques were used to investigate the mechanism of action of FIBCD1 in the amygdala of PTSD mice. The inventors found that reducing FIBCD1 expression in the amygdala can ameliorate SPS&S-induced PTSD-like symptoms, suggesting that FIBCD1 may serve as a promising target for anti-PTSD drugs. To address this, three shRNA sequences were designed to knock down FIBCD1 in the amygdala and screened for efficacy using Western blot. Ultimately, shRNA1 and shRNA2 were confirmed to inhibit FIBCD1 expression.

[0049] A second typical embodiment of the present invention provides a recombinant plasmid containing the above-mentioned shRNA that interferes with FIBCD1 expression.

[0050] A third typical embodiment of the present invention provides a vector comprising the above-mentioned shRNA that interferes with FIBCD1 expression or the above-mentioned recombinant plasmid.

[0051] In some examples of this embodiment, the vector is obtained by operatively linking the above-mentioned shRNA to an adeno-associated virus vector.

[0052] In some examples of this embodiment, the adeno-associated viral vector is pHBAAV-U6-MCS-CMV-EGFP.

[0053] A fourth typical embodiment of the present invention provides use of the above-mentioned shRNA, the above-mentioned vector or the above-mentioned host in preparing a product for treating post-traumatic stress disorder.

[0054] In some examples of this embodiment, the product is a drug.

[0055] According to the present invention, when the product is a drug, the drug further comprises at least one inactive pharmaceutical ingredient. The inactive pharmaceutical ingredient may be a carrier, excipient, diluent, or the like commonly used in pharmacy. Furthermore, according to conventional methods, the drug can be formulated into oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, sprays, topical preparations, suppositories, and sterile injectable solutions.

[0056] The non-drug active ingredients such as carriers, excipients and diluents commonly used in medicine are well known in the art, and those skilled in the art can determine whether they meet clinical standards.

[0057] In some examples of this embodiment, the carriers, excipients and diluents include but are not limited to lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.

[0058] In some examples of this embodiment, the medicine of the present invention can be administered to the body in a known manner. For example, it can be delivered to the tissue of interest by systemic intravenous delivery or local injection. Alternatively, it can be administered via intravenous, transdermal, intranasal, mucosal or other delivery methods. Such administration can be carried out via a single dose or multiple doses. It will be appreciated by those skilled in the art that the actual dose to be administered in the present invention can vary depending on various factors to a great extent, such as the target cell, the type of organism or its tissue, the general condition of the subject to be treated, the route of administration, the mode of administration, etc.

[0059] In some examples of this embodiment, the drug administration subject can be a human or non-human mammal, such as a mouse, rat, guinea pig, rabbit, dog, monkey, orangutan, etc.

[0060] In some examples of this embodiment, the dosage form of the drug includes one of a liquid dosage form and a solid dosage form.

[0061] In some examples of this embodiment, the liquid dosage form includes but is not limited to one of an injection, a solution, a suspension, an emulsion, and an aerosol, and the solid dosage form includes but is not limited to one of a tablet, a capsule, and a powder.

[0062] In some examples of this embodiment, the drug is an experimental reagent used for basic research. For example, the experimental reagent can be used to construct cell and animal models related to post-traumatic stress disorder.

[0063] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0064] The reagents and equipment used in the present invention can all be purchased from the market.

[0065] Example 1

[0066] (1) Construction of SPS&S animal model

[0067] C57 mice were restrained for 2 h, forced to swim for 20 min, rested for 15 min, and anesthetized with ether until unconscious. After a 30-min interval, they were given an inescapable electric shock (1 mA, 5 s).

