A soybean leaf-specific promoter Pcab1 and its applications
By cloning and applying the soybean leaf-specific promoter Pcab1, the problems of metabolic burden and heterologous protein accumulation caused by constitutive promoters in soybean transgenic technology have been solved, enabling specific expression in soybean leaves, improving ecological safety and production efficiency, and promoting sustainable agricultural development.
Patent Information
- Application Number
- CN202510566184.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2045-04-30
Smart Images

Figure CN120330190B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant biobreeding technology, and in particular to a soybean leaf-specific promoter Pcab1 and its applications. Background Technology
[0002] Soybeans are an important food and oilseed crop worldwide. In recent years, genetically modified soybeans have been successfully commercialized, bringing economic benefits, but their potential ecological risks and environmental problems have also attracted much attention. As the core organ of photosynthesis, the leaf's specific promoters enable the spatiotemporal specific expression of exogenous genes in the chloroplasts of mesophyll cells, avoiding problems such as root development inhibition or abnormal reproductive growth caused by constitutive promoters.
[0003] With breakthroughs in genetic transformation technology, promoters, as core components of gene expression regulation, are increasingly demonstrating their engineering application value. In crop transgenic systems, constitutive strong promoters drive the continuous expression of exogenous genes across the entire domain, which can easily lead to multiple negative effects: ① continuous activation of exogenous genes leads to increased metabolic load; ② accumulation of heterologous proteins in non-target tissues interferes with endogenous signaling pathways; ③ the frequency of transgene silencing increases. In contrast, tissue-specific promoters, by precisely locating the spatiotemporal patterns of gene expression, can achieve efficient enrichment of target products in specific organs while maintaining basal metabolic homeostasis in plants, demonstrating unique advantages in applications such as the targeted expression of C4 metabolic enzymes in photosynthetic tissues.
[0004] Therefore, providing a soybean leaf-specific promoter offers a new strategy for soybean-specific expression regulation, reduces ecological risks, improves the ecological safety and production efficiency of transgenic soybeans, and promotes sustainable agricultural development. Summary of the Invention
[0005] The purpose of this invention is to provide a soybean leaf-specific promoter Pcab1, which drives the specific expression of the target gene in soybean leaf tissue, overcoming the current lack of endogenous specific promoters in soybean.
[0006] This invention provides a soybean leaf-specific promoter Pcab1, the nucleotide sequence of which is shown in SEQ ID NO.4.
[0007] Preferably, the primer set used to amplify the soybean leaf-specific promoter Pcab1 is Pcab1-F1 and Pcab1-R1, the sequence of Pcab1-F1 is shown in SEQ ID NO.5, and the sequence of Pcab1-R1 is shown in SEQ ID NO.6.
[0008] The present invention also provides an expression cassette containing the aforementioned promoter Pcab1.
[0009] The present invention also provides the application of the promoter Pcab1 or the expression cassette in transgenic soybean.
[0010] Preferably, the method for constructing the genetically modified soybean includes the following steps:
[0011] (1) Construct an expression vector containing the soybean leaf-specific promoter Pcab1 and the target gene;
[0012] (2) Transform the expression vector from step (1) into Agrobacterium;
[0013] (3) The soybean explants were infected with Agrobacterium from step (2), and transgenic soybean plants were obtained after culturing and rooting.
[0014] Preferably, the backbone of the expression vector in step (1) is the pCAMBIA3300 plasmid.
[0015] This invention cloned the soybean leaf-specific promoter Pcab1 from the soybean variety Williams 82, fused it with the red fluorescent protein DsRed gene, and then transferred it into soybeans. Observation of the red fluorescent protein coloration in the transgenic soybean plants revealed that the coloration only occurred in the soybean leaves, indicating that the promoter is specifically expressed only in soybean leaf tissue. Compared with existing technologies, this invention overcomes the current lack of endogenous specific promoters in soybeans and has significant application value in gene function analysis and targeted genetic improvement, propelling crop improvement into a new stage of intelligent breeding characterized by "tissue specificity, metabolic direction, and dynamic regulation." Attached Figure Description
[0016] Figure 1 The relative expression levels of the Glyma.08G082900.1 gene at different sites in Example 1;
[0017] Figure 2 The results of PCR gel electrophoresis of the cloned promoter Pcab1 in Example 2;
[0018] Figure 3 This is the cis-element function of the promoter Pcab1 sequence in Example 3;
[0019] Figure 4 The image shows the pCAMBIA3300-Pcab1-DsRed recombinant expression vector from Example 4.
