A pharmaceutical composition containing nuclear autoantigen sperm protein for promoting myocardial regeneration repair and application

Abstract

The application relates to the technical field of biological medicine, and discloses a drug composition containing nuclear autoantigen sperm protein for promoting myocardial regeneration and repair and application, which comprises an NASP gene; the nucleotide sequence of the NASP gene is shown as SEQ ID NO:1, and the amino acid sequence encoded by the NASP gene is shown as SEQ ID NO:2. The drug composition can promote the number of myocardial cells, repair the necrotic myocardium, and thus improve acute myocardial infarction at the gene level.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a drug combination and application containing sperm protein with nuclear autoantigen that promotes myocardial regeneration and repair. Background Technology

[0002] The incidence and mortality rates of acute myocardial infarction (AMI) continue to rise rapidly. Current treatments primarily focus on revascularizing the infarcted coronary arteries to improve myocardial perfusion, but this does not increase the number of cardiomyocytes or repair necrotic myocardium. Identifying effective targets for cardiomyocyte regeneration and promoting the repair of cardiac tissue and function is crucial for slowing or even reversing the progression of post-infarction disease. Research has found that mammalian hearts retain regenerative capacity within the first seven days after birth. After a myocardial infarction, the endogenous proliferative capacity of the myocardium rapidly initiates within this period, ultimately achieving complete repair of cardiac tissue and function. However, this regenerative capacity rapidly disappears after seven days. Currently, several genes, including ERBB2 and Hippo / YAP, have been found to have weakened or absent expression after birth; restoring their expression in adulthood can restart the endogenous myocardial regeneration and repair capacity of the damaged heart. Therefore, increasing the number of cardiomyocytes and repairing necrotic myocardium at the gene level is a key technology for improving myocardial infarction.

[0003] Nuclear self-antigen sperm protein (NASP) is a histone molecular chaperone encoded by the NASP gene. It has a molecular weight of 85.2 kDa and consists of 788 amino acids, exhibiting high sequence conservation in humans and mice. NASP exists in two forms: somatic NASP (sNASP), expressed in all mitotic cells and located in the nucleus, and testicular NASP (tSNAP), expressed in embryonic tissues, tumor cells, and the testis. NASP primarily binds to H1 histones and HSP90 proteins, facilitating the transport of histones to the dividing cell nucleus, and is essential for DNA replication, cell cycle progression, and cell proliferation. NASP is highly expressed in neonatal hearts but less so in adult hearts. A literature search of domestic and international sources revealed no studies on how NASP protein improves cardiac function after myocardial infarction by promoting cardiomyocyte regeneration. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a drug combination and application containing sperm protein with nuclear autoantigen that promotes myocardial regeneration and repair. The drug combination of this invention can promote the number of cardiomyocytes and repair necrotic myocardium at the gene level, thereby improving acute myocardial infarction.

[0005] This invention provides the use of a pharmaceutical composition containing nuclear autoantigen sperm protein in the preparation of a medicament for treating acute myocardial infarction, wherein the pharmaceutical composition includes the NSP gene;

[0006] The nucleotide sequence of the NASP gene is shown in SEQ ID NO:1, and the amino acid sequence it encodes is shown in SEQ ID NO:2.

[0007] Furthermore, the drug combination also includes a pharmaceutically acceptable carrier.

[0008] Furthermore, the vector contains the myocardial-specific promoter cTNT.

[0009] Furthermore, the NASP gene is overexpressed in the myocardial tissue of the body.

[0010] The present invention also provides a drug combination containing nuclear autoantigen sperm protein that promotes myocardial regeneration and repair, wherein the drug combination contains the NASP gene.

[0011] The present invention also provides the application of the drug combination containing the nuclear autoantigen sperm protein in the preparation of a drug to promote myocardial regeneration and repair after myocardial injury.

[0012] The present invention also provides the application of the drug combination containing the nuclear autoantigen sperm protein in the preparation of a drug that promotes cardiomyocyte proliferation.

[0013] The NASP gene has any of the following applications: (1) in the preparation of drugs or reagents that promote cardiomyocyte proliferation; (2) in the preparation of drugs that promote myocardial regeneration and repair after myocardial injury.

