Dual-vector system for expressing STRC protein and application of dual-vector system
The STRC gene was segmented and reassembled by the dual AAV vector system, and the problem of large gene delivery was solved, gene therapy for inherited deafness DFNB16 was realized, and the patient's hearing function was restored.
Patent Information
- Application Number
- CN202410090950.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-23
- Publication Date
- 2025-07-25
AI Technical Summary
The prior art is difficult to effectively deliver deaf-related genes greater than 4kb, such as STRC genes, resulting in the lack of effective gene therapy for inherited deafness DFNB16.
The STRC gene was divided into two segments using a bi-agent-associated virus (AAV) vector system and reassembled and expressed in the cells. The codon was used to optimize and select appropriate AAV subtypes and expression elements to achieve the complete expression of STRC protein.
The normal functional STRC protein is produced in the body to restore the hearing function of deaf patients and provide a gene therapy regimen for inherited deafness DFNB16.
Smart Images

Figure BDA0004676723680000141 
Figure BDA0004676723680000151 
Figure BDA0004676723680000161
Abstract
Description
Technical Field
[0001] The present invention relates to a dual-vector system for expressing STRC protein and its application in gene therapy, particularly in the treatment of hearing loss. Background Art
[0002] Deafness is the most common disabling disease clinically, which has seriously affected the normal life of humans and caused a huge burden to society. According to the report of WHO, there are nearly 1.5 billion people with varying degrees of hearing loss globally, 466 million people with disabling hearing loss, accounting for 5% of the total population, among which children account for 34 million. It is estimated that by 2050, there will be 2.5 billion people with varying degrees of hearing loss globally and 700 million people with disabling hearing loss.
[0003] Genetics and environment are the two major factors causing deafness. Environmental reasons are mainly related to various environmental factors such as the use of ototoxic drugs, prenatal infections, neonatal hypoxia, and radiation exposure, or certain complications. While genetics is the main cause of deafness, and deafness caused by genetic factors accounts for about 60%. Genetic factors are mainly due to individual deafness gene defects, resulting in varying degrees of hearing loss; the pathogenic genes are transmitted to the next generation through different inheritance patterns, and can occur at any age, and the impact is permanent. More than 120 genes related to deafness have been discovered so far, involving more than 1500 pathogenic variants, and there is still no drug available for the treatment of genetic deafness clinically.
[0004] According to whether there are clinical symptoms in other organs besides the auditory system, hereditary deafness can be divided into syndromic hearing loss (SHL) and non-syndromic hearing loss (NSHL). Syndromic hearing loss (SHL) is often accompanied by clinical manifestations in other systems, including eyes, heart, kidneys, nervous system, skin, bones, etc., accounting for 30% of hereditary deafness. Among SHL, Pendred syndrome, Usher syndrome (abbreviated as USH), and Waardenburg syndrome (WS) are the most well-known; and USH, Pendred syndrome, and Jervell and Lange-Nielsen syndrome (JLNS) have successfully achieved inner ear gene therapy in preclinical animal model studies. Non-syndromic hearing loss (NSHL) has four types: autosomal dominant (DFNA), autosomal recessive (DFNB), X-linked (DFNX), and mitochondrial non-syndromic deafness. Approximately 70% of hereditary deafness patients are non-syndromic. The most common mode of inheritance of NSHL is autosomal recessive inheritance (75%-80%), followed by autosomal dominant inheritance (20%), X-linked inheritance (<2%), and mitochondrial inheritance (<1%). To date, more than 120 genes have been reported to be related to NSHL. Among them, there are 51 DFNA-related deafness genes, 78 DFNB-related deafness genes, and 10 deafness genes are related to both DFNA and DFNB, namely CLOL11A2, GJB2, GJB6, MYO3A, MYO6, MYO7A, PTPRQ, TCB1D24, TECTA, and TMC1 genes; there are 5 DFNX-related deafness genes. The GJB2 gene is the most common pathogenic gene (21.6%), followed by the STRC gene (16.1%), the SLC26A4 gene (6.6%), and the TECTA gene (5.2%).
[0005] Each type of deafness is described according to the naming principle of deafness genes. For example, DFNA1 is the first discovered autosomal dominant deafness type. DFNB16 is the sixteenth described autosomal recessive non-syndromic deafness, which is a monogenic, non-syndromic, recessive hearing loss caused by mutations in the Strc gene. This gene is located at 15q15.3 on chromosome 15 and is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Approximately 40 different mutations (mainly recessive mutations) have been identified in the Strc gene, and most mutations result in the synthesis of defective STRC proteins or completely prevent their synthesis.
[0006] It is considered that mutations in the Strc gene are the main cause of mild to moderate autosomal recessive non-syndromic hearing loss. The Strc gene encodes an extracellular structural protein called stereocilin (also known as "STRC protein"), which is related to the hair bundles of sensory hair cells in the inner ear. The hair bundle consists of stiff microvilli called stereocilia. The role of the Strc gene is to maintain the cohesive bundle of microvilli and couple the bundle to the overlying tectorial membrane, which is located in the cochlea of the inner ear. Normal expression of the Strc gene in the inner ear is crucial for auditory function. The lack of normal STRC protein causes the sensory hair bundle to detach from the overlying tectorial membrane. However, the non-detachment of the sensory hair bundle from the overlying tectorial membrane is necessary for appropriate sound-evoked stimulation.
[0007] Global statistics show that DFNB16 accounts for a large proportion of hereditary deafness, especially in the population with moderate hearing impairment. Therefore, it is the second most common form of hereditary hearing loss and the most common form affecting the sensory hair cells of the inner ear. Patients with DFNB16 have moderate to severe hearing loss and are usually treated with hearing aids or cochlear implants. However, there is currently no biological treatment for DFNB16 hearing loss in clinical practice.
[0008] Treating deafness is one of the major challenges faced by the medical community today. Although hearing aids and cochlear implants can provide significant benefits to patients, there is still an unmet medical need for a single, precise, and permanent strategy to potentially cure hereditary hearing loss.
[0009] Currently, most of the methods to address deafness are physical methods such as using hearing aids, vibrating sound bridges, and cochlear implants. Although patients can achieve varying degrees of improvement in hearing function, there are large individual differences, and there are also significant limitations and weaknesses. For example, the treatment effect is limited, frequency sensitivity, speech discrimination, and difficulties in perception in a noisy environment, and the device needs to be used carefully. Approximately 300,000 patients worldwide have received cochlear implants, but this only accounts for a small part of all deaf patients. For the majority of patients, there is still an urgent need for a fundamental and effective drug treatment approach, but there is still no approved treatment method, which is a severely unmet need area.
[0010] For hereditary deafness with a clear etiology, gene therapy is regarded as an ideal treatment method, that is, using normal genes to compensate for defective genes, and a single administration can fundamentally restore or improve hearing, achieve a lasting restoration of auditory function, and be closer to natural sounds. In the past decade, with the rapid development of delivery vectors and gene therapy technologies globally, significant breakthroughs have been made in the treatment of diseases with related drugs, and some gene therapy drugs have been approved for marketing one after another. However, in the field of hereditary deafness, there is no gene therapy drug on the market.
[0011] Gene therapy refers to a method that enables a subject to recover from a disease caused by abnormal nucleic acid sequences or abnormal expression in the body by correcting, compensating, or suppressing at the DNA or RNA level, thereby achieving the purpose of disease treatment. Currently, most gene therapies require vector delivery, and adeno-associated virus (AAV) is one of the safe and efficient delivery vectors, with a packaging capacity of approximately 4.7 Kb. However, in the field of deafness, the coding regions of many genes are not suitable for AAV packaging, such as BDP1, CDH23, COL11A2, LOXHD1, MET, MYO15A, MYO3A, MYO7A, OTOG, OTOF, OTOGL, PCDH15, PTPRQ, STRC, TECTA, TARA, etc. Their coding regions are all over 4 kb, and together with related regulatory elements, they will exceed the packaging limit of the AAV vector.
[0012] Using a dual-adeno-associated virus system (dual-AAV vector system) to deliver large gene sequences (for example, genes larger than 4 kB; such as the STRC gene) can overcome the limitation of the gene size by a single AAV vector. However, looking globally, there is still a need for breakthroughs in current clinical research on using AAV gene therapy to treat deafness. Summary of the Invention
[0013] The present invention provides a treatment method for hereditary deafness DFNB16. AAV vectors have been proven to be effective transgene delivery tools and are one of the most promising vectors for human gene therapy transfer technology. Their safety and the ability to persistently express in inner ear cells have made significant progress in deafness gene therapy. Therefore, AAV-based gene therapy is a blessing for deaf patients. However, the AAV packaging capacity is less than 4.7 kb, resulting in a packaging limitation problem. The coding sequences of many proteins crucial for inner ear function exceed the AAV vector packaging limit, including Strc (the full length exceeds 9 kb including regulatory sequences). In the dual-AAV vector system, a larger foreign gene is divided into two segments and packaged into different AAV particles. By co-transforming the same cell with dual AAV vectors, the foreign gene fragments in each AAV vector can be reassembled, transcribed, and expressed in the target cell. In an ideal situation, the dual-AAV vector system can expand the foreign gene carrying capacity to 9 kb.
[0014] However, the efficiency of delivering the Strc gene using a dual-AAV vector is a challenging problem. Due to the packaging capacity limitation of the AAV vector, the system of the present invention screened a large number of STRC protein cleavage sites and optimized the codon of the Strc gene nucleotide sequence to increase the expression level of the full-length STRC protein. Finally, a more suitable AAV subtype, expression element, and the optimal STRC protein cleavage site were selected. Thus, normal functional STRC protein is produced in vivo.
[0015] The present invention is a gene therapy based on the dual-AAV vector technology. By administering the dual-AAV vector system of the present invention into the cochlea unilaterally once, the transgene encoding Strc is delivered to the cochlear hair cells. Thus, normal functional STRC protein is expressed to treat Strc-mediated hearing loss. The present invention provides a method and composition for treating autosomal recessive nonsyndromic deafness DFNB16 by delivering the Strc gene encoding the STRC protein using a dual-vector system.
[0016] Aiming at the deficiencies of the prior art, the present invention provides a composition and method for delivering the Strc gene cDNA to human 293T cells and Strc ko mice using a dual-vector system and expressing the STRC protein to form a complete and functional STRC protein, which can be used to increase the expression of wild-type STRC protein or provide wild-type STRC protein to a subject to treat autosomal recessive nonsyndromic DFNB16 deafness disease related to STRC gene mutation.
[0017] The dual-AAV vector system separates the Strc gene target sequence into two AAV virus particles. The two AAV vectors each carry a partial target gene sequence, and these two gene sequences do not overlap. The dual-AAV vector system finally produces a complete and functional STRC protein in cells. In the dual-AAV vector system, at the 3' end of the AAV genome encoding the N-terminal sequence of the target protein in one AAV vector, there is a coding sequence for the N-terminal of intein; at the 5' end of the AAV genome encoding the C-terminal sequence of the target protein in the other AAV vector, there is a coding sequence for the C-terminal of intein; and each of these two AAV genome sequences contains an independent promoter. Finally, based on the splicing at the polypeptide level in cells, the two polypeptides of the N-terminal sequence of the target protein and the C-terminal sequence of the target protein will complete splicing to form an active STRC protein.
[0018] The present invention improves the expression level of the STRC protein entering cells by screening the cleavage sites of the STRC protein / Strc gene in the dual-AAV vector system and codon optimization, laying a foundation for the Strc gene to be used in the preparation of targeted drugs for treating sensorineural deafness.
[0019] Thus, in a first aspect, the present invention provides a dual-vector system for expressing STRC protein, which comprises a first nucleic acid vector and a second nucleic acid vector, wherein
[0020] the first nucleic acid vector comprises a first nucleotide sequence; and the second nucleic acid vector comprises a second nucleotide sequence;
[0021] the first nucleotide sequence comprises an expression cassette inserted between two first ITR sequences;
[0022] the second nucleotide sequence comprises an expression cassette inserted between two second ITR sequences;
[0023] the expression cassette of the first nucleotide sequence comprises a promoter, an N-terminal coding sequence of STRC, an N-terminal coding sequence of intein, and polyA;
[0024] the expression cassette of the second nucleotide sequence comprises a promoter, a C-terminal coding sequence of intein, a C-terminal coding sequence of STRC, and polyA; and
[0025] a STRC cleavage site is provided in the STRC amino acid sequence. For example, the STRC amino acid sequence is as shown in SEQ ID NO:2 or a functional fragment thereof. For example, the functional fragment is an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO:2;
[0026] the N-terminal coding sequence of STRC is a nucleotide coding sequence from the N-terminal of the STRC amino acid sequence to the STRC cleavage site; the C-terminal coding sequence of STRC is a nucleotide coding sequence from the amino acid after the STRC cleavage site to the C-terminal of the STRC amino acid sequence.