[0068] (2) Western blot detection of FIBCD1 expression in amygdala, hippocampus, and prefrontal cortex

[0069] Mice were anesthetized with isoflurane vapor and sacrificed by decapitation. Brain tissue was quickly removed on ice, and the hippocampus, prefrontal cortex, and amygdala were isolated and stored in 1.5 mL cryovials. The cells were snap-frozen in liquid nitrogen and stored at −80°C. Protein / phosphatase inhibitors were mixed with RIPA high-performance lysis buffer at a ratio of 1:100, and 10 μL of the mixture was added to 1 mg of tissue in EP tubes. Two grinding beads were added to each EP tube. The samples were ground twice at 60 Hz for 2 minutes each using a high-throughput tissue grinder (the inner chamber of the grinder had been pre-chilled at −20°C). After grinding, the samples were incubated on ice for 20 minutes and then centrifuged in a refrigerated high-speed centrifuge at 12,000 rpm for 20 minutes at 4°C. Protein concentration was determined using the BCA assay. The adjusted samples were heat-denatured in a metal bath for 5 minutes.

[0070] For protein electrophoresis, prepare a 10% separating gel and a 5% stacking gel. Add 5 μL of appropriate marker and 20 μL of protein sample to the sample and electrophorese. After blocking, incubate with primary antibodies against FIBCD1 and β-actin overnight at 4°C. Incubate with a goat anti-rabbit secondary antibody. After development, analyze the image using software, generate data, and process the data.

[0071] WB results ( Figure 4 ) showed that the expression of FIBCD1 in the amygdala of mice in the SPS&S group was significantly higher than that in the CTL group, while the expression in the hippocampus and prefrontal cortex remained unchanged.

[0072] (3) Stereotactic injection of adeno-associated virus AAV-shRNA into the amygdala

[0073] Construction of AAV-shRNA adeno-associated virus:

[0074] 1. Design interference targets and synthesize primers based on the FIBCD1 gene sequence:

[0075] 1.1 The control viral vector siRNA and shRNA sequences are as follows:

[0076] siRNA sequence: TTCTCCGAACGTGTCACGTAA (SEQ ID NO.1)

[0077] shRNA sequence:

[0078] Justice chain (Top strand):

[0079] GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC (SEQID NO.2)

[0080] Bottom strand:

[0081] AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG (SEQID NO.3)

[0082] 1.2 Target gene siRNA sequence and shRNA sequence:

[0083] siRNA1 sequence: TCACCGGTGTGGTTCTCTTCCTGAA (SEQ ID NO.4)

[0084] shRNA1 sequence:

[0085] Justice chain (Top strand):

[0086] AATTCGTCACCGGTGTGGGTTCTCTTCCTGAACTCGAGTTCAGGAAGAGAACCACACCGGTGATTTTTTG (SEQ ID NO.5)

[0087] Bottom strand:

[0088] GATCCAAAAAATCACCGGTGTGGGTTCTCTTCCTGAACTCGAGTTCAGGAAGAGAACCACACCGGTGACG (SEQ ID NO.6)

[0089] siRNA2 sequence: CGGGATGGCAGTATTCACTCAAGTT (SEQ ID NO. 7)

[0090] shRNA2 sequence:

[0091] Justice chain (Top strand):

[0092] AATTCGCGGGATGGCAGTATTCACTCAAGTTCTCGAGAACTTGAGTGAATACTGCCATCCCGTTTTTTG (SEQ ID NO.8)

[0093] Bottom strand:

[0094] GATCCAAAAAACGGGATGGCAGTATTCACTCAAGTTCTCGAGAACTTGAGTGAATACTGCCATCCCGCG (SEQ ID NO.9)

[0095] siRNA3 sequence: CAGCAGGATGATGGTGTCTACTCTA (SEQ ID NO. 10)

[0096] shRNA3 sequence:

[0097] Justice chain (Top strand):

[0098] AATTCGCAGCAGGATGATGGTGTCTACTCTACTCGAGTAGAGTAGACACCATCATCCTGCTGTTTTTTG (SEQ ID NO.11)

[0099] Bottom strand:

[0100] GATCCAAAAAACAGCAGGATGATGGTGTCTACTCTACTCGAGTAGAGTAGACACCATCATCCTGCTGCG (SEQ ID NO. 12)

[0101] The primers anneal to form double-stranded fragments with sticky ends.