[0014] The embodiments of the present invention have the following technical effects:

[0015] 1. This invention demonstrates for the first time that NASP protein promotes myocardial regeneration and repair: By increasing the NASP protein content in cardiomyocytes, the proliferative capacity of both primary mouse cardiomyocytes cultured in vitro and mature cardiomyocytes in vivo was significantly enhanced. Following acute myocardial ischemia-reperfusion injury in adult hearts, NASP protein rapidly activates endogenous regeneration of cardiomyocytes. This process helps promote the regeneration and repair of damaged myocardium, reduces scar tissue formation, and contributes to the recovery of cardiac function.

[0016] 2. Cardiomyocyte-Specific cTNT Promoter Enhances Treatment Precision and Efficiency: This invention utilizes a viral vector carrying a cardiomyocyte-specific cTNT promoter. This design ensures that only cardiomyocytes can activate and express the exogenous NASP gene within the vector. This method achieves precise treatment of cardiomyocytes while significantly reducing the risk of side effects from non-target tissues or cells. Using this viral vector, carrying a cTNT-driven therapeutic gene fragment, provides an ideal strategy for the treatment of myocardial infarction.

[0017] 3. Ease of operation and safety: The gene expression vector provided by this invention can be administered via both local myocardial in situ injection and intravenous injection, which is convenient and easy to perform. It can effectively avoid the huge risks brought about by cardiopulmonary bypass and heart transplantation, and provides a new strategy for the biological treatment of acute myocardial infarction and ischemia-reperfusion injury.

[0018] 4. Significant effects on cardiac protection and repair: Preliminary experimental results show that in situ injection into the myocardium and in situ injection into the infarct border area can effectively promote endogenous proliferation of cardiomyocytes in adult mice, reduce chronic scar formation, inhibit ventricular pathological remodeling, and significantly improve cardiac function. Attached Figure Description

[0019] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0020] Figure 1 This is a map of the pDC315-CTnT-3flag-T2A-egfp plasmid vector provided in an embodiment of the present invention.

[0021] Figure 2 This is a map of the GV425 pAAV-cTNT promoter-EGFP-FT2A-WPRE-SV40polyA plasmid vector provided in this embodiment of the invention.

[0022] Figure 3 This is a PCR electrophoresis image of the NASP plasmid of this invention.

[0023] Figure 4 This is the result of NASP protein expression in cell experiments provided in the embodiments of the present invention.

[0024] Figure 5 This is the result of NASP protein expression in animal experiments provided in the embodiments of the present invention.

[0025] Figure 6 In the cell experiments provided in this embodiment of the invention, Ki67 + and pH3 + The positive rate of the indicators, among which, Figure 6 In the middle, 'a' represents Ki67 in the control group. + Typical chart of the indicator, Figure 6 b is Ki67 from the experimental group. + Typical chart of the indicator, Figure 6 c represents the pH3 of the control group. + Typical chart of the indicator, Figure 6 d represents the pH of the experimental group. + Typical chart of the indicator, Figure 6 The middle 'e' is Ki67 + Statistical charts of indicators Figure 6 f is pH3 + Statistical charts of indicators.

[0026] Figure 7 In the animal experiment provided in this embodiment of the invention, Ki67 on day 14 + and pH3 + Staining results, among which Figure 7 In the middle, 'a' represents the pH 3 of the control group. + Staining results, Figure 7 b is the pH of the experimental group. + Staining results, Figure 7 c represents the Ki67 of the control group. + Staining results, Figure 7 d represents Ki67 in the experimental group. + Staining results, Figure 7 The middle e is Figure 7 (a) is a magnified view of the staining results. Figure 7 f is Figure 7 (b) is a magnified view of the staining results. Figure 7 g is Figure 7 (c) is a magnified view of the staining results. Figure 7 h is Figure 7 (d) is a magnified view of the staining results. Figure 7 i is Ki67 + Statistical charts of indicators Figure 7 The middle j is pH3 + Statistical charts of indicators.