[0027] In some embodiments, the STRC cleavage site is located at the amino acid immediately preceding serine, threonine or cysteine in the STRC amino acid sequence.
[0028] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, the promoter of the expression cassette of the first nucleotide sequence or the second nucleotide sequence is selected from the CAG promoter, CMV promoter, CBA promoter, UbC promoter, SFFV promoter, EF1α promoter, PGK promoter, or the promoters of Myo7A, Myo15, Atoh1, POU4F3, Lhx3, Myo6, α9AchR, α10AchR, OTOF and STRC encoding genes.
[0029] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, the polyA of the expression cassette of the first nucleotide sequence or the second nucleotide sequence comprises AATAAA (SEQ ID NO: 20) and variants of AATAAA; the variants of AATAAA comprise ATTAAA (SEQ ID NO: 21), AGTAAA (SEQ ID NO: 22), CATAAA (SEQ ID NO: 23), TATAAA (SEQ ID NO: 24), GATAAA (SEQ ID NO: 25), ACTAAA (SEQ ID NO: 26), AATATA (SEQ ID NO: 27), AAGAAA (SEQ ID NO: 28), AATAAT (SEQ ID NO: 29), AAAAAA (SEQ ID NO: 30), AATGAA (SEQ ID NO: 31), AATCAA (SEQ ID NO: 32), AACAAA (SEQ ID NO: 33), AATCAA (SEQ ID NO: 34), AATAAC (SEQ ID NO: 35), AATAGA (SEQ ID NO: 36), AATTAA (SEQ ID NO: 37) or AATAAG (SEQ ID NO: 38); for example, the polyA is a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with the polyA signal sequence shown in SEQ ID NO: 14 or SEQ ID NO: 17; and each ITR sequence of the two first ITR sequences and the two second ITR sequences is derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9.
[0030] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, the expression cassette of the first nucleotide sequence or the second nucleotide sequence further comprises an expression regulatory element and / or a tag element; for example, the expression regulatory element is the woodchuck hepatitis post-transcriptional regulatory element (WPRE) or a variant thereof, preferably a WPRE truncated variant, for example, a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with the nucleotide sequence shown in SEQ ID NO: 13, for example, the nucleotide sequence shown in SEQ ID NO: 16; for example, the tag element is HA.
[0031] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, the intein is derived from MxeGyrA, pabPolIII, MjaKlbA, SspDnaB, SceVMA, SspDnaE, NpuDnaE, AvaDnaE, CraDnaE, CspDnaE, CwaDnaE, MchtDnaE, OliDnaE, TerDnaE, gp41-1, gp41-8, IMPDH-1 or RmaDnaB. For example, the intein is derived from RmaDnaB. For example, the N-terminus of the intein is the N-terminus of the RmaDnaB intein shown in SEQ ID NO:5, and the C-terminus of the intein is the C-terminus of the RmaDnaB intein shown in SEQ ID NO:6. In some embodiments, the intein is derived from NpuDnaE. For example, the N-terminus of the intein is the N-terminus of the NpuDnaE intein shown in SEQ ID NO:39, and the C-terminus of the intein is the C-terminus of the NpuDnaE intein shown in SEQ ID NO:41.
[0032] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, the first nucleotide sequence is inserted into a plasmid containing two first ITR sequences, and the second nucleotide sequence is inserted into a plasmid containing two second ITR sequences. For example, the plasmid containing two first ITR sequences and the plasmid containing two second ITR sequences are the same or different. For example, the plasmid is pAAV, pAAV-CMV, pX601, pX551 or pAAV-MCS plasmid.
[0033] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, the STRC cleavage site is shown in Table 1.
[0034] In some specific embodiments, in the dual-vector system for expressing STRC protein of the present invention, the 656th amino acid of the STRC amino acid sequence shown in SEQ ID NO:2 is used as the STRC cleavage site, and the RmaDnaB intein is used. After connecting and fusing the N-terminal coding sequence of STRC with the N-terminal coding sequence of the RmaDnaB intein, the first nucleotide sequence is constructed, with the pAAV-CMV plasmid as the vector. After connecting and fusing the C-terminal coding sequence of the RmaDnaB intein with the C-terminal coding sequence of STRC, the second nucleotide sequence is constructed, with the pAAV-CMV plasmid as the vector.
[0035] Use the 708th amino acid of the STRC amino acid sequence shown in SEQ ID NO: 2 as the STRC cleavage site, and use the RmaDnaB intein; after ligating and fusing the N-terminal coding sequence of STRC with the N-terminal coding sequence of RmaDnaB intein, construct a first nucleotide sequence, using the pAAV-CMV plasmid as a vector; after ligating and fusing the C-terminal coding sequence of RmaDnaB intein with the C-terminal coding sequence of STRC, construct a second nucleotide sequence, using the pAAV-CMV plasmid as a vector;
[0036] Use the 722nd amino acid of the STRC amino acid sequence shown in SEQ ID NO: 2 as the STRC cleavage site, and use the RmaDnaB intein; after ligating and fusing the N-terminal coding sequence of STRC with the N-terminal coding sequence of RmaDnaB intein, construct a first nucleotide sequence, using the pAAV-CMV plasmid as a vector; after ligating and fusing the C-terminal coding sequence of RmaDnaB intein with the C-terminal coding sequence of STRC, construct a second nucleotide sequence, using the pAAV-CMV plasmid as a vector; or
[0037] Use the 917th amino acid of the STRC amino acid sequence shown in SEQ ID NO: 2 as the STRC cleavage site, and use the RmaDnaB intein; after ligating and fusing the N-terminal coding sequence of STRC with the N-terminal coding sequence of RmaDnaB intein, construct a first nucleotide sequence, using the pAAV-CMV plasmid as a vector; after ligating and fusing the C-terminal coding sequence of RmaDnaB intein with the C-terminal coding sequence of STRC, construct a second nucleotide sequence, using the pAAV-CMV plasmid as a vector;
[0038] For example, the N-terminal coding sequence of RmaDnaB intein encodes the N-terminal part of RmaDnaB shown in SEQ ID NO: 5, and the C-terminal coding sequence of RmaDnaB intein encodes the C-terminal part of RmaDnaB shown in SEQ ID NO: 6.
[0039] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, the expression cassette of the first nucleotide sequence and the expression cassette of the second nucleotide sequence each contain a signal sequence operably linked to a promoter sequence and under the control of the promoter; preferably, the signal sequence is the nucleotide sequence encoding SEQ ID NO: 3.
[0040] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, the expression cassette of the first nucleotide sequence and the expression cassette of the second nucleotide sequence each contain a combination of a WPRE nucleotide sequence and an SV40 polyadenylation sequence at the N-terminus of the 3' ITR sequence. For example, it has the nucleotide sequence shown in SEQ ID NO: 12 or a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 12; or contains a combination of a WPRE3 nucleotide sequence and an SV40 late polyadenylation sequence. For example, it has the nucleotide sequence shown in SEQ ID NO: 15 or a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 15.
[0041] In a second aspect, the present invention provides a packaging vector system for an adeno-associated virus, which packaging vector system comprises the dual-vector system for expressing STRC protein described in the first aspect of the present invention, a vector carrying AAV rep and cap genes, and a helper virus vector, and is packaged into an AAV vector. Preferably, the amino acid sequence of the STRC protein is as shown in SEQ ID NO: 2.
[0042] In some embodiments, in the packaging vector system for an adeno-associated virus of the present invention, the vector carrying AAV rep and cap genes is selected from AAV1, AAV2, AAV5, AAV8, AAV9, Anc80, PHP.eB, AAV-DJ and AAVrh.10 vectors; the helper virus vector is a pHelper plasmid.
[0043] In a third aspect, the present invention provides a method for packaging an adeno-associated virus, wherein the packaging vector system for an adeno-associated virus described in the second aspect of the present invention is transferred into a host cell for packaging.
[0044] In some embodiments, the host cell is selected from Hela-S3 cells, HEK-293 cells, HEK-293T cells, HEK-293FT cells, A549 cells and Sf9 cells.
[0045] In a fourth aspect, the present invention provides a dual adeno-associated virus vector, which is obtained by the packaging method described in the second aspect of the present invention.
[0046] In a fifth aspect, the present invention provides the use of the dual-vector system for expressing STRC protein described in the first aspect of the present invention or the dual adeno-associated virus vector described in the fourth aspect of the present invention for preparing a drug or preparation for treating deafness diseases or hearing impairment or hearing dysfunction.
[0047] In a sixth aspect, the present invention provides a drug or preparation for treating deafness diseases, hearing impairment, or hearing dysfunction, which is prepared from the dual-vector system for expressing STRC protein described in the first aspect of the present invention or the adeno-associated virus described in the fourth aspect of the present invention. Among them, the adeno-associated virus is obtained by transferring the packaging vector system of the adeno-associated virus into a host cell for packaging. The packaging vector system of the adeno-associated virus includes a dual-vector system for expressing STRC protein, a vector carrying AAVrep and cap genes, and a helper virus vector.
[0048] In some embodiments, the drug or preparation of the present invention further comprises a neutral salt buffer, an acidic salt buffer, a basic salt buffer, glucose, mannose, mannitol, protein, polypeptide, amino acid, antibiotic, chelating agent, adjuvant, preservative, nanoparticle, liposome, and positive lipid particle.
[0049] In some embodiments, the drug or preparation of the present invention is administered by injection through the round window, oval window, semicircular canal, or common canal of the cochlea; and is administered once or multiple times throughout life, with a total dose of 1×10 9 -1×10 13 viral genomes. BRIEF DESCRIPTION OF THE DRAWINGS
[0050] Figure 1 Schematic diagram of intein-mediated STRC protein expression in the dual-vector system.
[0051] Figure 2 Illustrates the vector backbone elements in the dual-vector system. For example, its sequence can be as shown in SEQ ID NO:7, where the 5' ITR sequence is located at 1bp - 141bp, the CMV promoter sequence is located at 169bp - 752bp, the Kozak sequence is located at 792bp - 797bp, the EGFP sequence is located at 801bp - 1517bp, the WPRE sequence is located at 1536bp - 2124bp, the SV40 PolyA sequence is located at 2131bp - 2252bp, the 3' ITR sequence is located at 2290bp - 2430bp, the f1 Ori sequence is located at 2505bp - 2960bp, the kana resistance sequence is located at 3242bp - 4156bp, and the Ori sequence is located at 4327bp - 4515bp.
[0052] Figure 3 Schematic diagram for constructing the dual-vector system based on the wild-type human Strc nucleotide sequence (taking the cleavage site at 650Leu as an example), where both the first and second nucleic acid vectors have a signal peptide coding sequence at the C-terminus of the promoter sequence.
[0053] Figure 4 Schematic diagram of constructing a dual-vector system based on the codon-optimized human Strc nucleotide sequence (taking the cleavage site at 656Asn as an example), where both the first and second nucleic acid vectors have a signal peptide coding sequence at the C-terminus of the promoter sequence.
[0054] Figure 5 Schematic diagram of constructing a dual-vector system based on the codon-optimized human Strc nucleotide sequence (taking the cleavage site at 656Asn as an example), where the first nucleic acid vector has a signal peptide coding sequence at the C-terminus of the promoter sequence, and the second nucleic acid vector has removed the signal peptide coding sequence at the C-terminus of the promoter sequence.
[0055] Figure 6 Shows the expression of full-length STRC protein in co-transfected 293T cells by a dual-vector system based on the wild-type human Strc nucleotide sequence with different cleavage sites shown in Table 1.
[0056] Figure 7 Shows the expression of full-length STRC protein in co-transfected 293T cells by a dual-vector system of the codon-optimized human Strc nucleotide sequence with different cleavage sites, which shows that the codon-optimized cleavage site sequence leads to an increase in the expression level of full-length STRC protein. Among them Figure 7 Panel A shows the expression of full-length STRC protein in co-transfected 293T cells by a dual-vector system of the codon-optimized human Strc nucleotide sequence with different cleavage sites, where both the first and second nucleic acid vectors have a signal peptide coding sequence at the C-terminus of the promoter sequence; Figure 7 Panel B shows the expression of full-length STRC protein in co-transfected 293T cells by a dual-vector system of the codon-optimized human Strc nucleotide sequence with different cleavage sites, where the first nucleic acid vector has a signal peptide coding sequence at the C-terminus of the promoter sequence, and the second nucleic acid vector has removed the signal peptide coding sequence at the C-terminus of the promoter sequence.
