A root-specific promoter pgj4 of soybean and application thereof

By developing the soybean root-specific promoter Pgj4, cloning and introducing it into soybean plants, root-specific gene expression was achieved. This solved the risks and metabolic overload problems of existing promoters in crop genetic improvement and provided a precise means of gene regulation.

CN120330193BActive Publication Date: 2026-06-23JILIN ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JILIN ACAD OF AGRI SCI
Filing Date
2025-04-30
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing constitutive promoters pose risks of horizontal gene transfer and gene silencing effects in crop genetic improvement, and their global activation mode is prone to causing plant metabolic flux overload, making it difficult to achieve four-dimensional precise control of gene transcription activity.

Method used

We developed the root-specific promoter Pgj4 for soybean, cloned the Pgj4 promoter fragment from the soybean genome using specific primers, constructed a recombinant vector with the fluorescent reporter gene DsRed, and introduced it into soybean plants to achieve root tissue-specific expression.

Benefits of technology

This study achieved root-specific gene expression in soybeans, overcoming the problem of insufficient existing promoters and providing novel genetic manipulation elements for targeted regulation of root gene function analysis and precision molecular breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330193B_ABST
    Figure CN120330193B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of plant genetic engineering, and provides a soybean root-specific promoter Pgj4, wherein the nucleotide sequence of the root-specific promoter Pgj4 is shown as SEQ ID NO. 1. The present application also provides a primer set for the root-specific promoter Pgj4, and a recombinant vector and a recombinant bacteria containing the root-specific promoter Pgj4. The root-specific promoter Pgj4 is specifically expressed in the root tissue of transgenic soybean plants. This provides a precise molecular tool for root development mechanism analysis, rhizosphere interaction research and stress resistance genetic engineering, and has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a root-specific promoter of soybean, Pgj4, and its applications. Background Technology

[0002] As the core hub of plant matter-energy exchange and a primary responder to stress signals, the innovative development of tissue-specific regulatory elements in roots has become a cutting-edge hot topic in precision crop breeding. Based on root-targeted expression engineering element systems, researchers can optimize crop root architecture, enhance nutrient capture efficiency, improve resistance to abiotic stresses, and simultaneously construct root-based disease and pest defense barriers, providing an important technical pathway to overcome traditional breeding bottlenecks. Research in this field will promote the deep integration of root biology theory with the needs of modern agriculture, laying the molecular regulatory foundation for cultivating environmentally intelligent crops.

[0003] Upstream promoters, acting as "smart switches" in plant genetic regulatory networks, integrate spatiotemporal dynamic regulatory networks with environmental response mechanisms to achieve precise four-dimensional control of gene transcriptional activity (time, space, intensity, and environmental interactions). In crop genetic improvement engineering, the creation of breakthrough promoter elements has been listed as a strategic high ground in modern agricultural biotechnology. Although currently mainstream constitutive strong promoter systems (such as CaMV 35S and maize Ubi) demonstrate universal advantages in basic research, their technological limitations are becoming increasingly prominent with the upgrading demands of precision breeding: First, heterologous viral promoters pose a risk of horizontal gene transfer, and their cross-species recombination potential has been proven to induce niche imbalance; second, while endogenous constitutive promoters avoid biosafety issues, their global activation mode easily triggers gene silencing effects, and continuous overexpression leading to metabolic overload can cause decreased photosynthetic efficiency and reproductive developmental arrest in plants.

[0004] Based on this, constructing an intelligent starter subsystem integrating "environmental perception, signal transduction, and targeted activation," and especially exploring novel regulatory elements with root-specific responses, dynamic regulation of vascular bundles, or stress pulse activation characteristics, has become a core research direction for realizing modular design of crop traits and construction of biosafety barriers. Summary of the Invention

[0005] The purpose of this invention is to provide a root-specific promoter for soybean, Pgj4.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides a root-specific promoter Pgj4 for soybean, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The present invention provides a primer set for cloning the root-specific promoter Pgj4, the primer set including Pgj4-F1 and Pgj4-R1, the sequence of Pgj4-F1 is shown in SEQ ID NO.2, and the sequence of Pgj4-R1 is shown in SEQ ID NO.3.