[0102] 1.3 Vector digestion:

[0103] Add each reagent in the order shown in the table below, gently pipette to mix, and place in a 37°C water bath for 1-2 hours. After the enzyme digestion is complete, perform agarose gel electrophoresis to recover the target fragment.

[0104] The vector used in the present invention is the vector numbered AAV021 of Hanheng Biotechnology (Shanghai) Co., Ltd. The plasmid map is as follows Figure 13 As shown, the original sequence is pHBAAV-U6-MCS-CMV-EGFP.

[0105] The vector enzyme digestion system is shown in Table 1.

[0106] Table 1 Vector enzyme digestion system

[0107]

[0108] Note: The restriction enzyme 1 and restriction enzyme 2 have EcoRI and BamHI cleavage sites, respectively.

[0109] 1.4 Connecting the interfering fragment (siRNA) to the vector:

[0110] The ligation reaction system (20 μL) is shown in Table 2.

[0111] Table 2 Ligation reaction system

[0112]

[0113] Note: The annealing product is a double-stranded fragment with sticky ends formed by annealing the siRNA in 1.1 or 1.2.

[0114] The above ligation solution was ligated at 22℃ for 1-2 hours, or at 16℃ overnight.

[0115] 1.5 Conversion

[0116] 1) After taking the DH5α competent cells out of the -80℃ freezer, immediately place them on ice to thaw. Be gentle during the competent cell aliquoting process to minimize mechanical damage.

[0117] 2) After the competent medium has thawed, aliquot the aliquot into 50 μL aliquots (20 μL is sufficient for plasmid transformation). Add the ligation product to a volume no greater than 1 / 10 of the competent medium volume (currently add 5 μL of ligation product) and place on ice for 20-30 min.

[0118] Heat shock at 42°C for 90 seconds. Immediately incubate on ice for 2-3 minutes. In a laminar flow hood, add 500 μL of LB medium without scandium and gently invert the tube 3-5 times.

[0119] 4) Incubate at 37°C, 230 rpm, shaking for 45-60 min;

[0120] 5) Apply the bacterial solution evenly to a solid plate of the corresponding resistance, then incubate the plate upside down at 37°C for 12-16 hours.

[0121] 1.6 PCR identification of bacterial liquid

[0122] The bacterial liquid PCR identification system is shown in Table 3.

[0123] Table 3 Bacterial liquid PCR identification system

[0124]

[0125] Note: The sequences of primer 1 and primer 2 in Table 3 are as follows:

[0126] Primer 1: GGACTATCATATGCTTACCG (SEQ ID NO. 13)

[0127] Primer 2: GTCCCTATTGGCGTTACTATG (SEQ ID NO. 14)

[0128] The bacterial solution PCR identification procedure is shown in Table 4.

[0129] Table 4 Bacterial liquid PCR identification procedure

[0130]

[0131] 1.7 Sequencing

[0132] Comparison and analysis of sequencing results:

[0133] The sequencing results of m-FIBCD1 shRNA1 are as follows Figure 1 As shown in (A), the sequencing results of m-FIBCD1 shRNA2 are as follows Figure 1 As shown in (B), the sequencing results of m-FIBCD1 shRNA3 are as follows Figure 1 As shown in (C), sequencing results showed that the target sequence was consistent with the target plasmid, indicating that the target plasmid was successfully constructed. The resulting plasmid was named pAAV-RC plasmid.

[0134] After successful sequencing, the bacterial culture is amplified and the plasmid is extracted and purified. The plasmid extraction protocol follows the instructions of the extraction kit. The extracted plasmid is verified to be qualified and then used to transfect cells.

[0135] 2. Adeno-associated virus packaging

[0136] 2.1 Day 1: Subculture AAV-293 cells into 100 mm dishes for transfection. Place in an incubator at 37°C, 5% CO2, and 95% relative humidity.