[0057] Figure 8 Shows the auditory brainstem response (ABR) results in a Strc knockout mouse model treated with the dual-vector system, which shows that the ABR threshold is reduced in the treated Strc knockout mouse model, and the hearing in some frequency bands is significantly restored, approaching the hearing threshold of WT mice.
[0058] Figure 9 Shows the immunofluorescence results of STRC protein expression in the cochlea of a Strc knockout mouse model treated with the dual-vector system. After audiometry, the mice were sacrificed and the cochleas were taken for basilar membrane spreading staining. The immunofluorescence results show that the dual AAV vector system of the present invention achieved the expression of STRC protein in the cochlea of mice and restored the hearing. Detailed Embodiments
[0059] Unless otherwise defined herein, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In addition, the materials, methods, and examples described herein are illustrative only and are not intended to be limiting. Other features, objects, and advantages of the invention will be apparent from this specification, the drawings, and the appended claims.
[0060] I. Definitions
[0061] As used herein, the term "about" when used in conjunction with a numerical value means to cover a numerical value within a range that has a lower limit that is 5% less than the specified numerical value and an upper limit that is 5% greater than the specified numerical value. This term is also intended to cover numerical values within the range of ±1%,
[0062] ±0.5%, or ±0.1% of the specified number.
[0063] As used herein, the term "comprising" or "including" means including the recited elements, integers, or steps, or groups of elements, integers, or steps, but not excluding any other elements, integers, or steps, or other groups of elements, integers, or steps. As used herein, when the term "comprising" or "including" is used, unless otherwise specified, it also encompasses the case of consisting of the recited elements, integers, or steps. For example, when referring to a polynucleotide "comprising" a specific sequence, it is also intended to encompass a polynucleotide consisting of that specific sequence.
[0064] As used herein, the expression "and / or" when used in conjunction with two or more items is intended to mean any one of the listed related items, or any plurality or all of the possible combinations of the listed related items.
[0065] The intein or protein intein (also known as protein intron, Intein) described herein is a polypeptide chain in a precursor immature protein. Through a series of self-catalytic reaction processes such as rearrangement, transesterification, and cyclization, it can be excised from the precursor protein and the protein polypeptide segments (protein exteins) at its two ends can be connected by a natural peptide bond, that is, the protein structure can be rearranged through protein self-splicing. Split intein is a structural type of intein. Structurally, its N-terminal region and C-terminal region are separated from each other, and when the two fragments where the N-terminal region and C-terminal region of the intein are located are connected, the splicing of the exteins at its two ends can be completed according to the standard intein splicing pathway.
[0066] Most inteins are composed of terminal splicing regions at both ends and a homing endonuclease domain or linker domain in the middle. Inteins can be divided into three types: canonical inteins, miniinteins, and split inteins. Both the canonical inteins and miniinteins contain splicing domains at both ends and a middle region. The difference between them is that the middle region of the canonical intein is an endonuclease domain, while the middle region of the miniintein is a linker domain, and the lengths of the linker domains of different miniinteins are not the same. The middle region of the split intein is disconnected at a specific site to form an N-terminal fragment and a C-terminal fragment, and they are located on two genes far apart on the genome. In the process of precursor protein translation and maturation, these two intein fragments recognize each other and restore endonuclease activity, mediating protein trans splicing. In this context, the dual AAV vector system can be used to deliver nucleic acids encoding split inteins. For example, in the present invention, the intein N-terminal fragment is shown in SEQ ID NO:5, and the intein C-terminal fragment is shown in SEQ ID NO:6.
[0067] Usually, inteins are composed of 10 modules, starting from the N-terminus of the intein, they are A, N2, B, N4, C, D, E, H, F and G, among which A, N2, B, N4 are N-terminal splicing regions, F and G are C-terminal splicing regions, and C, D, E, H are self-guided endonuclease active regions or connecting domains. The amino acid residues at the splicing sites of the motifs involved in intein splicing in the A, B, F, and G modules are highly conserved, which are necessary for the affinity displacement reaction during intein splicing. The motifs in the A module of the intein usually contain amino acids with hydroxyl or sulfhydryl groups, such as Ser and Cys. The motifs in the B module contain the highly conserved amino acid sequence of Thr-XX-His, which is also present in serine proteases. The conserved amino acid residues of the motifs involved in the splicing reaction in the G module are Asn, Ser, Cys, Thr, and His. In addition, the conserved sites in the motif of the A module (such as Ser, Cys) can be replaced by Ala, Gln or Pro in some inteins, and the same is true for the motif of the G module.
[0068] As used herein, "hearing loss" refers to hearing below the normal hearing threshold level as determined by audiometry, including mild, moderate, severe, and profound hearing loss, as well as deafness. Hearing loss can be described by the percentage of hearing loss, e.g., 30%, 60%, 80%, or even 100% hearing loss, or by the classification of hearing loss. The hearing loss can be a hearing loss caused by or associated with a genetic defect, such as congenital deafness and prelingual deafness caused by genetic factors, or a hearing loss induced by environmental factors (e.g., aging, noise, drugs, or infections) associated with genetic factors. Hearing loss can be asymptomatic (i.e., there are no associated visible outer ear or other organ abnormalities) or symptomatic. In some embodiments, the hearing loss is sensorineural hearing loss.
[0069] As used herein, "hearing loss-related gene" refers to a gene in which a variation can cause hearing loss or create a susceptibility to hearing loss by altering the ability of the inner ear to function properly. Such a gene is also referred to herein as a "hearing loss gene". More than 100 genes have been identified as being related to hearing loss (see, Hereditary Hearing Loss Homepage, https: / / hereditaryhearingloss.org / , which lists the gene locations and identification data for currently known monogenic asymptomatic hearing loss). In cases where it creates a susceptibility to hearing loss, an individual carrying a variation of the hearing loss gene may exhibit a greater susceptibility to hearing loss due to environmental factors, such as aging, noise, drugs, or infections, compared to a healthy individual.
[0070] As used herein, "inner hair cells of the cochlea" refers to inner hair cells or cell lines or cell populations of the cochlea in vitro or in vivo from a mammal, or inner hair cells in the cochlea of a mammal.
[0071] As used herein, "outer hair cells of the cochlea" refers to outer hair cells or cell lines or cell populations of the cochlea in vitro or in vivo from a mammal, or outer hair cells in the cochlea of a mammal.
[0072] As used herein, an "isolated" nucleic acid refers to a nucleic acid molecule that is either synthetically produced or isolated from at least some of the components of its natural environment. For example, an isolated nucleic acid can be a part of a larger nucleic acid, or a part of a vector or a composition of matter, or can be contained within a cell and still be "isolated" provided that the larger nucleic acid, vector, composition of matter, or particular cell is not the natural environment of the nucleic acid.
[0073] As used herein, the term "operably linked" is also referred to as "effectively linked" or "functionally linked", and means that two or more polynucleotide (e.g., DNA) segments are in a relationship that allows them to function in the desired manner. For example, if a promoter sequence stimulates or regulates the transcription of a coding sequence in a suitable host cell or other expression system, then the promoter sequence is operably linked to the coding sequence. Generally, a promoter operably linked to a transcribable sequence is contiguous with the transcribable sequence, i.e., they are cis-acting. However, some transcriptional regulatory sequences (such as enhancers) need not be physically adjacent to or in close proximity to the coding sequence whose transcription they enhance.
[0074] A "promoter" refers to a polynucleotide sufficient to direct the transcription of a downstream polynucleotide. In some embodiments, the nucleic acid vectors described herein may contain one or more regulatory elements. Those of ordinary skill in the art can select regulatory elements suitable for use in mammalian cells or human host cells. Non-limiting examples of regulatory elements include promoters, transcription termination sequences, translation termination sequences, enhancers, and polyadenylation elements. The nucleic acid vectors described herein may contain a promoter sequence operably linked to a nucleotide sequence encoding a polypeptide of interest (e.g., the STRC protein). Promoters used in the present invention include, but are not limited to, the cytomegalovirus (CMV) promoter, the SV40 promoter, the Rous sarcoma virus (RSV) promoter, the chimeric CMV / chicken β-actin promoter (CBA), and the truncated form of CBA (smCBA). In some embodiments, the promoter is the CMV promoter.
[0075] A "signal peptide" is an amino acid sequence linked to the N-terminus of an exogenous protein sequence, which promotes the secretion of the exogenous protein outside the cell. The mature form of the extracellular protein has no signal sequence, which is excised during the secretion process.
[0076] The term "full-length STRC protein" refers to the STRC protein produced by operably linking the N-terminal portion and the C-terminal portion of the STRC protein expressed in the dual-vector system of the present invention, which may be the full-length STRC protein shown in SEQ ID NO.2 or its functional derivative or its functional fragment.
[0077] As used herein, the term "Adeno-associated virus (AAV)" was named because it was found in adenovirus preparations. AAV is a member of the Parvovirus family, contains multiple serotypes, and its genome is single-stranded DNA.
[0078] AAV is a dependent virus that requires other viruses such as adenovirus, herpes simplex virus, human papillomavirus, or accessory factors to provide accessory functional proteins for replication.
[0079] The earliest isolated AAV virus is serotype 2 AAV (AAV2). The AAV2 genome is about 4.7 kb in length, with "inverted terminal repeats" (ITRs) of 145 bp at both ends of the genome, presenting a palindrome-hairpin structure. There are two large open reading frames (ORFs) in the genome, encoding the rep and cap genes respectively.
[0080] ITR is a cis-acting element of the AAV vector genome and plays an important role in the integration, rescue, replication, and genome packaging of AAV viruses. The ITR sequence contains a Rep protein binding site (RBS) and a terminal resolution site trs (terminal resolution site), which can be recognized and bound by the Rep protein to generate a nick at trs. The ITR sequence can also form a unique "T" letter-shaped secondary structure, which plays an important role in the life cycle of AAV viruses.
[0081] The rest of the AAV2 genome can be divided into two functional regions, the rep gene region and the cap gene region.
[0082] The rep gene region encodes four Rep proteins, Rep78, Rep68, Rep52, and Rep40. Rep proteins play important roles in the replication, integration, rescue, and packaging of AAV viruses. Among them, Rep78 and Rep68 specifically bind to the terminal resolution site trs and the GAGY repeat motif in the ITR, initiating the replication process of the AAV genome from single-stranded to double-stranded. The trs and GAGC repeat motif and / or GAGY repeat motif in the ITR are the centers of AAV genome replication. Therefore, although the ITR sequences are different in various serotypes of AAV viruses, they can all form hairpin structures and have Rep binding sites. There is a p19 promoter at position 19 of the AAV2 genome map, which initiates the expression of Rep52 and Rep40 respectively. Rep52 and Rep40 have ATP-dependent DNA helicase activity but do not have the function of binding to DNA.
[0083] The cap gene encodes the capsid proteins VP1, VP2, and VP3 of AAV viruses. Among them, VP3 has the smallest molecular weight but the largest number. In mature AAV particles, the ratio of VP1, VP2, and VP3 is approximately 1:1:10. VP1 is necessary for the formation of infectious AAV; VP2 assists VP3 in entering the nucleus; VP3 is the main protein constituting AAV particles.
[0084] As used herein, the term "AAV vector" refers to an efficient exogenous gene transfer tool, i.e., an AAV vector, that is transformed from wild-type AAV virus as people gain an understanding of the AAV virus life cycle and its related molecular biological mechanisms. The modified AAV vector genome contains only the ITR sequence of the AAV virus and the exogenous sequence to be transported. The Rep and Cap proteins required for AAV virus packaging are provided in trans by other exogenous plasmids, thereby reducing the possible harm caused by packaging rep and cap genes into AAV vectors. Furthermore, the AAV virus itself is not pathogenic, which makes the AAV vector one of the most recognized safe viral vectors.
[0085] There are many AAV virus serotypes, and different serotypes have different tissue infection tropisms. Therefore, the use of AAV vectors can transport exogenous genes to specific organs and tissues.
[0086] The prior art has a relatively mature packaging system for AAV vectors, which facilitates the large-scale production of AAV vectors.
[0087] The term "vector genome (vg)" refers to the nucleic acid sequence that is packaged within the rAAV capsid to form the rAAV vector.