[0009] This invention provides a kit containing the above-described primer set.

[0010] The present invention provides a method for constructing the root-specific promoter Pgj4, comprising the following steps: using the soybean Glyma.15G218900.1 gene promoter sequence as a template, PCR amplification is performed using the above-mentioned primer set to obtain the sequence fragment of the root-specific promoter Pgj4.

[0011] The present invention provides a recombinant vector containing the root-specific promoter Pgj4 described above.

[0012] The present invention provides a method for constructing the recombinant vector, comprising the following steps: ligating the enzyme-digested pCAMBIA3300 vector with the root-specific promoter Pgj4 described above, thereby obtaining the vector.

[0013] The present invention provides a recombinant bacterium containing the above-mentioned recombinant vector.

[0014] This invention provides the application of the root-specific promoter Pgj4, the kit, the recombinant vector, or the recombinant bacteria in plant root tissue-specific expression.

[0015] This invention also provides a method for constructing transgenic soybean plants, comprising the following steps:

[0016] (1) The recombinant bacteria were used to infect the target soybean plants, and then clustered shoots were induced.

[0017] (2) Inoculate the clustered shoots into the shoot elongation medium and culture them until the shoots are 3-5 cm long. Then inoculate them into the rooting medium and continue to culture to obtain transgenic soybean plants with root tissue-specific expression.

[0018] Preferably, step (1) involves induction in an induction medium containing water as a solvent and comprising the following components in the indicated concentrations: B5 salt 3.1-3.4 g / L, sucrose 28-32 g / L, MES 0.4-0.65 g / L, BAP 1.5-1.8 mg / L, cephalosporin 240-260 mg / L, Timentin 90-110 mg / L, glufosinate 5-6 mg / L, and agar powder 6-10 g / L.

[0019] Preferably, the shoot elongation medium uses water as a solvent and consists of the following components at the following mass concentrations: MS salt 4.2-4.6 g / L, sucrose 28-32 g / L, MES 0.4-0.65 g / L, aspartic acid 48-52 mg / L, L-glutamic acid 48-52 mg / L, IAA 0.08-0.12 mg / L, GA3 0.4-0.6 mg / L, zeatin nucleoside 0.9-1.1 mg / L, cephalosporin 240-260 mg / L, Timentin 90-110 mg / L, glufosinate 5-6 mg / L, and agar powder 6-10 g / L.

[0020] Preferably, the rooting medium uses water as a solvent and consists of the following components in the indicated mass concentrations: MS salt 4.2-4.6 g / L, sucrose 18-22 g / L, MES 0.4-0.65 g / L, aspartic acid 48-52 mg / L, L-glutamic acid 48-52 mg / L, IBA 0.8-1.2 mg / L, and plant gel 2-4 g / L.

[0021] By adopting the above technical solution, the present invention has the following beneficial effects:

[0022] In this invention, the root-specific expression gene Glyma.15G218900.1 was screened from the soybean transcriptome database. Specific primers were designed through genome sequence analysis, and the root-specific promoter Pgj4 fragment of this gene was successfully cloned from the genomic DNA of the soybean variety Williams 82. The obtained Pgj4 promoter sequence was fused with the red fluorescent protein reporter gene DsRed to construct the fusion expression vector pCAMBIA3300-Pgj4-DsRed, which was then introduced into target soybean plants using genetic transformation technology to obtain transgenic soybean plants.

[0023] Experiments showed that the Glyma.15G218900.1 gene was expressed at the highest abundance in soybean roots, and the DsRed fluorescence signal was specifically limited to the roots of transgenic soybean plants. Compared with existing technologies, the Pgj4 promoter identified in this invention has a significant root tissue specificity advantage, overcoming the current lack of endogenous specific promoters in soybeans, and providing a novel genetic manipulation element for targeted regulation of root gene function and precision molecular breeding. Attached Figure Description

[0024] Figure 1 The image shows the RT-qPCR results of the Glyma.15G218900.1 gene in different tissue sites.

[0025] Figure 2 Image of PCR gel electrophoresis results for cloning promoter Pgj4;

[0026] Figure 3 The prediction results for the cis-acting elements of the root-specific promoter Pgj4 are shown in the figure.