[0020] Figure 5 The results of the Pcab1-activated red fluorescent protein in the leaf area in Example 5 are shown. Detailed Implementation
[0021] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0022] The soybean variety Williams 82 described in this invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).
[0023] Example 1 verifies the transcriptional level of the Glyma.08G082900.1 gene in different tissues.
[0024] Based on transcriptome data analysis, a gene strongly expressed in soybean leaves, Glyma.08G082900.1, was selected. The expression levels of this candidate gene in different soybean tissues and organs were further validated using real-time quantitative PCR. Specifically, total RNA was extracted from root, leaf, stem, pod, and seed tissue samples at the mature stage of soybean plants. Real-time quantitative PCR was performed using specific primers Glyma.08G082900.1-F1 and Glyma.08G082900.1-R1. The detection instrument was an ABIPRISM 7500 Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). A 2... –ΔΔCT The relative expression level of the gene was detected using the Livak method. The RT-qPCR system consisted of 10 μL SYBR Green PCR Master Mix, 2 μL cDNA, 0.2 μL forward primer, 0.2 μL reverse primer, and ddH2O to a final volume of 20 μL. The RT-qPCR program was as follows: 94℃, 10 min; (94℃, 45 s; 60℃, 45 s; 72℃, 30 s) 35 cycles; 72℃, 10 min. Results are shown below. Figure 1 As shown.
[0025] The sequence of Glyma.08G082900.1 is shown in SEQ ID NO.1, and the specific sequence is as follows:
[0026] ATGGCAGCAGCTTCTTCCATGGCTCTCTCATCCCCATCCTTGGCTGGCAAGGCCGTGAAGCTGGGCCCATCAGCCCCAGAAGTGGGAAGGGTGAGCATGAGGAAGACCGTCACCAAGCAGGTCTCCTCAGGAAGCCCATGGTACGGCCCAGACCGAGTCAAGTACTTGGGCCCATTCTCTGGCGAGCCCCCGTCCTACCTAACCGGTGAGTTCCCAGGCGACTACGGCTGGGACACTGCTGGGCTTTCCGCAGACCCAGAAACCTTCGCCAAGAACCGTGAACTCGAAGTGATCCACTCCAGGTGGGCCATGCTCGGAGCCTTGGGCTGCGTCTTCCCGGAGTTGCTGTCCCGCAACGGGGTGAAGTTCGGAGAAGCCGTGTGGTTCAAGGCCGGGTCCCAGATCTTCAGCGAGGGTGGGCTCGACTACTTGGGCAACCCAAGCCTGATCCACGCCCAGAGCATCCTCGCCATCTGGGCCACACAAGTTATCCTAATGGGTGCCGTTGAAGGTTACCGTATTGCTGGTGGCCCCCTCGGTGAGGTCACTGACCCAATCTACCCAGGTGGCAGCTTCGACCCATTGGGCCTTGCTGATGACCCAGAGGCTTTTGCTGAGCTTAAGGTGAAGGAACTCAAGAACGGACGATTGGCCATGTTCTCTATGTTTGGCTTCTTTGTTCAGGCCATTGTCACCGGAAAGGGTCCATTGGAGAACCTCGCCGATCACCTTGCTGACCCTGTCAACAACAACGCCTGGGCCTATGCCACCAACTTCGTCCCCGGAAAGTGA;
[0027] The sequence of the specific primer Glyma.08G082900.1-F1 is shown in SEQ ID NO.2, and the specific sequence is: AACCGTGAACTCGAAGTGATCC;
[0028] The sequence of the specific primer Glyma.08G082900.1-F1 is shown in SEQ ID NO.3, and the specific sequence is: GGATAACTTGTGTGGCCCAGAT.