[0088] As used herein, "individual" and "subject" are used interchangeably and refer to mammals. Examples of mammals include, but are not limited to, humans, non-human primates (e.g., cynomolgus monkeys, rhesus monkeys), rodents, and other mammals, e.g., cattle, pigs, horses, dogs. As used herein, mammals include individuals at all stages of development, including embryonic and fetal stages.
[0089] As used herein, the term "treatment" refers to a clinical intervention intended to alter the natural course of a disease in the individual being treated. Desired therapeutic effects include, but are not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of progression of the disease, ameliorating or relieving the disease state, and alleviating or improving prognosis. The term "treatment" also encompasses modification or improvement of at least one physical parameter, including physical parameters that may not be discernible by the patient.
[0090] As used herein, the term "prevention" refers to preventing or delaying the onset or development or progression of a disease or condition. As used herein, "prevention" generally refers to hospital intervention performed before at least one symptom of a disease occurs.
[0091] Various aspects of the present invention are described below.
[0092] II. Dual vector system
[0093] The present invention utilizes protein trans-splicing method, that is, the CDSs of the N-terminal and C-terminal of STRC are respectively constructed into two different plasmids for expression, and are spliced into a complete full-length protein through intein splicing. The N-terminal plasmid adds the N-terminal coding sequence of the intein to the 3' end of the STRC N-terminal CDS sequence, such as the nucleic acid sequence encoding the Rm-N-intein sequence (SEQ ID NO:5), and the first amino acid residue of the Rm-N-intein sequence contains Cys. The C-terminal plasmid adds the C-terminal coding sequence of the intein to the 5' end of the STRC C-terminal CDS sequence, such as the nucleic acid sequence encoding the Rm-C-intein (SEQ ID NO:6), and the terminal sequence of the Rm-C-intein contains His and Asn. The first amino acid residue of the STRC C-terminal CDS sequence is Cys, Ser, or Thr for intein splicing.
[0094] The present invention provides a dual-vector system for expressing STRC protein, which comprises a first nucleic acid vector and a second nucleic acid vector, wherein
[0095] the first nucleic acid vector contains a first nucleotide sequence; and the second nucleic acid vector contains a second nucleotide sequence;
[0096] the first nucleotide sequence contains an expression cassette inserted between two first ITR sequences;
[0097] the second nucleotide sequence contains an expression cassette inserted between two second ITR sequences;
[0098] the expression cassette of the first nucleotide sequence contains a promoter, the N-terminal coding sequence of STRC, the N-terminal coding sequence of the intein, and polyA;
[0099] the expression cassette of the second nucleotide sequence contains a promoter, the C-terminal coding sequence of the intein, the C-terminal coding sequence of STRC, and polyA.
[0100] Intein
[0101] Inteins can splice proteins and function by covalently linking two different proteins after protein translation or simultaneously during protein translation. The earliest inteins were discovered in fungi. Through the comparison and analysis of intein sequences, it is predicted that the number of intein genes present in viruses, bacteria, archaea, and eukaryotic microorganisms exceeds 600. Most inteins are complete proteins, but a small number of inteins are separated at the N-terminal and C-terminal, and each of the N-terminal and C-terminal of the intein is linked to a part of a protein and recombined after the translation of the protein, generating a complete protein through nucleophilic chemical reactions and allosteric changes.
[0102] In the present invention, preferably, the intein is N-terminal and C-terminal separated. The intein can be derived from MxeGyrA, pabPolIII, MjaKlbA, SspDnaB, SceVMA, SspDnaE, NpuDnaE, AvaDnaE, CraDnaE, CspDnaE, CwaDnaE, MchtDnaE, OliDnaE, TerDnaE, gp41-1, gp41-8, IMPDH-1 or RmaDnaB.
[0103] In some embodiments, the intein is the RmaDnaB intein, for example, having the N-terminal portion of the RmaDnaB intein shown in SEQ ID NO:5 and the C-terminal portion of the RmaDnaB intein shown in SEQ ID NO:6. In some embodiments, the intein is the NpuDnaE intein, for example, having the N-terminal portion of the NpuDnaE intein shown in SEQ ID NO:39 and the C-terminal portion of the NpuDnaE intein shown in SEQ ID NO:41.
[0104] STRC protein
[0105] In some embodiments, the STRC protein comprises or consists of the amino acid sequence of SEQ ID NO:2.
[0106] In some embodiments, a cleavage site is set on the amino acid sequence of the STRC protein to cleave the STRC protein into an N-terminal portion of the STRC protein (also abbreviated herein as the "N-terminus of STRC") and a C-terminal portion of the STRC protein (also abbreviated herein as the "C-terminus of STRC"). The N-terminus of STRC is the sequence from the N-terminus to the cleavage site of the STRC amino acid sequence, and the C-terminus of STRC is the sequence from the amino acid residue adjacent to the cleavage site to the C-terminus of the STRC amino acid sequence. The N-terminus of STRC is connected and fused with the N-terminus of the intein, and the C-terminus of the intein is connected and fused with the C-terminus of STRC. There are various choices for the cleavage site of STRC. Some of the positions of the cleavage site on the STRC protein and the corresponding N-terminal portion of STRC and C-terminal portion of STRC are listed in Table 1 below.
[0107] Table 1. Positions of the cleavage site on the STRC protein and the corresponding N-terminal portion of STRC and C-terminal portion of STRC
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114] In some embodiments, the STRC protein is cleaved at one or more sets of the following amino acid residues to form an N-terminal portion of the STRC protein and a C-terminal portion of the STRC protein: 650Leu, 947Leu, 651Ser, 967Leu, 657Cys, 982Arg, 669Arg, 983Ser, 688Pro, 989Leu, 697Pro, 1001Phe, 698Ser, 1012Leu, 701Ile, 1027Thr, 710Phe, 1047Leu, 722Lys, 1053Cys, 747Leu, 1062Leu, 774Pro, 1079Cys, 795Thr, 1086Leu, 802Leu, 1089Leu, 811Val, 656Asn, 819Pro, 708Ala, 825Asp, 933Ala, 834Tyr, 960Glu, 885Leu, 1052Leu, 895Asp, 1078Ala, 912Arg, 1080Ser, 917Gln, 1091Ala, 936Leu, 119Val or 942Gln, wherein the amino acid positions are relative to the positions in SEQ ID NO:2.
[0115] In some embodiments, the STRC protein is cleaved at one or more sets of the following amino acid residues to form an N-terminal portion of the STRC protein and a C-terminal portion of the STRC protein: positions 656, 722, 917 or 708, wherein the amino acid positions are relative to the positions in SEQ ID NO:2.
[0116] In some embodiments, the STRC protein is cleaved into an N-terminal portion of the STRC protein and a C-terminal portion of the STRC protein selected from any one of the following groups:
[0117] Table 2 Exemplary cleavage sites of the STRC protein shown in SEQ ID NO:2
[0118]
[0119]
[0120]
[0121] Optionally, wherein the amino acid positions are relative to the positions in SEQ ID NO:2.
[0122] In some embodiments, the STRC protein is cleaved into an STRC protein N-terminal portion and an STRC protein C-terminal portion selected from any one of the following groups:
[0123] 1 - 656aa + 657 - 1775aa;
[0124] 1 - 722aa + 723 - 1775aa;
[0125] 1 - 917aa + 918 - 1775aa; or
[0126] 1 - 708aa + 709 - 1775aa,
[0127] Optionally, wherein the amino acid positions are relative to the positions of SEQ ID NO:2.
[0128] In some embodiments, the STRC protein is cleaved into an amino acid sequence of the STRC protein N-terminal portion of 1 - 656aa and an amino acid sequence of the STRC protein C-terminal portion of 657 - 1775aa.
[0129] In some embodiments, the STRC protein is cleaved into an amino acid sequence of the STRC protein N-terminal portion of 1 - 722aa and an amino acid sequence of the STRC protein C-terminal portion of 723 - 1775aa.
[0130] In some embodiments, the STRC protein is cleaved into an amino acid sequence of the STRC protein N-terminal portion of 1 - 917aa and an amino acid sequence of the STRC protein C-terminal portion of 918 - 1775aa.
[0131] In some embodiments, the STRC protein is cleaved into an amino acid sequence of the STRC protein N-terminal portion of 1 - 708aa and an amino acid sequence of the STRC protein C-terminal portion of 709 - 1775aa.
[0132] Vector plasmid
[0133] The vector plasmid of the present invention can be any plasmid capable of replicating and expressing the corresponding polypeptide in a host cell.
[0134] In some embodiments, the vector plasmid contains two ITR sequences, namely a 5' inverted terminal repeat (5' ITR) sequence and a 3' inverted terminal repeat (3' ITR) sequence, respectively.
[0135] In some embodiments, in the dual-vector system for expressing STRC protein of the present invention, a first nucleotide sequence is inserted into a plasmid containing two first ITR sequences, and a second nucleotide sequence is inserted into a plasmid containing two second ITR sequences. For example, the plasmid containing two first ITR sequences and the plasmid containing two second ITR sequences are the same or different. For example, the plasmid is pAAV, pAAV-CMV, pX601, pX551 or pAAV-MCS plasmid.
[0136] Dual-vector system
[0137] The present invention provides a dual-vector system comprising a first nucleic acid vector and a second nucleic acid vector, wherein:
[0138] The first nucleic acid vector contains, in the 5'-3' direction: a 5' inverted terminal repeat (5' ITR) sequence, a nucleic acid sequence encoding the N-terminal portion of the STRC protein, a nucleic acid sequence encoding the N-terminal portion of the intein, and a 3' inverted terminal repeat (3' ITR) sequence;
[0139] The second nucleic acid vector contains, in the 5'-3' direction: a 5' ITR sequence, a nucleic acid sequence encoding the C-terminal portion of the intein, a nucleic acid sequence containing the C-terminal portion of the STRC protein and a 3' ITR sequence, and
[0140] Optionally, after introducing the first nucleic acid vector and the second nucleic acid vector into a host cell, the N-terminal portion and the C-terminal portion of the STRC protein are effectively ligated to produce the STRC protein.
[0141] In some embodiments, the present invention provides a dual-vector system comprising a first nucleic acid vector and a second nucleic acid vector, wherein:
[0142] The first nucleic acid vector contains, in the 5'-3' direction: a 5' inverted terminal repeat (5' ITR) sequence, a nucleic acid sequence encoding the N-terminal portion of the STRC protein, a nucleic acid sequence encoding the N-terminal portion of the intein and a 3' inverted terminal repeat (3' ITR) sequence;
[0143] The second nucleic acid vector contains, in the 5'-3' direction: a 5' ITR sequence, a nucleic acid sequence encoding the C-terminal portion of the intein, a nucleic acid sequence encoding the C-terminal portion of the STRC protein and a 3' ITR sequence, and
[0144] An STRC cleavage site is provided in the amino acid sequence of the STRC protein. For example, the amino acid sequence of the STRC protein is as shown in SEQ ID NO:2 or a functional fragment thereof. For example, an amino acid sequence having at least 80% sequence identity with SEQ ID NO:2;
[0145] The N-terminal portion of the STRC protein is the sequence from the N-terminus of the STRC amino acid sequence to the STRC cleavage site;
[0146] The C-terminal portion of the STRC protein is the sequence from the amino acid immediately following the STRC cleavage site to the C-terminus of the STRC amino acid sequence;
[0147] Optionally, after introducing the first nucleic acid vector and the second nucleic acid vector into a cell, the N-terminal portion of the STRC protein and the C-terminal portion of the STRC protein are effectively linked to produce a full-length STRC protein.
[0148] In some embodiments, the nucleotide sequences of the ITRs in the dual-vector system are respectively derived from the same AAV serotype or different AAV serotypes, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 serotypes. In some embodiments, the 5'-ITR and 3'-ITR of the first nucleic acid vector and the 5'-ITR and 3'-ITR of the second nucleic acid vector are derived from the same AAV serotype. In some embodiments, the 5'-ITR and 3'-ITR of the first nucleic acid vector and the 5'-ITR and 3'-ITR of the second nucleic acid vector are respectively from different AAV serotypes.
[0149] In some embodiments, a tissue-specific promoter is used in the dual-vector system. For example, a promoter that mediates expression in the ear, such as the synapsin promoter or the GFAP promoter.