[0137] 2.2 Day 3: Transfection

[0138] Cell observation: Transfection can be performed after confirming that the cell density has reached approximately 80-90% confluence.

[0139] Lipofectamine transfection: OptiMEM needs to be preheated in a 37°C water bath. TM The transfection reagent must be returned to room temperature before use and must be shaken well before use.

[0140] The components of the transfection complex required for transfection of a 100 mm dish are shown in Table 5.

[0141] Table 5 Transfection complex components

[0142]

[0143] Note: Lipofiter TM The transfection reagent is a product of Hanbio Biotech. For instructions, refer to Lipofiter. TM manual.

[0144] Both pHelper plasmid and shuttle plasmid are auxiliary plasmids required for the preparation of adeno-associated virus. Both are commercial plasmids and can be purchased directly.

[0145] Medium change: 6 h after transfection, replace with fresh complete medium containing 10% fetal bovine serum (FBS).

[0146] Cell collection: 72 h after transfection, gently scrape the cells containing AAV particles with a cell scraper and collect them in a 15 mL centrifuge tube. Centrifuge at 150 × g for 3 min to collect the cells, remove the culture supernatant, wash once with PBS, and finally resuspend the cells in 300 μL PBS.

[0147] Cell disruption: Prepare a 37°C water bath and liquid nitrogen. Repeat the freeze-thaw cycle three times in a 37°C water bath containing cells. Centrifuge at 4°C, 2000 × g, for 5 min to remove cell debris and collect the supernatant containing AAV particles.

[0148] 3. Adeno-associated virus purification

[0149] Treatment with universal nuclease: Add 0.1 μL of Benonase per 1 mL of crude viral extract and incubate at 37°C in a water bath for 1 hour to remove the cellular genome and residual plasmid DNA from the viral fluid. Centrifuge at 600 × g at 4°C for 10 minutes and collect the supernatant.

[0150] Column purification (purification according to Biomiga AAV purification kit V1469-01).

[0151] 4 mL of AAV virus sample from column purification was added to an ultrafiltration tube and centrifuged at 1400 × g for 30 min to obtain approximately 1 mL of AAV. The purified virus was collected and stored at -80°C.

[0152] 4. Adeno-associated virus quality testing

[0153] The key points of quality control for adeno-associated viruses include sterility testing, mycoplasma testing and virus titer testing.

[0154] 4.1 Sterility testing

[0155] Detection method: 10 μL of virus was added to Hela cells in a 96-well plate for verification. After 24 hours of culture, the following was examined under a microscope:

[0156] QC standards: The culture medium must be clear and transparent, with no obvious particles between cells and no bacterial or fungal contamination.

[0157] 4.2 Mycoplasma Detection

[0158] Detection method: Take 10 μL of virus, incubate at 96°C for 15 minutes, and then prepare the PCR reaction system in a clean bench. After the PCR reaction, perform electrophoresis to determine if there is mycoplasma contamination.

[0159] QC standard: No obvious bands in the PCR gel image.

[0160] 4.3 Titer detection

[0161] AAV virus samples were digested using DNase I and proteinase K.

[0162] The DNase I enzyme reaction system is shown in Table 6.

[0163] Table 6 DNase I enzyme reaction system

[0164]

[0165] Incubate at 37°C in a water bath for approximately 1 hour, then at 100°C for 10 minutes. Add 2 μL of proteinase K, incubate at 55°C in a water bath for 1 hour, then at 100°C for 10 minutes, centrifuge, and dilute 10-fold for later use.

[0166] Dilute the standard plasmid and set the copy gradient of the standard to 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 .

[0167] The QPCR reaction system was configured, and three replicate wells were designed for each sample and standard. The QPCR system is shown in Table 7.

[0168] Table 7 QPCR system

[0169]

[0170] Perform QPCR reaction, the procedure is shown in Table 8.