[0029] Depend on Figure 1 It can be seen that the expression level of the Glyma.08G082900.1 gene is highest in leaves, and its expression level is almost undetectable in other tissues such as stems and seeds, which confirms the specific expression characteristics of the Glyma.08G082900.1 gene in leaf tissues.
[0030] Example 2: Cloning of promoter Pcab1
[0031] Specific primers Pcab1-F1 and Pcab1-R1 were designed based on the promoter sequence of the soybean Glyma.08G082900.1 genome for PCR amplification. The amplification products were separated by electrophoresis on a 1% agarose gel (e.g., ...). Figure 2 (As shown). The agarose gel containing the target fragment was excised and collected into centrifuge tubes, recovered using the Omega Gel Extraction Kit, and cloned into the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.). The clones were then transformed into competent cells (DH5α). Positive clones were obtained through antibiotic selection. After colony PCR verification, sequencing confirmed that the inserted DNA fragment was 1642 bp. After sequence comparison confirmed that the sequence fragment was correct, it was named the leaf-specific promoter Pcab1.
[0032] The nucleotide sequence of the leaf-specific promoter Pcab1 is shown in SEQ ID NO.4, and the specific sequence is as follows:
[0033]
[0034] The primer Pcab1-F1 described above is shown in SEQ ID NO.5, and its specific sequence is as follows:
[0035] 5'-GGCCCTAGAATCAAACTTTCC-3';
[0036] The primer Pcab1-R1 described above is shown in SEQ ID NO.6, and its specific sequence is as follows:
[0037] 5'-TTTTTAACTCAAGGATGAGCTTTGC-3'.
[0038] The PCR amplification system is as follows: 25 μL of high-fidelity enzyme mix, 2 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and ddH2O added to a final volume of 50 μL.
[0039] The PCR amplification program of this invention is as follows: 95℃, 3 min; (95℃, 30 sec; 60℃, 30 sec; 72℃, 2 min;) 30 cycles; 72℃, 10 min.
[0040] Example 3: Analysis of the cis-component function of promoter Pgj4
[0041] The cis-elements of the promoter Pcab1 sequence cloned in Example 2 were analyzed using PlantPAN 4.0 online software, and the results are as follows: Figure 3 As shown.
[0042] The results showed that the promoter sequence contained elements such as circadian (AAAATATCT), LTR (CCGAAA), G-box (CACGTG), TATA-box (TATAWAW), TC-rich (ATTTTCTT), TATC-box (TATCCAC), and CAT-box (GCCACT).
[0043] Example 4: Obtaining transgenic soybeans containing the pCAMBIA3300-Pcab1-DsRed expression vector
[0044] The pCAMBIA3300-GUS vector (purchased from Beijing TransGen Biotech Co., Ltd.) was digested with EcoRI and HindIII enzymes and then linked with the DsRed gene to obtain pCAMBIA3300-DsRed.
[0045] The promoter Pcab1 fragment cloned from the pEASY-Blunt vector was seamlessly ligated into the pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Pcab1-DsRed recombinant expression vector (e.g., Figure 4 As shown in the image, the recombinant expression vector was introduced into Agrobacterium EHA105 (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain recombinant Agrobacterium. The transformation variety was Jiyu 86, and the specific transformation process is as follows:
[0046] (1) Pick a single colony carrying Agrobacterium EHA105 and inoculate it into 5mLYEP liquid medium (50mg / L spectinomycin, 25mg / L rifampin), and incubate overnight at 28°C. The next day, expand the culture (50mLYEP) to OD. 600nm The OD value was 0.6. After centrifugation at 3000 rpm for 10 min, the bacterial cells were resuspended in a liquid co-culture medium (B5 salt 0.321 g / L, sucrose 30 g / L, 2-morpholinoethanesulfonic acid (MES) 3.9 g / L, 6-benzylaminopurine (BAP) 1.67 mg / L, gibberellin (GA3) 0.25 mg / L, cysteine 400 mg / L, dithiothreitol (DTT) 154.2 mg / L, acetylsuccinone (AS) 200 μmol / L, pH 5.4), and the OD value was adjusted. 600nm Set aside until 0.5 is available.