[0027] Figure 8 This is an echocardiogram provided in an embodiment of the present invention, wherein... Figure 8 Image a is an echocardiogram of a control mouse on day 1 after a myocardial infarction. Figure 8 Image b is an echocardiogram of a control mouse on day 28 after myocardial infarction. Figure 8The image in image c is an echocardiogram taken on day 1 after NASP treatment for myocardial infarction in mice. Figure 8 The image in image d is an echocardiogram taken on day 28 after NASP treatment for myocardial infarction in mice. Figure 8 The graph in Figure 'e' represents the super-ejection fraction (EF) measurements of control mice and NASP-treated mice on days 1 and 28 post-myocardial infarction. The horizontal axis represents the values ​​of control mice on day 1 post-myocardial infarction, treated mice on day 1 post-myocardial infarction, control mice on day 28 post-myocardial infarction, and treated mice on day 28 post-myocardial infarction, respectively. Figure 8 The value of f represents the fractional shortening (FS) of control mice and NASP-treated mice on day 1 and day 28 after myocardial infarction, respectively. The horizontal axis represents the values ​​of control mice on day 1 after myocardial infarction, treated mice on day 1 after myocardial infarction, control mice on day 28 after myocardial infarction, and treated mice on day 28 after myocardial infarction.

[0028] Figure 9 These are Masson stainings of the hearts of mice in the control group and NSP treatment group 28 days after myocardial infarction, as provided in this embodiment of the invention. Figure 9 In the middle, 'a' represents the staining results of the control group mice. Figure 9 b represents the staining results of the NASP treatment group. Figure 9 c represents the quantitative data of cardiac scar area in mice in the control group (CON) and the NSP treatment group (NASP). Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0030] In a first aspect, some embodiments of the present invention provide the use of a pharmaceutical composition containing nuclear autoantigen sperm protein in the preparation of a medicament for treating acute myocardial infarction, said pharmaceutical composition including the NSP gene;

[0031] The nucleotide sequence of the NASP gene is shown in SEQ ID NO:1, and the amino acid sequence it encodes is shown in SEQ ID NO:2.

[0032] In some embodiments, the drug combination further includes a pharmaceutically acceptable carrier.

[0033] In some embodiments, the vector contains the myocardial-specific promoter cTNT.

[0034] In some embodiments, the NASP gene is overexpressed in the myocardial tissue of the body.

[0035] Secondly, some embodiments of the present invention also provide a drug combination containing nuclear autoantigen sperm protein that promotes myocardial regeneration and repair, wherein the drug combination contains the NASP gene.

[0036] Thirdly, some embodiments of the present invention also provide the application of the drug combination containing nuclear autoantigen sperm protein in the preparation of drugs to promote myocardial regeneration and repair after myocardial injury.

[0037] Fourthly, some embodiments of the present invention also provide the application of the drug combination containing the nuclear autoantigen sperm protein in the preparation of a drug that promotes cardiomyocyte proliferation.

[0038] Fifthly, some embodiments of the present invention provide any of the following applications of the NASP gene: (1) in the preparation of drugs or reagents that promote cardiomyocyte proliferation; (2) in the preparation of drugs that promote myocardial regeneration and repair after myocardial injury.

[0039] The following is a detailed explanation using specific embodiments:

[0040] The invention is designed with Figure 1 and Figure 2 The two different plasmid vector maps were all synthesized by Shanghai Jikai Gene Medical Technology Co., Ltd., from the design and preparation of the plasmid vectors to the preparation of the drug combination.

[0041] In this invention, the tool carrier information is as follows:

[0042] Vector name: pDC315-CTnT-3flag-T2A-egfp; element sequence: CTnT-MCS-3flag-T2A-egfp; constructed element sequence: CTnT-NM_016777(Nasp)-3flag-T2A-egfp; restriction site: AgeI / AgeI; vector map is shown below. Figure 1 Vector name: GV425 pAAV-cTNT promoter-EGFP-FT2A-WPRE-SV40 polyA; element sequence: cTNT promoter-EGFP-FT2A-MCS-WPRE-SV40 polyA; constructed element sequence: cTNT promoter-EGFP-FT2A-NM_016777(Nasp)-WPRE-SV40 polyA; restriction site: BamHI / SacII; vector map is shown below. Figure 2 .

[0043] Example 1: Preparation of a NASP protein viral agent driven by a myocardial-specific cTNT promoter:

[0044] 1. Construction of a viral plasmid vector for NASP protein overexpression driven by the myocardial-specific promoter cTNT.