[0027] Figure 4 Composition diagram of the pCAMBIA3300-Pgj4-DsRed recombinant vector;

[0028] Figure 5 The image shows the red fluorescence results of different parts of the pCAMBIA3300-Pgj4-DsRed transgenic soybean plant. Detailed Implementation

[0029] This invention provides a root-specific promoter Pgj4 for soybean, the nucleotide sequence of which is shown in SEQ ID NO.1. The specific sequence is as follows:

[0030] TCGGTACTACCTTTAACTCCAGAATACTTTTTTATTCTAATTTATTATTGT

[0031] TTTAACTTTTTAGATTTCATTATTTATCTTTTTAATGGATTAAATTTATTT

[0032] TTTATCCCAGTAATTTTATGAATATGCAAATTTTGGTCCCTACAAATTAATT

[0033] TAATGGCATATTTTGGTTCCCAAGTTTTCCAAAATTAAGAAATGATAGTC

[0034] TCCCATTAATATGTCTCCAATTGTTAATAGAAAACGTTGATATGTCCGT

[0035] AAGTGATAACACATGCTAGTTACTATCCATGCATGGGAGATATACTATGG

[0036] TTGGGAAAGAGTGAAGAAGGACGAGAAGGAAGAGAGATATAGTATGT

[0037] TGGAATCCCTCAAGATATTTTAATAAAATTAATAAATTAATATTTGTTGAT

[0038] TAAAAAAATCAATTCATGCTAGTGTTTAAATCCCAATACACGTGGATTA

[0039] ACTTTATTCTATATTTTTTTCACGGTTAATATGGAAACATTATATTTTCAG

[0040] GGTTTTAAAACTTTGATTTGGCCGGGAGTAGTAGGGGCCTAGGGGGTA

[0041] AGGTAACTCGTTCGAGAATTGCTTTGCAGTGCGTTCTTCCCTGAAGTTA

[0042] CGAAGAACAAGAGATAACGTGCTAGTTCCAATGATTAATGGTGGTAAT

[0043] GGGTAACGTGTTTTGCTCCACTAATTTACTAAGATTAACTTTGAATCCT

[0044] TGTCGGTTATACCTAGCAATAGAATATTTCCTCAGTATTTATGCACAAGCG

[0045] AGCTTTGCTGAGATAATACATGAATTAAAAATCTCCAAGCCACCTTTGC

[0046] TAAATCGCATAAGCTAAGCCAACGAACGGAATTAGTCCATGTACAAATC

[0047] AACAATCACAATTTAACTTTACTAAACATCGCTTACAATTCTTTTATATAT

[0048] TTCAATTTTTTTAAAGCTACTATCACATTTGAATTTTTATTTTTAAATATTTT

[0049] ATACTACGTGGATAAATAACTGACACCTATTTTCACTAACGGACATGTC

[0050] AGTGTTTTCCATTAACAATTGGATGGCATATTAACAATGGACAAAAATG

[0051] ATTAATTTTAGAAAACTAAAGGACTAAAGTGTGATTCAATTTTCATAAG

[0052] GATCAAAATTATATAATTACTAAATGAAAAGGGAATTGACGCTTATTATT

[0053] TTTTATAAGAATACAATTGAAAAAAAATTATCAAGAAGTTTTACAATAAT

[0054] AGATAAGCATAGAAATAACATTTTTTCTATAAAAGTAACAAAACAAAAG

[0055] AAACGCAGATAATATTAAAATTTCAAATTAAGTAATAAAATTTATTAATT

[0056] AAATTGTAAAACTTATTACTAAAAAAACTCATACTAAAAATATAAAAAC

[0057] TACAAATTTAGTAACAACAAACTTTTATTTTTTGGCCTGGAATATATGTC

[0058] TATTACTAAATTTGGAATATTTAAAATAAAATGATTGGGTACTTTTTTTTC

[0059] CTTGTAGGGTATTGAATATGGACCCCACACTTTAATTATTTAGTTGTTAG

[0060] GAGTGGGTAAATTATGGTCTTTTTAAGTCACATTTGTTCGCAATATTCAT

[0061] CCCCATCTCCCATCTTTGTTTGTTCCATCTCTTGCTTCTTGCTTCTATTACTTGCTTCTTTCTTCACC.