[0047] (2) Agrobacterium infection
[0048] Soybean leaves were cut open along the hilum of the seed using a scalpel, the skin was removed, and slight incisions were made at the cotyledon nodes. The prepared explants were then placed in resuspended Agrobacterium for 30 min of infection. The infected explants were then transferred to co-culture medium (B5 salt 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA 30.25 mg / L, cysteine 400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, agar powder 5 g / L, pH 5.4) and incubated in the dark at 23°C for 4 days.
[0049] (3) Adventitious bud induction
[0050] After co-culturing the explants for 4 days, they were transferred to induction medium (B5 salt 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cephalosporin 250 mg / L, timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7). The cotyledonary nodes and hypocotyl portions of the explants were inserted into the medium with the adaxial surface facing upwards at a 45° angle to the horizontal plane. The explants were cultured at 25°C under 16 / 8h light / dark conditions for approximately 2 weeks. The explants were then removed, and excess hypocotyl portions were trimmed, leaving only 5 mm. The explants were then transferred to fresh induction medium and cultured for another 2 weeks under the same conditions.
[0051] (4) Bud elongation
[0052] The induced shoot clusters (with cotyledon tissue removed) were transferred to shoot elongation medium (MS salt 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA 30.5 mg / L, zeatin 1.0 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5 mg / L, agar powder 8 g / L, pH 5.7) and cultured at 25°C with a 16 / 8 h light / dark cycle. Subcultures were performed every 2 weeks.
[0053] (5) Rooting
[0054] When the resistant shoots reach about 4 cm in length, cut them off and soak them in IBA (1 mg / L) for 30 seconds. Then transfer them to rooting medium (MS salt 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IBA 1.0 mg / L, plant gel 3 g / L, pH 5.6) for further cultivation. Once robust roots have developed, transplant them into a greenhouse for growth and fruiting.
[0055] Using promoter Pcab1 specific primers, PCR detection was performed on T1 generation transgenic soybeans. Combined with herbicide screening, red fluorescence was observed after obtaining pCAMBIA3300-Pcab1-DsRed transgenic soybean plants.
[0056] Example 5
[0057] Tissue-specific expression analysis of T1 generation transgenic pCAMBIA3300-Pcab1-DsRed soybean plants was performed using the LUYOR-3415RG dual-wavelength fluorescence imaging system. The results are as follows: Figure 5 As shown:
[0058] The results showed that the transgenic soybean plants exhibited red fluorescence in the leaves, but not in other parts, further verifying the specific expression of the promoter Pcab1 in leaf tissues.
[0059] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The application of a soybean leaf-specific promoter Pcab1 in driving the specific expression of a target gene in soybean leaves, characterized in that, The nucleotide sequence of the soybean leaf-specific promoter Pcab1 is shown in SEQ ID NO.
4.
2. The application as described in claim 1, characterized in that, The primer sets used to amplify the soybean leaf-specific promoter Pcab1 are Pcab1-F1 and Pcab1-R1, the sequence of Pcab1-F1 is shown in SEQ ID NO.5, and the sequence of Pcab1-R1 is shown in SEQ ID NO.
6.
3. The application of a soybean leaf-specific promoter Pcab1 in the construction of transgenic soybeans, characterized in that, The nucleotide sequence of the soybean leaf-specific promoter Pcab1 is shown in SEQ ID NO.
4. The specific promoter Pcab1 drives the specific expression of the target gene in soybean leaves.
4. The application as described in claim 3, characterized in that, The method for constructing the genetically modified soybean includes the following steps: (1) Construct an expression vector containing the soybean leaf-specific promoter Pcab1 and the target gene; (2) Transform the expression vector from step (1) into Agrobacterium; (3) The soybean explants were infected with Agrobacterium from step (2), and transgenic soybean plants were obtained after culturing and rooting.
5. The application as described in claim 4, characterized in that, The backbone of the expression vector in step (1) is the pCAMBIA3300 plasmid.