[0045] (1) Target gene: NASP.

[0046] The nucleotide sequence of the NASP gene is shown in SEQ ID NO:1, where,

[0047]

[0048] The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:1 is as shown in SEQ ID NO:2, where:

[0049] SEQ ID NO:2 is: MATESTAAAAIAAELVSADKIEDAPAPSTSADKMESLDVDSEAKKLLGLGQKHLVMGDIPAAVNAFQEAASLLGKKYGETANECGEAFFFYGKSLLELARMENGVLGNALEGVHVEEEEGEKTEDESLVENNDNVDEEAREELREQVYDAMGEKEAKKAEGKSLTKPETDKEQESEVEKGGREDMDISEPEEKLQETVEPTSKQLTESSEEAKEAAIPGLNEDEVASGKTEQESLCTEKGKSISGAYVQNKEFRETVEEGEEIISLEKKPKETSEDQPIRAAEKQGTLMKVVEIEAEIDPQVKSADVGGEEPKDQVATSESELGKAVLMELSGQDVEASPVVAAEAGAEVSEKPGQEITVIPNNGPVVGQSTVGDQTPSEPQTSAERLTETKDGSSVEEVKAELVPEQEEAMLPVEESEAAGDGVETKVAQRATEKAPEDKFKIAANEETQERDEQMKEGEETEGSEEEDRENDKAEETPNESVLEKKSLQENEEEEIGNLELAWDMLDLAKIIFKRQETKEAQLYAAQAHLKLGEVSVESENYIQAVEEFQACLSLQEQYLEAHDRLLAETHYQLGLAYGYNSQYDEAVAQFGKSIDVIEKRMAVLHEQMKEAEGSFTEYEKEIEELKELLPEIREKIEDAKESQRSGNVAELALKATLVESSTSGFTPSGAGASVSMIASRKPTDGASSSNCVTDISHLVRKKRKPEEESPRKDDAKKAKQEPEVNGGSGDAVSSGKEVSENMEAEAENQAESQTAEGTVESAATIKSTAC.

[0050] (2)Species: Mouse.

[0051] (3)According to Figure 1 and Figure 2The plasmid vector map was obtained, and two plasmid vectors linked to the myocardial-specific promoter cTNT were prepared.

[0052] (4) Vector enzyme digestion:

[0053] Prepare deionized water (ddH2O), 10×CutSmart Buffer, plasmid vector (concentration 1 μg / μL) from (3), and AgeI enzyme (10 U / μL). Each 50 μL digestion system contains: 42 μL ddH2O, 5 μL 10×CutSmart Buffer, 2 μL plasmid vector, and 1 μL AgeI enzyme. Gently pipette to mix the reagents, avoiding the formation of bubbles. Briefly centrifuge to allow the liquid to settle to the bottom of the tube and remove any bubbles that may have been generated. Place the entire system in a constant temperature environment of 37°C overnight for the reaction. After the digestion is complete, analyze the digestion products by agarose gel electrophoresis and recover the target DNA fragment based on the electrophoresis results.

[0054] (5) Obtaining the target gene fragment:

[0055] The upstream primer (NASP-p1) is shown in SEQ ID NO:3: AGAGTACTGCTAGCACCGGTCGCCACCATGGCCACAGAGTCTACAGCCGCTG.

[0056] The downstream primer (NASP-p2) is shown in SEQ ID NO:4: TCCATGGTGGCGACCGGTGCACATGCAGTGCTTTTAATTGTAGCTG.

[0057] (6) PCR amplification of the target gene fragment:

[0058] Prepare a 50 μL reaction system (5 μL 10×PCR Buffer, 4 μL dNTP, upstream and downstream primers added to (5), 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 5 μL template DNA of the target gene NASP (10 ng / μL), 0.5 μL Taq DNA polymerase, and DEPC water to make up to 50 μL), gently pipette to mix, briefly centrifuge, and place in a PCR instrument for reaction to obtain the target gene.

[0059] (7) PCR products are exchanged and transformed with plasmid vectors.

