Method for improving in-vivo and in-vitro antioxidant activity of pomegranate peel polyphenol extract through combined enzymolysis of tannase and beta-glucosidase
Through the combination of tannins and β-glucosidase and enzymatic pomegranate polyphenols, the problem of inability to absorb macromolecule ellagitannins is solved, the bioavailability and antioxidant activity of pomegranate polyphenols is improved, and the oxidative loss in oxidative stress mice is improved.
Patent Information
- Application Number
- CN202510636600.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-17
- Publication Date
- 2025-08-01
AI Technical Summary
In the prior art, the bioavailability and antioxidant activity of pomegranate polyphenol extracts are limited, especially the macromolecule ellagia tannins cannot be directly absorbed by the animal intestines, and require complex enzymatic decomposition, but the effect is average.
Tannins and β-glucosidase combined with enzymatic pomegranate polyphenols were used to hydrolyze macromolecule ellagicans into small-molecular substances such as ellagic acid and flavonoid aglycones to improve their biological activity.
The antioxidant activity of pomegranate polyphenol extract in vivo was significantly improved. After combined enzymatic lysis, the content of macromolecules ellagia tannins decreased, and the content of small molecules ellagia and gallic acid increased, improving the oxidation loss in oxidative stress mice.
Smart Images

Figure CN120392837A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of food science and biotechnology, and particularly relates to a method for improving the in vitro and in vivo antioxidant activities of pomegranate peel polyphenol extract by combined enzymatic hydrolysis with tannase and β-glucosidase. Background Art
[0002] Pomegranate peel is a by-product of pomegranate fruits and contains various bioactive substances such as polyphenols, flavonoids, polysaccharides, organic acids, fatty acids, and alkaloids, having antioxidant, anti-inflammatory, antimutagenic, and antibacterial activities. The in vitro antioxidant activity of pomegranate peel extract ranks first among natural plants, and the antioxidant activity is closely related to the polyphenol content, which can inhibit the generation of free radicals during metabolic activities. Therefore, pomegranate peel polyphenol extract is a natural antioxidant and can also be added to foods as a functional food ingredient to replace preservatives.
[0003] The pomegranate peel polyphenol extract contains a large amount of bound polyphenols and macromolecular ellagitannins, which limits the exertion of antioxidant activity. Macromolecular ellagitannins cannot be directly absorbed by the animal intestine and must be hydrolyzed into small molecules before being absorbed into the blood to play a physiological role. Therefore, the bioavailability and antioxidant activity of pomegranate peel polyphenol extract need to be further enhanced through an enzymatic hydrolysis process. Chinese Patent CN 106860490 A discloses a preparation process of pomegranate peel polyphenols with anti-fatigue activity. In this patent, pomegranate peel is first hydrolyzed with a complex enzyme to break the pomegranate peel cells and allow the effective ingredient polyphenols to flow out; the specially prepared complex enzyme preparation is configured according to the component structure of pomegranate peel, with a fast hydrolysis speed, thorough enzymatic hydrolysis, and no damage to the activity of pomegranate peel polyphenols; then supercritical CO2 extraction is used to extract polyphenols; finally, purification is carried out by utilizing the adsorption characteristics of different macroporous adsorption resins. The composition of the complex enzyme hydrolyzing agent in this patent is relatively complex, and the enzymatic hydrolysis effect is average. Summary of the Invention
[0004] The purpose of the present invention is to solve at least one of the technical problems existing in the prior art, and provide a method for extracting pomegranate peel polyphenols by combined enzymatic hydrolysis with tannase and β-glucosidase and improving their in vitro and in vivo antioxidant activities. Tannase can hydrolyze macromolecular ellagitannins such as punicalagin into small molecule substances such as ellagic acid, and β-glucosidase can hydrolyze flavonoid glycosides into flavonoid aglycones. Free flavonoid aglycones have higher biological activities. The present invention aims to improve the in vitro antioxidant activity of pomegranate peel polyphenols through the technical conditions of enzymatic hydrolysis and verify its effect in an animal model.
[0005] The technical solution of the present invention is as follows: The first aspect of the present invention provides a method for extracting pomegranate peel polyphenols by combined enzymatic hydrolysis with tannase and β-glucosidase, comprising the following steps: S1. Crush pomegranate peel to obtain pomegranate peel powder; add the pomegranate peel powder to water, and perform heating extraction to obtain pomegranate peel polyphenol extract; S2. Add the pomegranate peel polyphenol extract to a solvent, add tannase and β-glucosidase to perform combined enzymatic hydrolysis on the pomegranate peel polyphenol extract to obtain an enzymatic hydrolysis product of pomegranate peel polyphenol extract.
[0006] Optionally, in S1, the solid-liquid ratio of pomegranate peel powder to water is 1:20 - 1:60 g / mL, the temperature of heating extraction is 40 - 80°C, the heating extraction time is 0.5 - 6 h, and the number of heating extraction times is 1 - 2 times.