[0062] The present invention also provides a primer set for cloning the root-specific promoter Pgj4, the primer set comprising Pgj4-F1 and Pgj4-R1, wherein the sequence of Pgj4-F1 is shown in SEQ ID NO.2, specifically 5'-TCGGTACTACCTTTAACTCCAG-3'; and the sequence of Pgj4-R1 is shown in SEQ ID NO.3, specifically 5'-GGTGAAGAAAGAAGCAAGTA-3'.

[0063] The present invention also provides a kit containing the above-described primer set.

[0064] The present invention also provides a method for constructing the root-specific promoter Pgj4, comprising the following steps: using the soybean Glyma.15G218900.1 gene promoter sequence as a template, performing PCR amplification using the above-mentioned primer set to obtain the sequence fragment of the root-specific promoter Pgj4.

[0065] In this invention, the sequence of the soybean Glyma.15G218900.1 gene is as shown in SEQ ID. As shown in NO.6, the specific sequence is ATGTCACTTGCTGGGAAAATCACCACTGAAATTGGGGTTCATGCAACCGCTGCAAAGTGGTTCAACCTCTTTGCAACACAACTTCATCATGTTCAAAACCTTACTGATAGAGTACATGGAACCAAGCTGCATCAAGGTGAAGACTGGCATCACAACGAGACAGTCAAACACTGGACTTATACCATAGATGGTAAGGCTACAACATGTCTGGAGAGTATTGAATC CATTGATGAACAGAACAAAACAATCACCTACAAGCTCTTCAGTGGAGACATTGATCATAAGTATAAGAAATTTAAGTTCACCTTTCAAGCCATTGATAAGGATCAAGGCGGTGCTTTTATTAAATGGACGGTTGAATATGAAAGGCTTGCTGAGGAGGTTGATCCTCCATATGGATACATCGAATACCTGCACAAATGCACTAAAGATATTGATGTTCATCTTCTCAAAGCATAG.

[0066] In this invention, the PCR amplification system includes 25 μL of high-fidelity enzyme mix, 2 μL of template, 11 μL of primer Pgj4-F1, 11 μL of primer Pgj4-R1, and ddH2O added to bring the total to 50 μL.

[0067] In this invention, the PCR amplification program is 95°C for 3 min; (95°C for 30 sec; 60°C for 30 sec; 72°C for 2 min;) 30 cycles; 72°C for 10 min.

[0068] The present invention provides a recombinant vector containing the root-specific promoter Pgj4 described above.

[0069] The present invention provides a method for constructing the recombinant vector, comprising the following steps: ligating the enzyme-digested pCAMBIA3300 vector with the root-specific promoter Pgj4 described above, thereby obtaining the vector.

[0070] The present invention provides a recombinant bacterium containing the above-mentioned recombinant vector.

[0071] This invention provides the application of the root-specific promoter Pgj4, the kit, the recombinant vector, or the recombinant bacteria in plant root tissue-specific expression.

[0072] This invention also provides a method for constructing transgenic soybean plants, comprising the following steps:

[0073] (1) The recombinant bacteria were used to infect the target soybean plants, and then clustered shoots were induced.

[0074] (2) Inoculate the clustered shoots into the shoot elongation medium and culture them until the shoots are 3-5 cm long. Then inoculate them into the rooting medium and continue to culture to obtain transgenic soybean plants with root tissue-specific expression.

[0075] In this invention, step (1) involves induction in an induction medium using water as a solvent. The induction medium preferably comprises the following components at the following mass concentrations: B5 salt 3.1-3.4 g / L, sucrose 28-32 g / L, MES 0.4-0.65 g / L, BAP 1.5-1.8 mg / L, cephalosporin 240-260 mg / L, Timentin 90-110 mg / L, glufosinate 5-6 mg / L, and agar powder 6-10 g / L; more preferably, B5 salt 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5-6 mg / L, and agar powder 8 g / L.