[0060] Prepare the ligation reaction system under ice-water bath conditions, and ligate the target gene in (6) to the plasmid vector in (4). Gently mix by pipetting and briefly centrifuge to remove any air bubbles. Incubate the reaction system in a 37°C water bath for 30 minutes. After the reaction is complete, transfer the system to an ice-water bath to cool for 5 minutes to terminate the reaction. Add 10 μL of the ligation reaction product to 100 μL of competent cells, mix thoroughly, and incubate on ice for 30 minutes to pre-cool the cells. Then, transfer the tube containing the reaction mixture to a 42°C water bath for 90 seconds of heat shock treatment, and then return it to an ice-water bath to cool for 2 minutes. Add 500 μL of LB medium to the tube and incubate on a shaker at 37°C for 1 hour. Finally, take an appropriate amount of bacterial culture and spread it evenly on an agar plate containing the corresponding antibiotic using a sterile spreader. Invert the plate and place it in a constant temperature incubator at 37°C for 12-16 hours to screen for bacterial clones containing the target insert fragment.

[0061] (8) Colony PCR identification:

[0062] The upstream primer was identified as shown in SEQ ID NO:5: CTGTACTCCATGAGCAGATG;

[0063] The downstream primer was identified as shown in SEQ ID NO:6: CGTCCGTCCAGCTCGACCAG.

[0064] Prepare 10×PCR Buffer, dNTPs, upstream primer for identification, downstream primer for identification, Taq DNA polymerase, and DEPC water. Prepare the PCR reaction system under aseptic conditions. Each 50 μL reaction system contains: 5 μL 10×PCR Buffer, 4 μL dNTPs, 1 μL upstream primer for identification, 1 μL downstream primer for identification, 5 μL template DNA of the target gene NASP, 0.5 μL Taq DNA polymerase, and DEPC water to a final volume of 50 μL. In a clean bench, use a sterile pipette tip to pick a single colony and place it into a prepared PCR reaction tube, then briefly centrifuge. Place the PCR reaction system containing the colony DNA template into a PCR instrument for amplification, and perform a small amount of product electrophoresis on an agarose gel. Results: The electrophoresis results of the PCR product are consistent with the expected results, such as... Figure 3 As shown.

[0065] (9) Sequencing:

[0066] The identified positive clone transformants were inoculated into an appropriate amount of LB liquid medium containing the corresponding antibiotics and cultured at 37°C for 12-16 hours. A suitable amount of the bacterial culture was then sequenced. The sequencing results were compared with the target gene sequence. The comparison results showed that the sequencing results were completely consistent with the target sequence.

[0067] 2. After exchanging the plasmid vector obtained in step (6) of step 1, perform detoxification packaging:

[0068] (1) Adenovirus harvest:

[0069] HEK293 cells were cultured at 37°C in a 5% CO2 incubator until they reached 50%-60% confluence. Two hours before transfection, the culture medium was replaced with serum-free medium. In a clean bench, plasmid DNA solution (5 μg shuttle plasmid and 5 μg helper plasmid, wherein the shuttle plasmid was the plasmid vector constructed in Example 1, step 1), 10 μL of P3000™, and 250 μL of serum-free Opti-MEM™ medium were thoroughly mixed and incubated at room temperature for 5 minutes. Separately, 3.75 μL of Lipofectamine™ 3000 transfection reagent was thoroughly mixed with 250 μL of serum-free Opti-MEM™ medium. The diluted plasmid DNA solution was then added to the diluted Lipofectamine™ 3000 solution, and the mixture was gently pipetted to mix thoroughly, avoiding air bubbles. The mixture was incubated at room temperature for 20 minutes to form the DNA / Lipofectamine™ 3000 transfection complex. The transfection complex was slowly added dropwise to the HEK293 cell culture medium, and the medium was gently shaken to ensure even distribution. The cells were then incubated at 37°C in a 5% CO2 incubator. 48-72 hours post-transfection, HEK293 cells were observed under a microscope for signs of cytopathic effect (CPE), such as changes in cell morphology, cell aggregation, cell detachment, or decreased cell viability. When most cells showed CPE and 50% of the cells detached from the cell wall, the cells were collected by low-speed centrifugation and resuspended in 10 mL of DMEM medium. The cells were subjected to repeated freeze-thaw cycles at -70°C and 37°C with shaking three times, followed by centrifugation at 7000g for 5 min at 4°C. The viral supernatant was collected and stored at -70°C to obtain adenovirus containing the target vector.