[0150] In some embodiments, any one of the following promoters is used in the dual-vector system: cytomegalovirus (CMV) promoter, SV40 promoter, Rous sarcoma virus (RSV) promoter, CAG promoter, chimeric CMV / chicken β-actin (CBA) promoter, truncated form of CBA (smCBA) promoter, UbC promoter, SFFV promoter, EF1α promoter, PGK promoter, or promoters of Myo7A, Myo15, Atoh1, POU4F3, Lhx3, Myo6, α9AchR, α10AchR, OTOF, and STRC-encoding genes. In some embodiments, the promoter is the CMV promoter.
[0151] The dual-vector system of the present invention may further comprise one or more other regulatory sequences that can act before or after transcription. The regulatory sequences can be part of the native transgenic locus or can be heterologous regulatory sequences. A portion of the 5'UTR or 3'UTR of the native transgenic transcript can be included in the dual-vector system of the present invention.
[0152] A regulatory sequence can be any sequence that promotes transgene expression, i.e., is used to increase transcript expression, improve nuclear export of mRNA or enhance its stability. Such regulatory sequences include, for example, enhancer elements, post-transcriptional regulatory elements and polyadenylation sequences.
[0153] An enhancer is a cis-regulatory element that affects the transcription of a gene on the same molecule of DNA. Enhancers can be located upstream, downstream, within an intron of the gene they regulate, or even relatively far from the gene they regulate.
[0154] A preferred post-transcriptional regulatory element used in the dual-vector system of the present invention is the woodchuck hepatitis post-transcriptional regulatory element (WPRE) or a variant thereof. Compared with an AAV vector without WPRE or its variant, the AAV vector containing WPRE or its variant increases the expression of STRC protein.
[0155] In one embodiment, the dual-vector system of the present invention comprises a WPRE nucleotide sequence shown in SEQ ID NO:13. In another embodiment, the dual-vector system of the present invention comprises a post-transcriptional regulatory element having a nucleotide sequence that is at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the WPRE nucleotide sequence shown in SEQ ID NO:13, wherein the nucleotide sequence substantially retains the functional activity of the post-transcriptional regulatory element shown in SEQ ID NO:13, for example, a truncated variant of WPRE. Reducing the size of the AAV genome enables increased flexibility in introducing other regulatory elements into the vector in addition to the transgene. In one embodiment, the truncated variant of WPRE has the WPRE3 nucleotide sequence shown in SEQ ID NO:16.
[0156] In one embodiment, the dual-vector system of the present invention comprises a polyadenylation sequence, for example, the bovine growth hormone polyadenylation sequence, the SV40 polyadenylation sequence and / or the SV40 late polyadenylation sequence. In one embodiment, the dual-vector system of the present invention comprises an SV40 polyadenylation sequence having a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence shown in SEQ ID NO:14. In one embodiment, the dual-vector system of the present invention comprises an SV40 late polyadenylation sequence having a nucleotide sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence shown in SEQ ID NO:17.
[0157] In some embodiments, the dual-vector system of the present invention comprises a combination of the WPRE nucleotide sequence and the SV40 polyadenylation sequence. For example, the dual-vector system of the present invention has the nucleotide sequence shown in SEQ ID NO:12 or a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:12. The combination of the WPRE nucleotide sequence and the SV40 polyadenylation sequence enables high-level expression of the transgene.
[0158] In some embodiments, the dual-vector system of the present invention comprises a combination of the WPRE3 nucleotide sequence and the SV40 late polyadenylation sequence. For example, the dual-vector system of the present invention has the nucleotide sequence shown in SEQ ID NO:15 or a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:15. The combination of the WPRE3 nucleotide sequence and the SV40 late polyadenylation sequence (also abbreviated as "W3SL") can efficiently express larger foreign genes and occupy less AAV packaging capacity.
[0159] In some embodiments, a signal peptide sequence is provided in the dual-vector system, which post-translationally localizes the effectively linked polypeptide to one or more cellular destinations (including, for example, specific organelle compartments) or to the site of protein synthesis and / or activity, and even to the extracellular environment.
[0160] By using the dual-vector system, the present invention provides the STRC protein gene in two parts to inner ear cells, inner hair cells or outer hair cells, where the N-terminal part and the C-terminal part of the STRC protein expressed undergo trans-splicing to form the full-length STRC protein. The present invention has confirmed that the dual-vector system for expressing the STRC protein of the present invention can effectively transduce the targeted inner ear cells, inner hair cells or outer hair cells, produce the STRC protein in the cells, and restore the hearing impairment caused by STRC gene knockout in a persistent manner.
[0161] In a preferred embodiment, the dual-vector system of the present invention allows the expression of a homologous polypeptide having an amino acid sequence with at least 70% identity and / or similarity to SEQ ID NO:2. The homologous sequence is more preferably at least 75%, even more preferably at least 80%, or at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 99%, at least 99% identity and / or similarity to SEQ ID NO:2. When the homologous polypeptide is much shorter than SEQ ID NO:2, local alignment can be considered.
[0162] In another embodiment, the dual-vector system of the present invention can allow the expression of a functional fragment of the STRC protein polypeptide. The term "functional fragment" as used herein refers to any fragment that retains at least one biological function of the STRC protein polypeptide of interest.
[0163] The full-length STRC protein can be obtained by transforming a host cell with the dual-vector system described in the present invention. In some embodiments, the host cell is selected from Hela-S3 cells, HEK-293 cells, HEK-293T cells, HEK-293FT cells, A549 cells, and Sf9 cells.
[0164] III. Uses of the Dual-Vector System
[0165] The dual-vector system of the present invention is used to administer to a patient suffering from DFNB16 deafness. A "patient suffering from DFNB16 deafness" refers to such a patient, particularly a human patient, who is considered to have (or has been diagnosed as having) a mutation in the gene encoding the constitutive STRC protein, which mutation triggers abnormal expression, abnormal function, or both of the STRC protein.
[0166] In some embodiments, the dual-vector system of the present invention is a dual-AAV vector system. In some embodiments, the first AAV vector and the second AAV vector in the dual-AAV vector system are vectors each having a capsid of the same or different AAV origin. For example, the first AAV vector and the second AAV vector in the dual-AAV vector system are vectors each having an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-Anc80 capsid or an AAV vector having a chimeric capsid, particularly an AAV vector having an AAV-Anc80 capsid. Preferably, the synthetic adeno-associated virus vector Anc80L65 is used, which has been shown to have the highest transduction efficiency in inner ear hair cells reported to date (Suzuki et al., Sci. Rep. 7:45524 (2017)).
[0167] The dual AAV vector system, after administration, treats STRC mutation-related autosomal recessive nonsyndromic DFNB16 deafness by increasing the expression of wild-type STRC protein or providing wild-type STRC protein to a subject.
[0168] The dual vector system of the present invention, after administration, can trigger the expression of full-length STRC protein polypeptide, or a functional fragment thereof, in inner ear cells, inner hair cells or outer hair cells.
[0169] The patients to whom the dual vector system of the present invention is administered are preferably newborn human infants, usually less than 6 months old, even less than 3 months old (if they are diagnosed with DFNB16 deafness in infancy). These human infants are more preferably between 3 months and 1 year old.
[0170] The dual vector system of the present invention can also be administered to, for example, young children (2 - 6 years old), children (6 - 12 years old), adolescents (12 - 18 years old) or adults (18 years old and above).
[0171] As used herein, the term "treatment" is intended to mean administering a therapeutically effective amount of the dual vector system of the present invention to a patient suffering from DFNB16 deafness so as to partially or completely restore the hearing of the patient. The restoration can be evaluated by testing the auditory brainstem response (ABR) using an electrophysiological device. "Treating hearing impairment induced by STRC mutation" particularly refers to the complete restoration of hearing function. The term "prevention" refers to reducing or delaying hearing loss within the audible frequency range.
[0172] Examples
[0173] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention. Unless otherwise specified, various reaction reagents involved in the examples can be obtained through commercial channels.
[0174] Example 1. Designing intein cleavage sites in the amino acid sequence of the full-length STRC protein
[0175] Intein cleavage sites as shown in Table 2 were designed in the human STRC protein shown in SEQ ID NO:2, with a total of 47 cleavage sites.
[0176] Each N-terminal fragment of the STRC protein in Table 2 (also referred to herein as "N-Strc", "5'Strc") and each C-terminal fragment of the STRC protein (also referred to herein as "C-Strc", "3'Strc") are encoded by the corresponding nucleotide sequences shown in SEQ ID NO:1.
[0177] Example 2. Construction of a dual-vector system for expressing STRC protein using a plasmid containing ITR sequences
[0178] The schematic diagram of the dual-vector system used in this example is as shown in Figure 1 . Using the pAAV-CMV-EGFP-WPRE-SV40 plasmid (synthesized by Nanjing Genscript Co., Ltd., Figure 2 ), the first nucleic acid vector expressing the N-terminus of the STRC protein and the second nucleic acid vector expressing the C-terminus of the STRC protein were constructed. Figure 3 The dual-vector system constructed for the cleavage site numbered 1 (i.e., using 650aaLeu of the STRC protein as the cleavage site) is exemplified. In the second nucleic acid vector, an HA tag (the HA tag sequence YPYDVPDYA (SEQ ID NO:8) was used to verify in vitro expression) was ligated to the end of the coding sequence (CDS) expressing the C-terminus of the STRC protein, thereby obtaining the dual-vector system.
[0179] Specifically, the first nucleic acid vector and the second nucleic acid vector in this dual-vector system were obtained by modifying on the Figure 2 shown pAAV-CMV-EGFP-WPRE-SV40 plasmid backbone. Specifically, using
[0180] the pAAV-CMV-EGFP-WPRE-SV40 plasmid backbone( Figure 2)It was transformed. By using double digestion with EcoRI and EcoRV, the EGFP reporter gene sequence and other sequences in the pAAV-CMV-EGFP-WPRE-SV40 plasmid backbone were replaced with the target sequence containing the coding sequence of the 5’Strc NT part and the N-terminal sequence of the intein to obtain the first nucleic acid vector; by using double digestion with EcoRI and EcoRV, the EGFP reporter gene sequence in the pAAV-CMV-EGFP-WPRE-SV40 plasmid backbone was replaced with the target sequence containing the C-terminal sequence of the intein and the coding sequence of the 3’Strc CT to obtain the second nucleic acid vector. The obtained first nucleic acid vector contains inverted terminal repeats (ITR), CMV promoter sequence, Kozak sequence, cDNA sequence containing the coding sequence of the N-terminal (5’Strc NT) part of the STRC protein, a segment of the N-terminal sequence of the intein (“N-intein”) (the encoded amino acid sequence is as shown in SEQ ID NO:5), WPRE sequence, SV40 PolyA sequence, Ori sequence and resistance sequence; the second nucleic acid vector includes inverted terminal repeats (ITR), CMV promoter sequence, a segment of the C-terminal sequence of the intein (“C-intein”) (the encoded amino acid sequence is as shown in SEQ ID NO:6), Kozak sequence, cDNA sequence containing the coding sequence of the C-terminal (3’Strc CT) part of the STRC protein, WPRE sequence, SV40 PolyA sequence, Ori sequence and resistance sequence. After the first nucleic acid vector and the second nucleic acid vector are expressed in cells, the full-length STRC protein is expressed by protein trans-splicing method.
[0181] The synthesis of the said sequence and the construction of the vector were both commissioned to Nanjing Genscript Biotech Co., Ltd. to complete.
[0182] 47 pairs of plasmids corresponding to the 47 cleavage sites in Table 2 were obtained for the subsequent examples.
[0183] Example 3. Recombination of the constructed plasmids in cells
[0184] The 47 pairs of plasmids obtained in Example 2 were transfected into HEK-293T cells (the cells were purchased from ATCC) in pairs respectively. 48 hours after transfection, the expression of the full-length STRC protein was analyzed by Western blot. The specific experimental method is as follows.
[0185] Cell transfection: HEK-293T cells (Human Embryonic Kidney 293T cells, also abbreviated as "293T cells" hereinafter) were inoculated and transfection was prepared when the cell density reached 70-90%. Prepare Tube A: 125 μL of serum-free DMEM medium + 8 μL of Lipofectamine 3000 reagent (Invitrogen, catalog number: L3000015), and mix well. Prepare Tube B: 125 μL of serum-free DMEM medium + 2 μg of the first nucleic acid vector + 2 μg of the second nucleic acid vector + 8 μL of P3000 reagent (Invitrogen, catalog number: L3000015), and mix well. Add the mixture in Tube B to Tube A, mix gently and thoroughly, and let it stand at room temperature for 10-15 min. Tube A is a mixture of medium and Lipofectamine 3000 transfection reagent, and Tube B is a mixture of medium, vector plasmid DNA, and transfection enhancer P3000. Add the obtained DNA-liposome complex to 293T cells for transfection, incubate at 37 °C, 95% air and 5% CO2, and harvest the cells by centrifugation 48 hours after transfection.