[0171] Table 8 QPCR reaction procedure

[0172]

[0173] 4.4 Data Analysis

[0174] Table 9 shows the Ct values ​​of the Roche LC96 real-time fluorescence quantitative PCR instrument.

[0175] Table 9 Ct value data statistics

[0176]

[0177] The standard curve was prepared. The mean Ct of each group of AAV standards was taken as the vertical coordinate Y, and the logarithm of the corresponding copy number was taken as the horizontal coordinate X. Figure 2 ), the function formula and R square value of the standard curve are obtained.

[0178] Calculate the titer of the sample to be tested. Calculate the number of AAV template copies added, X, by taking the average Ct value of the AAV sample to be tested, and then convert it into titer. The conversion formula is: AAV virus titer = 10 x ×400,000 (dilution factor) vg / mL. The resulting sample injection ratio is shown in Table 10.

[0179] Table 10 Sample titer

[0180]

[0181] The adeno-associated virus containing shRNA1 was named AAV-shRNA1, the adeno-associated virus containing shRNA2 was named AAV-shRNA2, the adeno-associated virus containing shRNA3 was named AAV-shRNA3, and the control virus vector was named AAV-shNC.

[0182] The AAV adeno-associated virus is loaded with shRNA1, shRNA2 or shRNA3, and shRNA is used to knock down FIBCD1 in the amygdala brain region.

[0183] Stereotaxic injection of AAV-shRNA adeno-associated virus

[0184] After inducing anesthesia with isoflurane, the SPS&S model mouse head was fixed in a stereotaxic apparatus, and anesthesia was maintained using a variable isoflurane concentration of 0.5% to 1.5%. Subsequently, the mouse's head hair was removed, the skin overlying the skull was incised, and the mucosal tissue removed to expose the cranial sutures. Under a stereoscope, the height of the anterior and posterior bregma was measured, and the skull surface was leveled. AAV-shRNA adeno-associated virus was injected at the coordinates of the amygdala located on a mouse brain atlas. The injection rate was controlled at 20-40 nL / min. To ensure adequate viral absorption, the needle was left in place for 10 minutes after injection. After suturing the wound, a triple antibiotic was applied. Western blot analysis was performed 3-4 weeks later to assess viral efficacy.

[0185] like Figure 5 As shown in Figure (B), the adeno-associated virus was successfully injected into the amygdala. Figure 5 Figures (C) and (D) show that both shRNA1 and shRNA2 have interference effects on FIBCD1, and shRNA1 has the best interference effect on FIBCD1. Therefore, AAV-shRNA1 was used in subsequent experiments. Figure 5 Panel (E) shows that shRNA3 has no inhibitory effect on FIBCD1.

[0186] (4) Open field test and elevated plus maze test

[0187] Open field test:

[0188] The open-field test was conducted in a separate, quiet room using an open-field box (40 cm in length, width, and height) with rough, non-reflective interior walls. Recording was performed using a camera mounted directly above the open field. At the start of the experiment, mice were placed in the center of the open field and recording began. The mice were allowed to freely explore the open field for 5 minutes. Behavioral analysis software (Shanghai Xinruan Information Technology Co., Ltd.) was used to define the central and peripheral zones. The software analyzed and recorded the mice's movement paths within the open field, the number of times they entered the central zone, the time they spent in the central zone, and the total distance traveled. After each trial, the open-field box was cleaned with 75% ethanol to prevent odor interference with subsequent experiments, and to remove feces and urine.