[0070] (2) Adeno-associated virus harvest:

[0071] AAV-293 cells were cultured at 37°C and 5% CO2 until 70%-80% confluence. Two hours before transfection, the culture medium was replaced with serum-free medium. The plasmids required for co-transfection (viral plasmid vector (the vector constructed in the example), pAAV-RC vector, and pHelper vector) were taken and their concentration adjusted to 1 mg / mL with pH 7.5 TE buffer. For each 100mm culture dish containing the virus, 10 μL (10 μg) of each of the three plasmids were required and mixed with 1 mL of 0.3 M CaCl2. 1 mL of 2×HBS solution was transferred to a 15 mL centrifuge tube, and 1.03 mL of DNA / CaCl2 mixture was added. The mixture was gently pipetted to mix, and the resulting solution was added dropwise to the cell culture dish. The cells were then gently shaken and incubated at 37°C and 5% CO2. 48-72 hours post-transfection, AAV-293 cells were observed under a microscope for signs of cytopathic effect (CPE), such as changes in cell morphology, cell aggregation, cell detachment, or decreased cell viability. When most cells showed CPE and 50% of cells detached from the cell wall, the cells were collected by low-speed centrifugation and resuspended in 10 mL of DMEM medium. The cells were then subjected to repeated freeze-thaw cycles at -70℃ and 37℃ with shaking three times, followed by centrifugation at 7000g for 5 min at 4℃. The viral supernatant was collected and stored at -70℃ to obtain adeno-associated virus containing the target vector.

[0072] 2. Viral amplification:

[0073] Amplification can be chosen based on the actual situation. HEK293 cells were cultured in 10cm culture dishes in DMEM medium containing 10% FBS (fetal bovine serum) at 37°C and 5% CO2 until 50%-60% cell confluence. 0.5μL of the initial amplified virus stock solution was added to 1mL of DMEM medium containing 10% FBS, mixed thoroughly, and the original culture medium was removed from the dish. The virus mixture was added, and the mixture was shaken in a cross-shaped manner. The cells were then incubated at 37°C and 5% CO2 for 90 minutes. Then, 9mL of DMEM medium containing 10% FBS was added, and the cells were cultured for another 72 hours. MOI was then measured. Cells were collected, centrifuged at 4°C and 600xg for 5 minutes to precipitate the cells, and the supernatant was slowly discarded. The cells were resuspended in 1mL of virus preservation solution, and subjected to three freeze-thaw cycles at -20°C and 37°C. The cells were then centrifuged at 4°C and 7000g for 5 minutes. The supernatant was collected, and the virus titer was determined. The collected virus particles were aliquoted and stored at -70°C.

[0074] (3) Virus purification:

[0075] Use the Adeno-X™ Virus Purification Kit. Remove the Adeno-X purification device and filter the crude virus stock solution through a 0.45µm filter membrane, storing the filtrate in a collection bottle. Add 4µL of 25U / µL Benzonase to the virus filtrate, mix well, incubate at 37°C for 30 min, then add 10mL of 1×Dilution buffer and mix thoroughly. Assemble the purification filter onto a standard-sized Luer-Lok syringe, attaching a one-way valve between the filter and the syringe. After equilibrating the filter with Equilibration Buffer, insert the cannula into the virus filtrate in the collection bottle and pull the syringe outward at a rate of 5mL / min to allow the virus filtrate to flow through the filter, adsorbing virus particles onto the filter membrane. First, wash the filter device with 1×Wash Buffer to remove unadsorbed impurities, then elute the virus particles adsorbed on the filter membrane with 1×Eultion Buffer. Pass the elution buffer through the filter and collect the eluent containing purified virus. The eluted virus was collected into sterile centrifuge tubes, the titer of the purified virus was determined, and the purified virus was aliquoted and stored at -70°C.

[0076] Example 2: Cellular Experiment: Experimental Study on the Promotion of Primary Mouse Cardiomyocyte Proliferation by cTNT Promoter-Driven NASP Protein Kinase Gene Expression Vector.