[0186] The cell pellet harvested by centrifugation after cell transfection was resuspended thoroughly in an appropriate amount of RIPA lysis buffer (Thermo Fisher Scientific, catalog number: 89900) (added with 1% protease inhibitor cocktail (Thermo Fisher Scientific, catalog number: 87786), 1% PMSF), and lysed on ice for 30 min. During this period, vortex every 10 min to ensure that the cell pellet was fully resuspended in the lysis buffer. Centrifuge at 12000 rpm for 15 min to collect the supernatant (do not aspirate the pellet), add the sample in proportion with 5X loading buffer, boil at 75 °C for 15 min, cool on ice, and after centrifugal sedimentation, take the supernatant for Western blot analysis.
[0187] Western blot detection of STRC protein expression: Wash the glass plates, fix the glass plates flat on the rack, clamp them with the concave side facing inwards, and place two symmetrically in the front and back. Prepare the separating gel, seal it with isopropanol, pour off the isopropanol after 0.5 h, place it sideways and suck it dry with a pump. Prepare the stacking gel, add it until it overflows, and insert the comb. After 45 min, remove the gel plate, install it on the clips of the electrophoresis tank, add the running buffer from the center of the tank until the running buffer overflows to half of the tank volume, and carefully pull out the comb with force. Load the sample, perform electrophoresis at a constant voltage of 100 v for 1 h and transfer the membrane at a constant current of 300 mA on ice for 90 min.
[0188] Take out the PVDF membrane after the transfer is completed, and incubate it with the blocking solution (5% skim milk powder, prepared with TBST buffer) at room temperature for 1 hour. Add the primary antibodies (HA-Tag Mouse mAb, Cell Signaling Technology, catalog number: 6E2; β-Actin Mouse mAb, Cell Signaling Technology, catalog number: 8H10D10) to the blocked PVDF membrane and incubate overnight at 4°C. Use the HA antibody as the primary antibody to detect the expression of the full-length STRC protein, and use the β-actin antibody as the primary antibody to detect the level of the internal reference protein β-actin in the Western blot. The protein level of β-actin usually does not change, so it can be used to detect whether the loading amount is consistent during Western blotting.
[0189] The next day, take out the incubated PVDF membrane, wash it 3 times with 1X TBST for 5 minutes each time, incubate it with the secondary antibody (HRP-conjugated Affinipure Goat Anti-Mouse IgG(H+L), Proteintech, catalog number: SA00001-1) at room temperature for 1 hour, wash it 3 times with 1X TBST for 5 minutes each time; then add the chemiluminescent reagent (ECL) and develop it in the darkroom.
[0190] The results of the target protein expression after the 47 pairs of plasmids obtained in Example 2 were co-transfected into 293T cells in pairs are as Figure 6 shown. Figure 6 In it, the lane "Ctrl" represents the cell protein control without transfected plasmid; the lane "FL" represents the full-length protein STRC, and the lanes "1" - "47" respectively represent the protein expression levels of STRC after the 47 pairs of plasmids obtained in Example 2 were co-transfected into 293T cells.
[0191] From Figure 6 it can be seen that for the cleavage sites where the first amino acid residue at the C-terminal part of STRC is Ser (cleavage site numbers 1 - 38 of the STRC protein), after the paired plasmids corresponding to cleavage site numbers 10 and 22 of the STRC protein were co-transfected into 293T cells respectively, significantly more full-length STRC protein expression was produced. For the cleavage sites where the first amino acid residue at the C-terminal part of STRC is Cys (cleavage site numbers 39 - 47 of the STRC protein), after the paired plasmids corresponding to cleavage site numbers 39 and 40 of the STRC protein were co-transfected into 293T cells respectively, significantly more full-length STRC protein expression was produced.
[0192] Example 4. Codon Optimization, Vector Construction and Recombinant Expression in Cells
[0193] The codon optimization of the Strc gene and the construction of the cleavage site plasmids were completed by Nanjing Genscript Biotech Co., Ltd. Specifically, the cDNA sequences corresponding to cleavage site numbers 10 and 22 of the STRC protein in Example 3 were selected for codon optimization; and the cDNA sequences corresponding to cleavage site numbers 39 and 40 of the STRC protein in Example 3 were selected for codon optimization. The nucleotide sequence of the Strc gene after codon optimization is shown in SEQ ID NO:4, and the encoded signal peptide sequence is shown in SEQ ID NO:3.
[0194] Using the nucleotide sequence of the Strc gene after codon optimization, a dual-vector system 48 - 55 (Table 3) expressing the STRC protein was constructed in a similar manner as described in Example 2. The synthesis of the sequences and the construction of the vectors were all completed by Nanjing Genscript Biotech Co., Ltd.
[0195] Table 3 Coding sequence information related to the STRC protein in the codon-optimized paired plasmids
[0196]
[0197]
[0198] Note: In Table 3, "GS-1-656" indicates that the coding nucleotide sequence of the N-terminal part 1 - 656 of STRC has been codon-optimized; "Signal peptide - GS-657-1775" indicates that the coding nucleotide sequence of the C-terminal part 657 - 1775 of STRC has been codon-optimized, and its N-terminal is linked to the nucleotide sequence encoding the signal peptide shown in SEQ ID NO:3. They correspond to the corresponding sequences in the nucleotide sequence of the Strc gene after codon optimization in SEQ ID NO:4 respectively.
[0199] The 8 pairs of plasmids obtained corresponding to Table 3 were transfected into HEK-293T cells in pairs using the method described in Example 3, and the expression of the full-length STRC protein was detected by Western blotting. The Western blotting results are as Figure 7 shown.
[0200] Figure 7 In it, the lane "Ctrl" represents the cell protein control without transfected plasmids; lanes "48" - "51" respectively represent the protein expression levels of STRC after co-transfecting 293T cells with the paired plasmids 48 - 51 in Table 3 (i.e., the C-terminal part (CT) of STRC encoded by the second plasmid vector also has a signal peptide coding sequence) ( Figure 4 ) and lanes "52" - "55" respectively represent the protein expression levels of STRC after co-transfecting 293T cells with the paired plasmids 52 - 55 in Table 3 (i.e., the C-terminal part (CT) of STRC encoded by the second plasmid vector does not have a signal peptide coding sequence) (Figure 5 ) Protein expression level of STRC after co - transfection into 293T cells.
[0201] From Figure 7 the results, it can be seen that in the case where the C - terminal part (CT) of STRC encoded by the second plasmid vector does not have a signal peptide - encoding sequence, the full - length STRC protein can still be formed, and it is not necessary to add a signal peptide sequence. After codon optimization, the expression level of the full - length STRC protein in cells has been significantly improved.
[0202] Example 5. Auditory function analysis and cochlear morphology analysis of Strc gene - knockout mice
[0203] 5.1 Construction of Strc gene - knockout mouse model
[0204] Entrust Suzhou Cyagen Biosciences Inc. to construct a mouse model with complete knockout of the Strc gene using the Crispr - Cas9 system; then detect the expression of the Strc gene in the knockout mice by sequencing, RT - PCR and immunofluorescence.
[0205] PCR (for crude genomic DNA extraction) method: Cut the mouse tail (2 - 5 mm) and put it into a microcentrifuge tube, add 200 μL of lysis buffer (vazyme, PD101 - 01), vortex it, and incubate it in a water bath at 55 °C for 20 min. After incubation, heat the sample at 95 °C or in a boiling water bath for 5 min to inactivate Proteinase K (vazyme, PD101 - 01). After vortexing the lysis product thoroughly, centrifuge it at 12,000 rpm for 5 min, and take the supernatant for PCR reaction. PCR amplification reaction system (50 μL): 2×Taq Plus Master Mix (Dye Plus) 25 μL, lysis product 2 μL, primer 1
[0206] (5’ - CTGCTAGGCATCTAACTGGTCTG - 3’ (SEQ ID NO: 9), 10 μM) 2 μL, primer 2 (5’ - CATGGGACCATCCACCTTACATT - 3’ (SEQ ID NO: 10), 10 μM) 2 μL, primer 3 (5’ - ACGAGGAAATCATGAAGTCGAAGTG - 3’ (SEQ ID NO: 11), 10 μM) 2 μL, ddH2O 17 μL; The amplification product is directly detected by agarose gel electrophoresis.
[0207] Immunofluorescence staining method: Take the temporal bone of neonatal mice and place it on an ice box. Dissect it quickly and rinse the temporal bone gently once with 1X PBS. Coat a 10-mm coverslip with the pre-packaged Cell Tak, 0.5 μL per coverslip, and let it dry (freshly coated). Place the coated coverslip into a culture dish with the cochlea, and attach the cochlea to the coverslip with the front side of the cochlea facing up. Place the attached coverslip into a 4-well culture dish (which has been pre-added with 3 ml of 1×PBS and placed on ice). After all the coverslips are attached, remove the PBS, and add 4% paraformaldehyde PFA (freshly prepared) to the 4-well culture dish. Fix at room temperature for 1 h and wash 3 times with 1×PBST. If the mouse is older than 7 days, cut the entire ear tissue of the mouse and place it in 1×PBS. Dissect the temporal bone under a microscope and place it in 4% PFA. Use forceps to gently punch holes at the top of the temporal bone, and repeatedly blow in PFA with a syringe. Place the temporal bone in 4% PFA and fix overnight at 4°C. Rinse 3 times with 1X PBS, 5 min each time, and then place it in 0.5 M EDTA (pH = 8.0) for decalcification: P0 - P7 (P0 - P7 represents the 0 - 7 days after the birth of the mouse), decalcify for 3 - 4 hours; P8 - P15, decalcify for 1 day; P15 - P30, decalcify for 2 days. Wash 3 times with 1×PBST, place the temporal bone in 1×PBS, and dissect the cochlea under a microscope. Coat a coverslip with Cell-tak and place it into a culture dish with the cochlea, attach the cochlea to the coverslip (front side up), and place the attached coverslip into a 4-well dish (which has been pre-added with 3 mL PBS). After all the attached coverslips are placed in the 4-well dish, use a blocking solution (PBS containing 1% Triton X-100 and 10% donkey serum) to block for 1 - 2 hours (85 μL / well); prepare the first antibody solution (STRC antibody, rabbit-derived, obtained from Hua'an Biotech) with PBT (PBS containing 1% Triton X-100 and 1% donkey serum), add the first antibody solution to the 4-well culture dish at 80 μL / well for incubation. Place the 4-well culture dish into a large culture dish lined with a paper towel with water to prevent the evaporation of the first antibody, and incubate overnight at 4°C; wash 3 times with 1×PBST (the second antibody can be prepared during this period), add the second antibody (Goat anti-Rabbit IgG(H+L) Cross-Adsorbed Secondary Antibody, AlexaFluor 488, Invitrogen, A-11008 and Alexa Fluor Plus 555 phalloidin, Invitrogen, A30106) to PBT in proportion, RT, 1 h (80 μL / well), protected from light. Wash 3 times with 1×PBST, add 6 μL of DAKO to each sample, cover with a coverslip, seal with nail polish, and store at 4°C.
[0208] Results: Cochlear basilar membrane spreads of Strc knockout mice at different time points were prepared as above. Immunofluorescence staining was performed using the stereocilia marker phalloidin (an actin fluorescent dye), the kinocilium marker acetylated α-tubulin, and an Strc antibody. The results showed that Strc was not expressed in the inner ear of knockout mice.
[0209] 5.2 Detection of Auditory Function in Strc Gene Knockout Mice
[0210] Littermate wild-type C57BL / 6J mice without Strc gene knockout at P30 (30 days old after birth) were used as controls. Auditory brainstem response (ABR), distortion product otoacoustic emission (DPOAE), and CP analysis were performed on Strc gene knockout mice at 30 days after birth to comprehensively evaluate the overall hearing status and inner ear hair cell function of Strc gene knockout mice.
[0211] A. ABR Threshold Analysis
[0212] Parameters such as auditory response threshold, latency, and inter-wave interval were detected by ABR. Click sounds, especially tone pips of different audio frequencies (4 KHz, 8 KHz, 12 KHz, 16 KHz, 24 KHz, 32 KHz), were used as stimulus sounds to detect the hearing thresholds of mice for different audio frequencies, analyze the hearing sensitivity of mice, and overall judge whether there is normal auditory function from hair cells to the cerebral cortex in mice. The higher the ABR threshold, the more severe the loss of auditory function in Strc gene knockout mice.