[0189] Elevated plus maze test:

[0190] The elevated plus maze test was conducted in a separate, quiet room. The elevated plus maze apparatus consisted of two open arms (35 cm long, 5 cm wide, 15 cm high), two closed arms (35 cm long, 5 cm wide, 15 cm high), and a central platform (5 cm long, 5 cm wide). Recording was performed using a camera mounted directly above the open-field maze (EPM). To prevent external interference with the mouse, a solid, unpatterned blackout curtain was placed around the EPM. At the start of the experiment, the mouse was placed on the central platform with its head facing the closed arms, and recording began. The mouse was allowed to freely explore the EPM for 5 minutes. Software was used to analyze and record the mouse's movement path within the EPM, the number of entries into the open arms, and the time spent in the open arms. After each trial, the open-field chamber was cleaned with 75% ethanol to prevent odor contamination in subsequent experiments. Feces and urine were removed.

[0191] Figure 6 Open field test and elevated plus maze test were used to detect anxiety-like behaviors in mice. *P<0.05, #P<0.05, ****P<0.0001, ####P<0.0001. Figure 6Figures (A), (B) and (C) in the middle are the results of open field test to detect the motor ability and anxiety of mice. Figure 6 Figures (A) and (B) show that the exploration time and frequency of the central area of ​​the open field in mice were significantly reduced after SPS&S modeling, and this was reversed after injection of AAV-shRNA1 adeno-associated virus. Figure 6 The middle panel (C) shows that injection of adeno-associated virus has no effect on the motor ability of mice. Figure 6 Figures (D) and (E) show that the time and number of open-arm entries were significantly reduced after SPS&S modeling, and this was also reversed after injection of the AAV-shRNA1 adeno-associated virus. In summary, the results of the open field test and elevated plus maze test indicate that SPS&S modeling induces anxiety-like behaviors in mice, while injection of the AAV-shRNA1 adeno-associated virus exhibits anxiolytic behaviors.

[0192] (5) Situational fear experiment and conditioned fear experiment

[0193] The situational fear experiment was conducted using two different test chambers (A and B). Chamber A (30 cm long, 30 cm wide, 30 cm high, produced by Shanghai Xinruan Information Technology Co., Ltd.) was used for the contextual fear test. It consisted of four solid-color, opaque acrylic panels with a metal rod at the bottom connected to the electrical stimulator. Chamber B, similar in size and material to Chamber A, had black and white stripes printed on all four walls (due to differences in manufacturing conditions).

[0194] On the 8th day after modeling, mice were trained: the mice were placed in box A to adapt for 180 s, and then the conditioned stimulus (CS) and unconditioned stimulus (US) were cycled for a total of 3 times. The conditioned stimulus was a sound stimulus (75 dB, sine wave) lasting 28 s each time, and the unconditioned stimulus was a foot shock (0.8 mA) lasting 2 s each time; after 24 hours, a situational fear test was performed: the mice were placed in box A without any sound or electrical stimulation. The experimental process was recorded by a camera located on the top of box A. The environmental settings of the fear training phase were maintained, and the mice were free to explore for 5 minutes; the sound-cued fear test was performed 24 hours later: the mice were placed in box B to adapt for 180 s, and then the same sound stimulus as in the fear memory training phase was given for 3 minutes. The experimental process was recorded by a camera located on the top of box A; behavioral analysis software was used to analyze and record the freezing time of the mice in the two behavioral test phases.

[0195] The results of the situational fear experiment are as follows Figure 7 As shown in Figure (B), the results of the conditioned fear experiment are as follows Figure 7As shown in Figure (C), the SPS&S group exhibited both context- and cue-related fear behaviors. Injection of AAV-shRNA1 adeno-associated virus improved cue-related fear behaviors but had no effect on context-related fear behaviors.

[0196] (6) Fear generalization test

[0197] On day 8 after modeling, mice were trained using the same conditions as in the fear experiment. The trained mice were placed in box B. After acclimating for 2 minutes in box B, no electrical stimulation was given. Instead, 3-4 pure tone stimuli (GS) and sound stimuli (CS) of varying frequencies (75 dB, 30 s duration) were presented. The order of the sounds was randomly counterbalanced, with an interval of 30-90 s between each sound. 60 s after the last sound ended, the mice were removed from box B and returned to their cages. The total freezing time during the sound presentation and the interval between sounds was recorded.