[0076] In this invention, the shoot elongation medium uses water as a solvent and preferably consists of components comprising the following mass concentrations: MS salt 4.2-4.6 g / L, sucrose 28-32 g / L, MES 0.4-0.65 g / L, aspartic acid 48-52 mg / L, L-glutamic acid 48-52 mg / L, IAA 0.08-0.12 mg / L, GA3 0.4-0.6 mg / L, zeatin nucleoside 0.9-1.1 mg / L, cephalosporin 240-260 mg / L, Timentin 90-110 mg / L, glufosinate 5-6 mg / L, and agar powder 6-10 g / L; more preferably, MS salt 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, and IAA. 0.1 mg / L, GA3 0.5 mg / L, zeatin nucleoside 1.0 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5-6 mg / L, and agar powder 8 g / L.

[0077] In this invention, the rooting medium uses water as a solvent and preferably consists of components with the following mass concentrations: MS salt 4.2-4.6 g / L, sucrose 18-22 g / L, MES 0.4-0.65 g / L, aspartic acid 48-52 mg / L, L-glutamic acid 48-52 mg / L, IBA 0.8-1.2 mg / L, and plant gel 2-4 g / L; more preferably, MS salt 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IBA 1.0 mg / L, and plant gel 3 g / L.

[0078] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0079] The soybean variety Williams 82 described in this invention can be obtained from the National Crop Germplasm Resources Platform (website: http: / / www.cgris.net / home).

[0080] Example 1: Transcriptional levels of the Glyma.15G218900.1 gene in different tissues

[0081] Total RNA was extracted from root, leaf, stem, pod, and seed tissue samples of mature soybean plants. cDNA was transcribed and specific primers Glyma.15G218900.1-F1 and Glyma.15G218900.1-R1 were designed. Real-time quantitative PCR was then performed using these specific primers to verify the expression level of Glyma.15G218900.1 in different soybean tissues and organs. The detection instrument was an ABI PRISM 7500Fast Real-Time PCR System (Applied Biosystems, CA, USA), and the internal reference gene was GmACT6 (GenBank No. NM_001289231). A 23 –ΔΔCT The relative expression level of genes was detected by the (Livak) method.

[0082] The sequence of the soybean Glyma.15G218900.1 gene described in this invention is shown in SEQ ID NO.6; the sequence of Glyma.15G218900.1-F1 is shown in SEQ ID NO.4, specifically 5'-AGACTGGCATCACAACGAGAC-3'; and the sequence of Glyma.15G218900.1-R1 is shown in SEQ ID NO.5, specifically 5'-GCACCGCCTTGATCCTTATCA-3'.

[0083] The RT-qPCR program is as follows: 94℃, 10 min; (94℃, 45 s; 60℃, 45 s; 72℃, 30 s) 35 cycles; 72℃, 10 min.

[0084] The RT-qPCR system consisted of 10 μL of SYBR Green PCR MasterMix, 2 μL of cDNA template, 0.2 μL of primer Glyma.15G218900.1-F, 0.2 μL of primer Glyma.15G218900.1-R, and ddH2O added to bring the total volume to 20 μL.

[0085] The results showed that the Glyma.15G218900.1 gene was expressed at the highest level in roots, while its expression was almost undetectable in other tissues such as leaves and stems (e.g., roots). Figure 1 Consistent with transcriptome data, this confirms the root-specific expression characteristics of the Glyma.15G218900.1 gene.

[0086] Example 2: Cloning of the Glyma.15G218900.1 gene promoter Pgj4

[0087] Specific primers were designed based on the promoter sequence of the soybean Glyma.15G218900.1 genome, followed by PCR amplification. The amplification products were separated by electrophoresis on a 1% agarose gel (electrophoresis results are shown in Figure 1). Figure 2 (As shown). The agarose gel containing the target fragment was excised and collected into centrifuge tubes, recovered using the Omega Gel Extraction Kit, and cloned into the pEASY-Blunt vector (purchased from Beijing TransGen Biotech Co., Ltd.). The clones were then transformed into competent DH5α cells. Positive clones were obtained through antibiotic selection. After colony PCR verification, sequencing confirmed that the inserted DNA fragment was 1611 bp. After sequence comparison confirmed that the sequence fragment was correct, the inventors named this sequence fragment the root-specific promoter Pgj4.