[0213] Auditory brainstem response (ABR): Mice were anesthetized with sodium pentobarbital (at a concentration of 10 mg / mL), then placed in a double-walled sound chamber system (IAC, Bronx, NY, USA) and corresponding recordings and tests were performed using a Smart EP evoked potential system. A subcutaneous needle was used as the experimental electrode (type F-E2, Astro-Med Inc., Rhode Island). The detection electrode used was implanted at the top of the mouse's head, and the reference electrode and ground electrode were implanted on the outside of the left and right ears, respectively. Biological signals needed to be processed with a band-pass filter for signals below 100 Hz and above 3000 Hz, amplified 200,000 times at the same time, and data was collected at an A / D sampling rate of 25 kHz. The anti-interference level during data collection needed to be set to 31.00 μV, and the acquisition results were directly displayed after being averaged by a computer. The computing time of the computer was basically stable at about 10 ms. The threshold was determined by increasing the sound pressure level (SPL) in 10 dB increments. The body temperature of the experimental animals needed to be kept constant throughout the entire experimental process.
[0214] B. Outer Hair Cell Function Analysis
[0215] The amplitude and threshold of distortion product otoacoustic emission (DPOAE) in mice were measured. A long-duration pure tone (2f1-f2) with two different frequencies and a certain frequency ratio relationship was used to induce DPOAE, and the function of outer hair cells in the cochlea of mice was preliminarily analyzed.
[0216] Distortion product otoacoustic emission detection (DPOAE): Mice were anesthetized with sodium pentobarbital (concentration used was 10 mg / mL), and then placed in a double-wall sound chamber system (IAC, Bronx, NY, USA) and recorded and tested using an IL092 otoacoustic emission meter (Otodynamic, UK). The probe used was prepared by the laboratory itself, and it was necessary to ensure good airtightness between the probe and the external auditory canal of the mice during the experiment. The probe was connected to the IL092 otoacoustic emission meter via a wire. The relevant parameters were set as / = 1.207. The threshold was set with the DPOAE intensity just greater than the local noise by 3 dB. When detecting the DPOAE input and output curves, the original tone intensity was attenuated from 80 dB SPL to below the threshold in 15 dB steps; the DPOAE thresholds at 5, 6, 7, and 8 kHz were recorded; the intensities of 2DPOAE elicited at 70 dB SPL and 60 dB SPL were recorded. When detecting the DPOAE latency, the original tone was 70 dB, and the DPOAE latencies at 5, 6, and 7 kHz were recorded. At the same time, the data was directly processed using the corresponding software. The body temperature of the experimental animals needed to be kept constant throughout the experimental process.
[0217] C. Electrocochleography (ECochG) is an electrophysiological detection technique (CP analysis) for recording the electrical activities of the cochlea and primary cochlear nerve fibers after acoustic stimulation
[0218] CP analysis includes the analysis of cochlear microphonics (CM) and compound action potential (CAP or AP, including three negative potentials N1, N2, and N3). Short sounds were given by a stimulator, and parameters such as latency, threshold intensity, and amplitude value of CM and AP were recorded, and the CM and AP graphs were drawn; the output intensity and delay of the stimulator were adjusted to observe the phase changes of cochlear microphonics and compound action potential.
[0219] 5.3 Morphological analysis of the cochlea of Strc gene knockout mice
[0220] A. Detection of the change in the number of hair cells in Strc knockout mice by immunostaining
[0221] Prepare cochlear basilar membrane spreads of Strc knockout mice at time points P14, P21, P30, P60, and P90 (i.e., 14 days old, 21 days old, 30 days old, 60 days old, and 90 days old after birth). Immunofluorescently stain the fine dissection of the basilar membrane of Strc knockout mice using the hair cell marker myo7a antibody (Proteus-bioscienes, catalog number: 25-6790) and STRC antibody (Signalway Antibody, catalog number: CB17). The number of inner ear hair cells in Strc gene knockout mice changes (relative to wild mice).
[0222] B. Study the morphological and structural changes of cilia in Strc knockout mice by SEM and TEM
[0223] Detect the morphological changes, number, structure, etc. of the cilia of inner ear hair cells and the changes of actin filaments in stereocilia in Strc gene knockout mice at different time points P3, P14, P30, P60, and P90 by scanning electron microscopy (SEM) and transmission electron microscopy (TEM).
[0224] Scanning electron microscopy (SEM) method: Fix the tissue overnight in 1 / 2 Karnovsky's fixative (2% PFA, 2.5% glutaraldehyde dissolved in 0.1 M sodium cacodylate buffer, pH 7.4), and fix it in 1% osmium tetroxide for 1 hour. All samples need to be dehydrated through a series of gradient ethanol and washed three times with hexamethyldisilazane, and then air-dried at room temperature. The tissue is adjusted to the optimal position and fixed on a carbon tape, and then the tape is placed on an aluminum base. Then, the prepared tissue sample is fully coated with a 10 nm gold and palladium mixed coating, and finally observed by FEI XL30 SEM, with a working voltage of 10 kV.
[0225] Example 6. Preparation of adeno-associated virus
[0226] In this example, a dual-vector system capable of highly efficiently expressing larger foreign genes and occupying less packaging capacity of AAV was constructed, and paired adeno-associated viruses for infecting mice were prepared.
[0227] 6.1 Preparation of a dual-vector system containing truncated WPRE
[0228] According to the results of Examples 3 and 4, the cleavage site was selected as Asn at position 656 of the STRC protein; and the cleavage site was Lys at position 722 of the STRC protein, and a dual-vector system containing truncated WPRE corresponding to numbers 52 and 53 in Table 3 was constructed, where Figure 2The WPRE+SV40 poly(A) (717bp) nucleotide sequence shown in SEQ ID NO:12 in the pAAV-CMV-EGFP-WPRE-SV40 plasmid backbone shown is replaced with the WPRE3-SV40 late poly(A) (432bp) nucleotide sequence shown in SEQ ID NO:15, and two groups of dual-vector systems 52 and 53 containing truncated WPRE are constructed.
[0229] 6.2 Preparation of dual AAV viruses
[0230] Four plasmids corresponding to the two groups of dual-vector systems 52 and 53 containing truncated WPRE are used to prepare four adeno-associated viruses (AAV) in HEK-293T cells and paired into two pairs of dual AAV viruses. The specific method is as follows. Virus packaging: Prepare 10 dishes of HEK-293T cells in 150mm dishes: the cell density is 80%-90% confluent. Prepare Tube A: 4880 μL of serum-free medium DMEM + 120 μL of PEI transfection reagent, and mix well. Prepare Tube B: 4958 μL of serum-free medium DMEM + 15 μL of pAnc80L65 plasmid (GenBank: KT235804.1, providing the capsid protein of Anc80L65) (Addgene plasmid #68837) + 15 μL of pHelper plasmid (GenBank: AF369965.1) + 12 μL of the first nucleic acid vector or the second nucleic acid vector in the dual-vector system constructed in Example 6.1, and mix well. Add the liquid in Tube A to Tube B, add dropwise and mix gently, and let stand at room temperature for 20-25 minutes. Add the mixture to the prepared HEK-293T cells, and add 1 ml of DNA-liposome complex (can be prepared in batches) to each dish. Change the medium after 12 h, collect the supernatant into a sterile bottle after 48 h, and store at 4°C. Continue to culture for 48 h with fresh medium added, and then collect the cells and supernatant into the aforementioned sterile bottle.
[0231] AAV Purification: After collecting the supernatant and cells, the cells were lysed using a cyclic hot and cold alternating method. The cells were alternately placed in ethanol pre-cooled with dry ice and a 37 °C water bath three times, and then centrifuged at 4 °C, 1167 g, for 15 min. Then, genomic and plasmid DNA were removed, and the supernatant was transferred to a 50 mL centrifuge tube. DNase and Rnase were added to a final concentration of 10 U / ml and 10 mg / mL, respectively, and incubated at 37 °C for 30 min. Centrifuge at 13490 rpm at 4 °C for 20 min. Filter the supernatant obtained from the previous centrifugation using a sterile 50 mL syringe and a 0.22 um filter membrane. Then prepare a gradient of iodixanol: 8 mL of 15% (v / v) iodixanol, 5.5 mL of 25% (v / v) iodixanol, 5 mL of 40% (v / v) iodixanol, and 4.5 mL of 60% (v / v) iodixanol. In this step, iodixanol is irritating to the eyes, skin, and respiratory tract. Personal protection should be taken and it should be carried out in a fume hood. Carefully drop the supernatant obtained above on the surface of 15% iodixanol for ultracentrifugation: Use a fixed-angle titanium rotor and centrifuge at 301580 g at 12 °C for 1 h 40 min. The maximum acceleration and deceleration are used during the centrifugation acceleration and deceleration processes. The purified AAV virus is located between the 40% and 60% iodixanol interfaces. Carefully insert and aspirate using a stainless steel blunt needle. Pair the obtained AAV viruses and name them double AAV virus 52 and double AAV virus 53, respectively.
[0232] AAV Titer Determination: The titer of AAV was determined using qPCR. The content is expressed in GC / ml, where GC is the genomic particle concentration. It is sufficient to verify that the titer of the purified virus is above 10e+12 GC / mL. The primers for qPCR were designed on the ITR sequence. The primer sequences are: forward ITR primer, 5'-GGAACCCCTAGTGATGGAGTT (SEQ ID NO:18); reverse ITR primer, 5'-CGGCCTCAGTGAGCGA (SEQ ID NO:19).
[0233] Titer Calculation Formula: Titer = 1000000 * power(10 x )
[0234] The calculation formula for x is: x = (38.71 - y) / 3.54
[0235] Where y is the CT value, that is, the threshold cycle (Ct) in qPCR. The CT value can be exported after qPCR. Substitute the CT value into x = (38.71 - y) / 3.54 to calculate the x value.
[0236] For example, if the CT value of the qPCR result is 13.925 = y, substituting it into the above formula, then x = (38.71 - 13.925) / 3.54 = 7. Thus, the virus titer value is = 1000000*power(10 7 ), that is, 1.00E+13.
[0237] Example 7. Recovery of deafness in Strc gene knockout mice by dual-vector AAV delivery of exogenous Strc gene
[0238] 7.1 Administration of AAV virus in mice
[0239] Newborn mice were anesthetized by the method of hypothermia-induced anesthesia. Strc gene knockout mice at P2 to P3 (i.e., 2 days old to 3 days old after birth) were placed in an ice bath for 2 - 3 min, taken out and the subsequent surgical procedures were carried out on an ice pad. The surgery was only performed on the left ear of each mouse, and the right ear was used as a negative control. During the surgery, the round window was exposed by an incision behind the left ear. Care was taken to avoid damaging the facial nerve during the surgery. Then, the dual AAV viruses 52 and 53 prepared in Example 6.2 were respectively injected into the cochlea through a capillary glass electrode (diameter 10 mm) from the round window using a microinjection system (Nanoliter2000, WPI). Since the cochlea of neonatal mice can accommodate 2 μL of AAV virus solution, the volume of the injected virus was selected to be 1 - 2 μL (N-terminal virus: C-terminal virus = 1:1 corresponding to each group of cleavage sites to obtain the dual AAV virus mixture Anc80L65-Tr). After the surgery, the wound was glued and painkillers and anti-inflammatory agents were applied, and the mice were placed on a 37 °C hot plate to wake up. The mice were sent back to their mother mice after fully recovering within about 10 minutes after the surgery. Standard postoperative care was adopted after the surgery.
[0240] Four weeks later, auditory brainstem response (ABR) and distortion product otoacoustic emission (DPOAE) were performed on the injected mice to evaluate the effect of the injection of the dual AAV virus mixture Anc80L65-Tr on the overall hearing of the mice.
[0241] 7.2 Analysis of the therapeutic effect of mice after injection of the dual AAV virus mixture
[0242] Detection of the expression of exogenous Strc gene:
[0243] The basilar membrane of the cochlea on the side of gene therapy was sectioned, and the stereocilia marker phalloidin conjugated with actin fluorescent dye was used; the Strc antibody was used as the primary antibody (rabbit-derived, obtained from Hua'an Biotech), and the secondary antibody was goat anti-rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, Invitrogen, A-11008 and Alexa Fluor Plus 555 phalloidin, Invitrogen, A30106 for immunofluorescence staining to study the expression of exogenous Strc gene in hair cells.