[0077] (1) Extraction of primary mouse cardiomyocytes

[0078] Newborn mice aged 1-3 days were disinfected by immersion in alcohol, and then their ventricular myocardium was harvested through open-chest surgery. The myocardium was washed with PBS buffer, minced, and the entire process was completed within 5 minutes. The myocardium was digested 6-8 times with a digestive solution containing trypsin and collagenase (37℃, 120 rpm, 8 minutes each time) until the myocardial tissue became white and flocculent. All supernatants were collected, centrifuged at 1200 rpm for 8 minutes, and the supernatant was discarded. The cells were resuspended in complete culture medium, filtered through a 40 μm cell sieve, and allowed to adhere differentially for 45 minutes to remove a large number of fibroblasts. The myocardial cells were then isolated and purified using the Percoll method. The cells were cultured at 37℃ in a 5% CO2 incubator, and the culture medium was changed after 48 hours.

[0079] Ad5:cTNT-NASP transfection of primary mouse cardiomyocytes:

[0080] Transfect the extracted cardiomyocytes with the same titer (MOI=50) of empty virus (i.e., virus without loading) Figure 1 The adenovirus vector, denoted as Ad5:cTNT-CON, and the myocardial-specific human NASP gene expression vector (Ad5:cTNT-NASP, i.e., loaded with...) Figure 1The adenovirus vector (referred to as Ad5:cTNT-NASP) was mixed by cross-shaking and incubated at 37°C in a 5% CO2 incubator for 36-48 hours. The fluorescence transfection efficiency was then observed under a microscope.

[0081] A mouse primary cardiomyocyte glucose-oxygen deprivation model (i.e., an acute myocardial infarction model) was established: the original cell culture medium was removed and replaced with glucose-free, serum-free DMEM medium. The culture was then placed in a sealed anaerobic flask to remove oxygen and incubated at 37°C for 8 hours. Ki67 was then applied to the mouse primary cardiomyocytes. + and pH3 + The specific procedures for staining detection are as follows:

[0082] (1) Remove the culture medium and wash the cells three times with PBS buffer. Add 4% paraformaldehyde to each well to fix the cells for 30 minutes. Remove the fixative and wash the cells three times with PBS buffer. Add PBS buffer containing 0.2% Triton X-100 to each well and permeate on a shaker at room temperature for 10-15 minutes. Remove the permeate and wash the cells three times with PBS buffer. Add PBS buffer containing 10% goat serum and block on a shaker at 60-70 rpm for 2 hours at room temperature. Remove the blocking solution and add primary antibody dilution buffer (cTNT(Anti-Cardiac Troponin T antibody [1C11](ab8295)): PBS buffer with a volume ratio of 1:200 for 10% goat serum. Among them, Ki67 + For staining, a PBS buffer solution with a volume ratio of Ki67 (Anti-Ki67 antibody (ab15580)): 10% goat serum of 1:200 was used; pH 3. + During staining, the pH ratio of PBS buffer (anti-PH3 antibody [EPR13306](ab180577)): 10% goat serum was 1:200. The mixture was incubated overnight at 4°C on a shaker at 60-70 rpm.

[0083] (3) Remove the primary antibody dilution solution, add the corresponding species secondary antibody dilution solution (PBS buffer of 10% goat serum) to PBS buffer, and incubate at room temperature at 50 rpm for 2 hours.

[0084] (4) Remove the secondary antibody dilution buffer and wash three times with PBS buffer. Add DAPI dye and incubate on a shaker at 60-70 rpm for 20 minutes at room temperature. Remove the dye and wash three times with PBS. Acquire images using a laser confocal microscope and perform Ki67 cell analysis. + and pH3 + Quantitative analysis of positive cells.

[0085] The results are as follows Figure 4 As shown, in Figure 4It can be seen that in Example 1, the adenovirus loaded with the target gene successfully infected cardiomyocytes, thereby increasing the NASP protein content in cardiomyocytes.

[0086] exist Figure 6 Further verification also revealed that Ki67 in cardiomyocytes infected with the adenovirus carrying the target gene in Example 1... + and pH3 + A high positive rate for both indicators demonstrates a stronger ability of cardiomyocytes to divide and proliferate. Therefore, the viral vector obtained in Example 1 of this invention can successfully promote the proliferation of cardiomyocytes.