[0088] The primer set designed in this invention includes Pgj4-F1 and Pgj4-R1. The sequence of Pgj4-F1 is shown in SEQ ID NO.2, specifically 5'-TCGGTACTACCTTTAACTCCAG-3'; the sequence of Pgj4-R1 is shown in SEQ ID NO.3, specifically 5'-GGTGAAGAAAGAAGCAAGTA-3'.

[0089] The PCR amplification system of this invention is as follows: 25 μL of high-fidelity enzyme mix, 2 μL of template, 11 μL of primer Pgj4-F, 11 μL of primer Pgj4-R, and ddH2O added to a final volume of 50 μL. The PCR amplification program of this invention is as follows: 95℃, 3 min; (95℃, 30 sec; 60℃, 30 sec; 72℃, 2 min;) 30 cycles; 72℃, 10 min.

[0090] The colony PCR amplification system described in this invention includes 10 μL of 2X PCR MasterMix, 1 μL of template, 1 μL of forward primer, 1 μL of reverse primer, and ddH2O added to a final volume of 20 μL. The colony PCR amplification program is as follows: 95℃, 3 min; (95℃, 30 sec; 60℃, 30 sec; 72℃, 2 min;) 30 cycles; 72℃, 10 min. The forward primer used is the same as the Pgj4-F1 sequence, and the reverse primer is the same as the Pgj4-R1 sequence.

[0091] Example 3: Analysis of the cis-component function of promoter Pgj4

[0092] The promoter Pgj4 sequence obtained in Example 2 was analyzed using PlantPAN 4.0 online software.

[0093] The results show that the Pgj4 promoter sequence contains cis-elements with AuxRR-core, CAAT-box, ABRE, TC-richrepeats, ARE, and WUN-motif effects (such as...). Figure 3 (As shown).

[0094] The sequence of the AuxRR-core is shown in SEQ ID NO.7, specifically GGTCCAT; the sequence of the CAAT-box is shown in SEQ ID NO.8, specifically CCAAT; the sequence of the ABRE is shown in SEQ ID NO.9, specifically ACGTGGC; the sequence of the TC-rich repeats is shown in SEQ ID NO.10, specifically ATTTCTCTTCT; the sequence of the ARE is shown in SEQ ID NO.11, specifically GGTTT; and the sequence of the WUN-motif is shown in SEQ ID NO.12, specifically AAATTTCCT.

[0095] Example 4: Obtaining transgenic soybeans containing the pCAMBIA3300-Pgj4-DsRed recombinant vector

[0096] The pCAMBIA3300 vector (purchased from Beijing TransGen Biotech Co., Ltd.) was digested with EcoRI and HindIII and then ligated with the red fluorescent protein reporter gene DsRed to obtain pCAMBIA3300-DsRed.

[0097] The Glyma.15G218900.1 promoter Pgj4 fragment cloned from the pEASY-Blunt vector was seamlessly ligated and inserted into the pCAMBIA3300-DsRed expression vector to obtain the pCAMBIA3300-Pgj4-DsRed recombinant vector (e.g., Figure 4 (As shown).

[0098] Agrobacterium-mediated transformation was performed by introducing the pCAMBIA3300-Pgj4-DsRed recombinant vector into Agrobacterium EHA105 (purchased from Beijing TransGen Biotech Co., Ltd.) to obtain recombinant Agrobacterium. The specific transformation procedure is as follows:

[0099] (1) Pick a single colony carrying Agrobacterium EHA105 and inoculate it in 5ml LYEP liquid medium (50-100mg / L spectinomycin, 25mg / L rifampin), and incubate overnight at 28°C. The next day, expand the culture to OD on 50ml LYEP medium. 600nmThe OD value was 0.6-0.8. After centrifugation at 3000 rpm for 10 min, the bacterial cells were resuspended in a liquid co-culture medium (components: B5 salt 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA 30.25 mg / L, cysteine ​​400 mg / L, DTT 154.2 mg / L, and AS 200 μmol / L, pH 5.4). The OD value was adjusted... 600nm Set aside until 0.5 is available.