[0007] Optionally, in S1, the solid-liquid ratio of pomegranate peel powder to water is 1:60 g / mL, the temperature of heating extraction is 80°C, the heating extraction time is 0.5 h, and the number of heating extraction times is 1 time.
[0008] Optionally, in S2, the solvent is a mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate with a concentration of 0.05 - 0.15 mol / L, pH 4.5 - 5.5, the enzyme activity of tannase is 250 - 500 U / g, the enzyme activity of glucosidase is 150 - 250 U / g, the concentration of tannase is 3 - 27 μg / mg, the concentration of β-glucosidase is 5 - 45 μg / mg, the time of combined enzymatic hydrolysis is 0.5 - 4 h, and the temperature of combined enzymatic hydrolysis is 35 - 45°C.
[0009] Optionally, in S2, the solvent is a mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate with a concentration of 0.1 mol / L, pH 5.0, the enzyme activity of tannase is 300 U / g, the enzyme activity of glucosidase is 200 U / g, the concentration of tannase is 15 μg / mg, the concentration of β-glucosidase is 35 μg / mg, the time of combined enzymatic hydrolysis is 4 h, and the temperature of combined enzymatic hydrolysis is 35°C.
[0010] The second aspect of the present invention provides an enzymatic hydrolysis product of pomegranate peel polyphenol extract, which is prepared by the above method.
[0011] The third aspect of the present invention provides a method for improving the in vitro and in vivo antioxidant activities of pomegranate peel polyphenol extract, including the following steps: (1) Crush pomegranate peel to obtain pomegranate peel powder; add the pomegranate peel powder to water, set the extraction temperature at 40 - 80°C, the solid-liquid ratio at 1:20 - 1:60 g / mL, the extraction time at 0.5 - 6 h, the number of extraction times at 1 - 2 times, centrifuge after extraction, collect the supernatant to obtain pomegranate peel polyphenol extract; measure the polyphenol content in the pomegranate peel polyphenol extract, and determine the optimal extraction conditions based on the polyphenol content in the pomegranate peel polyphenol extract; (2) Add the pomegranate peel polyphenol extract obtained under the optimal extraction conditions into a solvent, and separately enzymatically hydrolyze the pomegranate peel polyphenol extract with tannase and β-glucosidase, and perform combined enzymatic hydrolysis on the pomegranate peel polyphenol extract with tannase and β-glucosidase to obtain tannase enzymatic hydrolysis products, β-glucosidase enzymatic hydrolysis products, and combined enzymatic hydrolysis products respectively. Measure the in vitro antioxidant activities and changes in the substance components of each enzymatic hydrolysis product; Among them, the conditions for separate enzymatic hydrolysis by tannase include: the solvent is a 0.1 mol / L mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate, pH 5, the enzyme activity of tannase is 300 U / g, the concentration of tannase is 0 - 27 μg / mg polyphenol, the enzymatic hydrolysis time is 0 - 240 min, and the enzymatic hydrolysis temperature is 35°C; The conditions for separate enzymatic hydrolysis by β-glucosidase include: the solvent is a 0.1 mol / L mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate, pH 5, the enzyme activity of β-glucosidase is 200 U / g, the concentration of β-glucosidase is 35 μg / mg, the enzymatic hydrolysis time is 0 - 240 min, and the enzymatic hydrolysis temperature is 45°C; The conditions for combined enzymatic hydrolysis include: the solvent is a 0.1 mol / L mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate, pH 5, the enzyme activity of tannase is 300 U / g, the enzyme activity of glucosidase is 200 U / g, the concentration of tannase is 15 μg / mg, the concentration of β-glucosidase is 35 μg / mg, the enzymatic hydrolysis time is 0 - 240 min, and the temperature of combined enzymatic hydrolysis is 35°C; (3) Act on oxidative stress mice with the pomegranate peel polyphenol extract obtained in step (1) and the tannase enzymatic hydrolysis products, β-glucosidase enzymatic hydrolysis products, and combined enzymatic hydrolysis products in step (2) respectively, and measure the changes in antioxidant activities of the four substances in the mice respectively; (4) Compare the in vitro antioxidant activities, changes in substance components, and changes in in vivo antioxidant activities of the tannase enzymatic hydrolysis products, β-glucosidase enzymatic hydrolysis products, and combined enzymatic hydrolysis products. Determine the optimal enzymatic hydrolysis conditions with the enzymatic hydrolysis product with the largest change, and treat pomegranate peel with the optimal enzymatic hydrolysis conditions to obtain pomegranate peel polyphenols with high antioxidant activities in vivo and in vitro.
[0012] Optionally, in step (1), the optimal extraction conditions include: extraction temperature 80°C, solid-liquid ratio 1:60 g / mL, extraction time 0.5 h, extraction times 1 time, and the polyphenol content is measured by the Folin-Ciocalteu method.