[0198] Depend on Figure 8 As shown in Figures (B) and (C), SPS&S induces the generalization of fear memory in mice. Injection of AAV-shRNA1 adeno-associated virus can improve fear responses at 9, 4.8, and 2.5 kHz, but not at 1.3 kHz.

[0199] (7) Detection of TLR2-NFkB and inflammatory factor expression

[0200] For protein electrophoresis, prepare a 10% separating gel and a 5% stacking gel. Add 5 μL of appropriate marker to 20 μL of protein sample and electrophorese. After blocking, incubate with primary antibodies against TLR2, NF-κB, p-NF-κB, IL-6, IL-1β, GAPDH, and β-actin overnight at 4°C. Incubate with a goat anti-rabbit secondary antibody. After development, analyze the images using software, generate data, and process the data.

[0201] The results are as follows Figure 9 As shown in the data, the expression of TLR2 and p-NFkB in the SPS&S group was significantly increased compared with the CTL group, and the expression of TLR2 and p-NFkB was significantly downregulated after injection of AAV-shRNA1 adeno-associated virus; the expression of IL-6 and IL-1β was increased in SPS&S mice, and the expression levels were significantly reduced after injection of AAV-shRNA1 adeno-associated virus compared with the SPS&S group.

[0202] (8) Immunofluorescence detection of IL-6 expression in the amygdala

[0203] Mice were secured on an operating table in a small animal anesthesia machine and anesthetized with isoflurane vapor using a respiratory anesthesia mask. The heart was dissected and exposed. A perfusion needle was inserted through the left ventricle. The atrial appendage above the right atrium was cut open. The syringe was then pushed at a constant speed to perfuse the entire mouse body with 37°C saline through the left ventricle, totaling approximately 40 mL, until the liver turned pale. Perfusion with 4% paraformaldehyde was continued for a total of approximately 30 mL until the limbs were completely rigid. The mouse was then decapitated, and the brain tissue was carefully isolated and fixed in 4% paraformaldehyde in the dark for 24 h. Subsequently, the tissue was embedded in OCT and fixed. The tissue was dehydrated in a 15%-30% gradient sucrose solution, then sampled and embedded in OCT. Sections were cut at 20 μm thickness from the bregma -1.23 mm to -2.07 mm.

[0204] Sections were rinsed three times with PBS for 5 minutes each. Brain sections were then placed in a light-tight humidified chamber and completely immersed in blocking solution (0.5 g BSA + 50 mL 0.3% TrionX-100) for 1 hour at room temperature. IL-6 antibody was diluted in blocking solution according to the antibody data sheet and incubated overnight at 4°C. Sections were then rinsed three times with PBS for 5 minutes each. Secondary antibody was diluted in PBS and incubated for 2 hours at room temperature. Sections were then rinsed three times with PBS for 5 minutes each. Mounting medium containing DAPI was evenly applied to each section, and a coverslip was gently applied from one side. Images were taken using a Leica confocal microscope.

[0205] The results are as follows Figure 10 As shown in the data, the expression level of IL-6 in the amygdala of the SPS&S group was significantly higher than that of the CTL group, and the IL-6 level was decreased after injection of AAV-shRNA1 adeno-associated virus, which was consistent with the WB results. The injection of AAV-shRNA1 adeno-associated virus can significantly reduce the level of inflammatory factors in the amygdala.

[0206] (9) Immunofluorescence detection of c-Fos expression in the amygdala

[0207] Sections were rinsed three times with PBS for 5 minutes each. Brain sections were then placed in a light-tight humidified chamber and completely immersed in blocking solution (0.5 g BSA + 50 mL 0.3% TrionX-100) for 1 hour at room temperature. NeuN and c-FOS antibodies were diluted in blocking solution according to the ratio provided in the antibody data sheet and incubated overnight at 4°C. Sections were rinsed three times with PBS for 5 minutes each. Cy3 and Cy5 fluorescent secondary antibodies were diluted in PBS and incubated for 2 hours at room temperature. Sections were rinsed three times with PBS for 5 minutes each. DAPI-containing mounting medium was evenly applied to each brain section, and a coverslip was gently applied from one side. Images were taken using a Leica confocal microscope.