[0244] Detect the change in the number of cochlear hair cells:
[0245] Detect the change in the number of cochlear hair cells on the side of gene therapy by immunofluorescence staining. Use the hair cell marker Myo7a and Strc antibody for immunofluorescence staining, observe and count the change in the number of cochlear hair cells on the side of virus injection. The primary antibody is STRC antibody, rabbit-derived, obtained from Hua'an Biotech; Myo7a antibody, Proteus, catalog number: 256790; the secondary antibody is goat anti-rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488, Invitrogen, A-11008 and Alexa Fluor Plus 555 phalloidin, Invitrogen, A30106.
[0246] Detect the change in the morphology and structure of stereocilia in the cochlea:
[0247] Detect the change in the morphology and structure of stereocilia in the cochlea on the side of gene therapy by immunofluorescence staining and electron microscopy. Detect the changes in the morphology, number, structure, etc. of stereocilia of cochlear hair cells on the side of virus injection by immunofluorescence staining and scanning electron microscopy (SEM). Detect the change in actin filaments in stereocilia of the cochlea on the side of virus injection by transmission electron microscopy (TEM).
[0248] It can be seen from Figure 8 that in the treated Strc knockout mouse model, dual AAV virus 52 and dual AAV virus 53 reduced the ABR threshold, and the hearing in some frequency bands was significantly restored, approaching the hearing threshold of wild-type (WT) mice.
[0249] Figure 9 The immunofluorescence results of
[0250] The exemplary embodiments of the present invention have been described above. Those skilled in the art should understand that these disclosures are merely exemplary, and various other substitutions, adaptations, and modifications can be made within the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments listed herein.
[0251] Exemplary sequence
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
Claims
1. A dual-vector system for expressing STRC protein, which comprises a first nucleic acid vector and a second nucleic acid vector, wherein the first nucleic acid vector contains a first nucleotide sequence; and the second nucleic acid vector contains a second nucleotide sequence; the first nucleotide sequence contains an expression cassette inserted between two first ITR sequences; the second nucleotide sequence contains an expression cassette inserted between two second ITR sequences; the expression cassette of the first nucleotide sequence contains a promoter, an N-terminal coding sequence of STRC, an N-terminal coding sequence of an intein, and polyA; the expression cassette of the second nucleotide sequence contains a promoter, a C-terminal coding sequence of an intein, a C-terminal coding sequence of STRC, and polyA; and a STRC cleavage site is set in the STRC amino acid sequence. For example, the STRC amino acid sequence is as shown in SEQ ID NO:2 or a functional fragment thereof, for example, an amino acid sequence having at least 80% sequence identity with SEQ ID NO:2; the N-terminal coding sequence of STRC is a nucleotide coding sequence from the N-terminal of the STRC amino acid sequence to the STRC cleavage site; the C-terminal coding sequence of STRC is a nucleotide coding sequence from the amino acid after the STRC cleavage site to the C-terminal of the STRC amino acid sequence.
2. The dual-vector system for expressing STRC protein according to claim 1, wherein, The STRC cleavage site is located at the amino acid preceding serine, threonine or cysteine in the STRC amino acid sequence.
3. The dual-vector system for expressing STRC protein according to claim 1, wherein, The promoter of the expression cassette of the first nucleotide sequence or the second nucleotide sequence is selected from the CAG promoter, CMV promoter, CBA promoter, UbC promoter, SFFV promoter, EF1α promoter, PGK promoter, or the promoters of Myo7A, Myo15, Atoh1, POU4F3, Lhx3, Myo6, α9AchR, α10AchR, OTOF and STRC encoding genes; The polyA of the expression cassette of the first nucleotide sequence or the second nucleotide sequence comprises AATAAA (SEQ ID NO: 20) and variants of AATAAA; the variants of AATAAA comprise ATTAAA (SEQ ID NO: 21), AGTAAA (SEQ ID NO: 22), CATAAA (SEQ ID NO: 23), TATAAA (SEQ ID NO: 24), GATAAA (SEQ ID NO: 25), ACTAAA (SEQ ID NO: 26), AATATA (SEQ ID NO: 27), AAGAAA (SEQ ID NO: 28), AATAAT (SEQ ID NO: 29), AAAAAA (SEQ ID NO: 30), AATGAA (SEQ ID NO: 31), AATCAA (SEQ ID NO: 32), AACAAA (SEQ ID NO: 33), AATCAA (SEQ ID NO: 34), AATAAC (SEQ ID NO: 35), AATAGA (SEQ ID NO: 36), AATTAA (SEQ ID NO: 37) or AATAAG (SEQ ID NO: 38); for example, the polyA is a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with the polyA signal sequence shown in SEQ ID NO: 14 or SEQ ID NO: 17; and Each of the two first ITR sequences and the two second ITR sequences is derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9.
4. The dual-vector system for expressing STRC protein according to claim 1, wherein, The expression cassette of the first nucleotide sequence or the second nucleotide sequence further comprises an expression regulatory element and / or a tag element. For example, the expression regulatory element is the woodchuck hepatitis post-transcriptional regulatory element (WPRE) or a variant thereof, preferably a truncated variant of WPRE, for example, a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with the nucleotide sequence shown in SEQ ID NO: 13, for example, the nucleotide sequence shown in SEQ ID NO: 16; for example, the tag element is HA.
5. The dual-vector system for expressing STRC protein according to claim 1, wherein, The intein is derived from MxeGyrA, pabPolIII, MjaKlbA, SspDnaB, SceVMA, SspDnaE, NpuDnaE, AvaDnaE, CraDnaE, CspDnaE, CwaDnaE, MchtDnaE, OliDnaE, TerDnaE, gp41-1, gp41-8, IMPDH-1 or RmaDnaB. For example, the intein is derived from RmaDnaB. For example, the N-terminus of the intein is the N-terminus of the RmaDnaB intein shown in SEQ ID NO:5, and the C-terminus of the intein is the C-terminus of the RmaDnaB intein shown in SEQ ID NO:6; or, the intein is derived from NpuDnaE. For example, the N-terminus of the intein is the N-terminus of the NpuDnaE intein shown in SEQ ID NO:39, and the C-terminus of the intein is the C-terminus of the NpuDnaE intein shown in SEQ ID NO:
41.
6. The dual-vector system for expressing STRC protein according to claim 1, wherein, Insert the first nucleotide sequence into a plasmid containing two first ITR sequences, and insert the second nucleotide sequence into a plasmid containing two second ITR sequences. For example, the plasmid containing two first ITR sequences and the plasmid containing two second ITR sequences are the same or different. For example, the plasmid is a pAAV, pAAV-CMV, pX601, pX551 or pAAV-MCS plasmid.
7. The dual-vector system for expressing STRC protein according to any one of claims 1-6, wherein, The STRC cleavage site is shown in Table 1; preferably, the 656th amino acid of the STRC amino acid sequence shown in SEQ ID NO:2 is used as the STRC cleavage site, and the RmaDnaB intein is used; after ligating and fusing the N-terminal coding sequence of STRC with the N-terminal coding sequence of the RmaDnaB intein, a first nucleotide sequence is constructed, using the pAAV-CMV plasmid as a vector; After ligating and fusing the C-terminal coding sequence of the RmaDnaB intein with the C-terminal coding sequence of STRC, a second nucleotide sequence is constructed, using the pAAV-CMV plasmid as a vector; Use the 708th amino acid of the STRC amino acid sequence shown in SEQ ID NO:2 as the STRC cleavage site, and use the RmaDnaB intein; after ligating and fusing the N-terminal coding sequence of STRC with the N-terminal coding sequence of the RmaDnaB intein, a first nucleotide sequence is constructed, using the pAAV-CMV plasmid as a vector; After ligating and fusing the C-terminal coding sequence of the RmaDnaB intein with the C-terminal coding sequence of STRC, a second nucleotide sequence is constructed, using the pAAV-CMV plasmid as a vector; Use the 722nd amino acid of the STRC amino acid sequence shown in SEQ ID NO:2 as the STRC cleavage site, and use the RmaDnaB intein; after ligating and fusing the N-terminal coding sequence of STRC with the N-terminal coding sequence of the RmaDnaB intein, a first nucleotide sequence is constructed, using the pAAV-CMV plasmid as a vector; After ligating and fusing the C-terminal coding sequence of the RmaDnaB intein with the C-terminal coding sequence of STRC, a second nucleotide sequence is constructed, using the pAAV-CMV plasmid as a vector; or Using the 917th amino acid of the STRC amino acid sequence shown in SEQ ID NO: 2 as the STRC cleavage site and using the RmaDnaB intein; after ligating and fusing the N-terminal coding sequence of STRC with the N-terminal coding sequence of the RmaDnaB intein, a first nucleotide sequence is constructed, using the pAAV-CMV plasmid as a vector; After ligating and fusing the C-terminal coding sequence of the RmaDnaB intein with the C-terminal coding sequence of STRC, a second nucleotide sequence is constructed, using the pAAV-CMV plasmid as a vector; For example, the N-terminal coding sequence of the RmaDnaB intein encodes the N-terminal portion of RmaDnaB shown in SEQ ID NO: 5, and the C-terminal coding sequence of the RmaDnaB intein encodes the C-terminal portion of RmaDnaB shown in SEQ ID NO:
6.
8. The dual-vector system for expressing the STRC protein according to any one of claims 1-7, wherein the expression cassette of the first nucleotide sequence and the expression cassette of the second nucleotide sequence each comprise a signal sequence operably linked to a promoter sequence and under the control of the promoter; preferably, the signal sequence is the nucleotide sequence encoding SEQ ID NO:
3.
9. The dual-vector system for expressing the STRC protein according to any one of claims 1-8, wherein the expression cassette of the first nucleotide sequence and the expression cassette of the second nucleotide sequence each comprise a combination of a WPRE nucleotide sequence and an SV40 polyadenylation sequence at the N-terminus of the 3' ITR sequence, for example, having the nucleotide sequence shown in SEQ ID NO: 12 or a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 12; or comprising a combination of a WPRE3 nucleotide sequence and an SV40 late polyadenylation sequence, for example, having the nucleotide sequence shown in SEQ ID NO: 15 or a nucleotide sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:
15.
10. Packaging vector system for adeno-associated virus, wherein, The packaging vector system comprises the dual-vector system for expressing the STRC protein according to any one of claims 1-9, a vector carrying the AAV rep and cap genes, and a helper virus vector, and is packaged into an AAV vector, preferably, wherein the amino acid sequence of the STRC protein is as shown in SEQ ID NO:
2.
11. The packaging vector system of adeno-associated virus according to claim 10, wherein, The vector carrying the AAV rep and cap genes is selected from AAV1, AAV2, AAV5, AAV8, AAV9, Anc80, PHP.eB, AAV-DJ and AAVrh.10 vectors; the helper virus vector is the pHelper plasmid.
12. A method for packaging adeno-associated virus, wherein, The packaging vector system of adeno-associated virus according to claim 10 or 11 is transferred into a host cell for packaging.
13. The packaging method of adeno-associated virus according to claim 12, wherein, The host cell is selected from Hela-S3 cells, HEK-293 cells, HEK-293T cells, HEK-293FT cells, A549 cells and Sf9 cells.
14. An adeno-associated virus, which is obtained by the packaging method according to claim 12 or 13.
15. Use of the dual-vector system for expressing STRC protein according to any one of claims 1-9 or the adeno-associated virus according to claim 14, for the preparation of a drug or preparation for treating deafness, hearing impairment or hearing dysfunction.
16. A drug or preparation for treating deafness diseases, hearing impairments or hearing dysfunctions, which is prepared from the dual-vector system for expressing STRC protein according to any one of claims 1-9 or the adeno-associated virus according to claim 14, wherein, The adeno-associated virus is obtained by transferring the packaging vector system of adeno-associated virus into a host cell for packaging. The packaging vector system of adeno-associated virus includes a dual-vector system for expressing STRC protein, a vector carrying AAVrep and cap genes, and a helper virus vector.
17. The drug or preparation according to claim 16, wherein, The drug or preparation further comprises a neutral salt buffer, an acidic salt buffer, a basic salt buffer, glucose, mannose, mannitol, protein, polypeptide, amino acid, antibiotic, chelating agent, adjuvant, preservative, nanoparticle, liposome and positive lipid particle.
18. The drug or preparation according to claim 16 or 17, wherein, Administration by injection through the round window, oval window, semicircular canals, and common canal of the cochlea; and single or multiple administrations throughout life with a total dose of 1×10 9 -1×10 13 viral genomes.