[0087] Example 3: Animal experiment: Experimental study on the promotion of myocardial regeneration and repair after infarction by a cTNT promoter-driven human NASP protein kinase gene expression vector.

[0088] Sixty 8-week-old male C57BL / 6J mice purchased from the Experimental Animal Center of Nanjing Medical University were randomly divided into two groups. One group was used to establish a myocardial infarction model combined with an intramyocardial injection model at the infarct margin (i.e., loaded with AAV9). Figure 2 The specific procedure was as follows: Adult C57BL / 6 mice were sedated with 1.2% aphthylamine (Sigma-Aldrich, St. Louis, USA), intubated, and artificially ventilated. After a skin incision, the intercostal muscles were bluntly dissected, and a lateral thoracotomy was performed in the third intercostal space. The left anterior descending coronary artery (LAD) was ligated with a 7-0 suture needle. An assistant used a microinjector with a 36G needle to inject the adeno-associated virus (AAV9):cTNT-NASP formulation (i.e., loaded with a 36G needle) into the myocardium at the left, right, and superior sides of the pale infarcted area surrounding the ligation site. Figure 2 Adeno-associated virus (AAV9:cTNT-NASP) was used as the experimental or control virus (without vector). Figure 2 Adeno-associated virus (AAV9:cTNT-CON) was used as a control group, with 3 µL injected at each site, for a total viral load of 1.1 × 10⁹ v.g. Chest wall and skin incisions were sutured with 3-0 non-absorbable sutures. Mice were then placed on an incubator and their vital signs were continuously monitored until anesthesia wore off. Subsequent experiments are as follows:

[0089] (1) Seven mice were randomly selected from each group to monitor the recovery of cardiac function at different time points after modeling. Echocardiography was performed on the first and 28th day after surgery to detect the difference in cardiac function between the two groups. Figure 5 The results showed that adeno-associated virus carrying the target gene also successfully infected cardiomyocytes, thereby increasing the NASP protein content in mouse myocardial tissue. Figure 8The results showed that 28 days post-surgery, 7 mice survived in both the myocardial infarction + AAV9:cTNT-CON group and the myocardial infarction + AAV9:cTNT-NASP group. The ejection fraction (EF) of the heart in the AAV9:cTNT-NASP group was significantly higher than that in the AAV9:cTNT-CON group, and maintained a slow upward trend until the longest observation time, indicating that the viral agent can significantly and sustainably promote the recovery of cardiac function in mice after myocardial infarction (MI). Figure 9 As shown, after echocardiography 28 days post-surgery, all mice in this group were euthanized, and fresh heart tissue was collected to prepare paraffin-embedded specimens. The tissue sections were stained using the Masson staining kit. It was found that the degree of myocardial fibrosis was significantly reduced in the AAV9:cTNT-NASP group compared with the AAV9:cTNT-CON group, indicating that the AAV9:cTNT-NASP preparation can promote myocardial regeneration and repair, reduce the fibrotic area, inhibit cardiac remodeling, and improve cardiac function.

[0090] (2) Three mice were randomly selected from each group to detect cardiomyocyte proliferation 14 days after modeling. The results are as follows: Figure 7 As shown, paraffin sections of the lesion margin area were prepared from fresh hearts of mice 14 days after surgery and subjected to Ki67 testing. + and pH3 + Staining results showed that the cell cycle activity and mitosis of cardiomyocytes in the injury border zone of mice in the AAV9:cTNT-NASP group were significantly increased, suggesting that the AAV9:cTNT-NASP preparation can promote the proliferation of cardiomyocytes after MI injury in adult mice. This indicates that the AAV9:cTNT-NASP preparation can serve as a new strategy for regenerative repair therapy after acute myocardial infarction.

[0091] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the technical solutions of the embodiments of the present invention.

Claims

1. The use of a viral vector expressing the NASP gene in the preparation of a drug for treating acute myocardial infarction in mice, characterized in that, The viral vector carries the cardiomyocyte-specific promoter cTNT; The nucleotide sequence of the NASP gene is shown in SEQ ID NO:1, and the amino acid sequence it encodes is shown in SEQ ID NO:

2. The NASP gene was overexpressed in the myocardial tissue of the body.

2. The application according to claim 1, characterized in that, The drug also includes a drug-acceptable carrier.

Images