[0208] The results are as follows Figure 11 As shown in the figure, the expression of c-Fos in the SPS&S group was significantly higher than that in the CTL group, indicating that the neurons in the amygdala were in an activated state; after injection of AAV-shRNA1 adeno-associated virus, the expression of c-Fos decreased and the number of active neurons decreased.

[0209] The present invention clarifies the mechanism of action of FIBCD1 on PTSD ( Figure 12 ): PTSD increases the expression of FIBCD1 on microglia in the amygdala region of mice, and promotes the secretion of inflammatory factors through the TLR2-NFkB signaling pathway. The increased secretion of IL-6 leads to the activation of amygdala neurons, thereby causing abnormal fear memory.

[0210] In summary, the present invention has determined that FIBCD1 is expressed at an elevated level in the amygdala region of PTSD mice, suggesting that FIBCD1 is closely related to PTSD. High expression of FIBCD1 in the amygdala region plays a key role in the occurrence and development of PTSD and is an unfavorable factor. Inhibiting FIBCD1 as a target and its protein and function can have a good anti-PTSD effect, and has great potential in the treatment of PTSD, drug screening, and other aspects. To this end, the present invention designed a series of shRNAs that interfere with the expression of FIBCD1, and constructed AAV-shRNA adeno-associated viruses. After injecting AAV-shRNA adeno-associated viruses into the amygdala region of SPS&S mice, it was found that the PTSD-like symptoms caused by SPS&S could be reversed.

[0211] The present invention has been found to be merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that the present invention is susceptible to various modifications and variations. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. Use of shRNA that interferes with FIBCD1 expression in the preparation of a product for treating post-traumatic stress disorder, characterized in that: The shRNA is shRNA1 or shRNA2; The DNA sequence corresponding to the shRNA1 is shown in SEQ ID NO.5-6; The DNA sequence corresponding to the shRNA2 is shown in SEQ ID NO 8-9.

2. The use according to claim 1, characterized in that The Gene ID of the FIBCD1 is 84929.

3. Use of a recombinant plasmid in preparing a product for treating post-traumatic stress disorder, characterized in that: The recombinant plasmid contains shRNA that interferes with FIBCD1 expression; The shRNA is shRNA1 or shRNA2; The DNA sequence corresponding to the shRNA1 is shown in SEQ ID NO.5-6; The DNA sequence corresponding to the shRNA2 is shown in SEQ ID NO 8-9.

4. The use according to claim 3, characterized in that The Gene ID of the FIBCD1 is 84929.

5. Use of a carrier in preparing a product for treating post-traumatic stress disorder, characterized in that: The vector contains shRNA that interferes with FIBCD1 expression; The shRNA is shRNA1 or shRNA2; The DNA sequence corresponding to the shRNA1 is shown in SEQ ID NO.5-6; The DNA sequence corresponding to the shRNA2 is shown in SEQ ID NO 8-9.

6. The use according to claim 5, characterized in that The Gene ID of the FIBCD1 is 84929.

7. The use according to claim 5, characterized in that The vector is obtained by effectively linking the shRNA to an adeno-associated virus vector.

8. The use according to claim 7, characterized in that The adeno-associated virus vector is pHBAAV-U6-MCS-CMV-EGFP.

9. The use according to any one of claims 1 to 8, characterized in that The product described is a drug.

10. The use according to claim 9, characterized in that The dosage form of the drug includes one of a liquid dosage form and a solid dosage form.

11. The use according to claim 10, characterized in that The liquid dosage form includes any one of injection, solution, suspension, emulsion and aerosol, and the solid dosage form includes any one of tablet, capsule and powder.

Images