[0100] (2) Agrobacterium infection

[0101] Using a scalpel, the seeds of the Jiyu 86 soybean variety were split open along the hilum, the skin was removed, and slight incisions were made at the cotyledon nodes. The prepared explants were then placed in resuspended Agrobacterium for 30 min of infection. The infected explants were then transferred to a co-culture medium (composed of B5 salt 0.321 g / L, sucrose 30 g / L, MES 3.9 g / L, BAP 1.67 mg / L, GA 30.25 mg / L, cysteine ​​400 mg / L, DTT 154.2 mg / L, AS 200 μmol / L, and agar powder 5 g / L, pH 5.4) and incubated in the dark at 23°C for 4 days.

[0102] (3) Adventitious bud induction

[0103] After co-culturing the explants for 4 days, the explants were transferred to induction medium (composed of B5 salt 3.21 g / L, sucrose 30 g / L, MES 0.59 g / L, BAP 1.67 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5-6 mg / L, and agar powder 8 g / L, pH 5.7). The cotyledonary nodes and hypocotyl portions of the explants were inserted into the medium with the adaxial surface facing upwards at a 45° angle to the horizontal plane. The explants were cultured at 25°C under 16 / 8h light / dark conditions for approximately 2 weeks. The explants were then removed, and excess hypocotyl portions were trimmed, leaving only 5 mm. The explants were then transferred to fresh induction medium and cultured for another 2 weeks under the same conditions.

[0104] (4) Bud elongation

[0105] The induced shoot clusters (with cotyledon tissue removed) were transferred to shoot elongation medium (composed of MS salt 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IAA 0.1 mg / L, GA 30.5 mg / L, zeatin nucleoside 1.0 mg / L, cephalosporin 250 mg / L, Timentin 100 mg / L, glufosinate 5-6 mg / L, and agar powder 8 g / L, pH 5.7) and cultured at 25°C with a 16 / 8 h light / dark cycle. Subculture was performed every 2 weeks.

[0106] (5) Rooting

[0107] When the resistant shoots reach 3-5 cm in length, cut them off and soak them in IBA (1 mg / L) for 30 seconds. Then transfer them to rooting medium (composed of MS salt 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, aspartic acid 50 mg / L, L-glutamic acid 50 mg / L, IBA 1.0 mg / L, and plant gel 3 g / L, pH 5.6) for further cultivation. Once robust roots have developed, transplant them into a greenhouse for growth and fruiting.

[0108] Using a specific primer for the promoter Pgj4, PCR detection was performed on T1 generation transgenic soybeans. Combined with herbicide screening, transgenic soybeans containing pCAMBIA3300-Pgj4-DsRed were obtained and red fluorescence was observed.

[0109] Example 5

[0110] The LUYOR-3415RG dual-wavelength fluorescence imaging system was used to analyze the tissue-specific expression of T1 generation pCAMBIA3300-Pgj4-DsRed soybean plants and to observe the red fluorescence in different parts of the pCAMBIA3300-Pgj4-DsRed transgenic soybean plants.

[0111] The results showed that only the roots of the transgenic soybean plants exhibited red fluorescence (e.g., ...). Figure 5 As shown in the figure, this indicates that the promoter Pgj4 is specifically expressed in the root tissue.

[0112] In summary, the present invention successfully cloned the root-specific promoter Pgj4 fragment from the genomic DNA of the soybean variety Williams 82, and further obtained transgenic soybean plants containing the expression vector pCAMBIA3300-Pgj4-DsRed. This invention verified that the Glyma.15G218900.1 gene has the highest expression abundance in soybean roots, and the DsRed fluorescence signal is specifically limited to the roots of transgenic soybean plants, indicating that the Pgj4 promoter has a significant root tissue-specific advantage.

[0113] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a soybean root-specific promoter Pgj4 in driving the specific expression of a target gene in soybean root tissue, characterized in that, The nucleotide sequence of the root-specific promoter Pgj4 is shown in SEQ ID NO.1.

Citation Information

Patent Citations

  • Specific promoter Glyma12g02240 of soybean root tissue and application of specific promoter Glyma12g02240

    CN112813068A