[0013] Optionally, in step (2), the in vitro antioxidant activity is measured by the DPPH radical scavenging ability and the ABTS radical scavenging ability, and the changes in the relative contents of polyphenol components in the samples before and after enzymatic hydrolysis are measured by UPLC-ESI-QTOF-MS; The scavenging rates of DPPH and ABTS free radicals reflect the enzymatic hydrolysis effect. The components of the three polyphenols were identified by UPLC-ESI-QTOF-MS, and the changes in the components and relative contents of the polyphenol extracts before and after enzymatic hydrolysis were further analyzed.
[0014] In step (3), the changes in in vivo antioxidant activity were reflected by measuring the body weight changes, organ indices, serum and liver antioxidant indices, and the expression of antioxidant-related genes and proteins in mice.
[0015] The three enzymatically hydrolyzed products were applied to an oxidative stress animal model, and the polyphenol extract without enzymatic treatment was used as a control to verify the in vivo antioxidant effect of the enzymatically hydrolyzed polyphenol extract. The in vivo antioxidant effect was reflected by measuring the serum and liver antioxidant indices and the expression of antioxidant-related genes and proteins in the liver.
[0016] Optionally, in step (4), the optimal enzymatic hydrolysis conditions include: the solvent is a mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate at 0.1 mol / L, pH 5, the enzyme activity of tannase is 300 U / g, the enzyme activity of glucosidase is 200 U / g, the concentration of tannase is 15 μg / mg, the concentration of β-glucosidase is 35 μg / mg, the time of combined enzymatic hydrolysis is 4 h, and the temperature of combined enzymatic hydrolysis is 35°C.
[0017] The present invention has at least one of the following beneficial effects: The treatment method of the present invention can enhance the in vivo and in vitro antioxidant activities. The effect of combined treatment of polyphenol extract with tannase and β-glucosidase is better than that of single enzyme treatment of polyphenol extract. This method is simple and efficient, can significantly improve the bioavailability and antioxidant activity of pomegranate peel polyphenol extract, and the combined enzymatic hydrolysis of polyphenols has an obvious improvement effect on the oxidative damage of oxidative stress mice, indicating that polyphenols have good antioxidant and anti-inflammatory activities and have broad application prospects.
[0018] The present invention combines tannase and β-glucosidase to enzymatically hydrolyze the pomegranate peel polyphenol extract. After enzymatic hydrolysis, the content of the macromolecular ellagitannin punicalagin decreases significantly, and the contents of ellagic acid and gallic acid increase. Moreover, the degradation rate of punicalagin and the production rates of ellagic acid and gallic acid after combined enzymatic hydrolysis are significantly higher than those of single enzymatic hydrolysis, indicating that combined enzymatic hydrolysis greatly improves the antioxidant activity of polyphenols. Description of the Drawings
[0019] Figure 1 It is the extraction result of the pomegranate peel polyphenol extract provided in Example 1 of the present invention.
[0020] Figure 2 It is the result of the change in the in vitro antioxidant activity of the enzymatically hydrolyzed polyphenol extract provided in Example 2 of the present invention.
[0021] Figure 3 It is the flow chart of the animal experiment provided in Example 4 of the present invention.
[0022] Figure 4 It is the change of body weight and organ index of oxidative stress mice provided in Example 4 of the present invention.
[0023] Figure 5 It is the HE staining section diagram of the liver of oxidative stress mice provided in Example 4 of the present invention.
[0024] Figure 6 It is the change of antioxidant-related indexes in the serum of oxidative stress mice provided in Example 4 of the present invention.
[0025] Figure 7 It is the change of antioxidant-related indexes in the liver of oxidative stress mice provided in Example 4 of the present invention.
[0026] Figure 8 It is the expression of antioxidant-related genes in the liver of oxidative stress mice provided in Example 4 of the present invention.
[0027] Figures 9 - 12 It is the expression of antioxidant-related proteins in the liver of oxidative stress mice provided in Example 4 of the present invention. Detailed implementation manners
[0028] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0029] Example 1 This example provides a method for extracting pomegranate peel polyphenol extract, and the specific steps are as follows: 1. Dry the pomegranate peel dry shell at 50 °C, crush it with a high-speed universal grinder and sieve it with a 60-mesh sieve to obtain powder, which is sealed for later use.
[0030] 2. Extract the polyphenol extract from the pomegranate peel powder with distilled water. The specific conditions are as follows: accurately weigh 1 g of pomegranate peel powder into a 100 mL centrifuge tube, add distilled water, set the temperature at 40 - 80 °C, the solid-liquid ratio at 1:20 - 1:60 g / mL, the extraction time at 0.5 - 6 h, the extraction times at 1 - 2 times. After extraction, centrifuge at 8000 rpm for 10 min, collect the supernatant, measure the polyphenol content, and freeze-dry to obtain polyphenol powder.
[0031] 3. The polyphenol content was determined by the Folin-Ciocalteu method. 40 μL of the sample was diluted with water to 2.4 mL, 200 μL of Folin-Ciocalteu reagent was added, 600 μL of 20% sodium carbonate was added within 1 - 8 min, and the volume was adjusted to 4 mL with 800 μL of water. After reacting in the dark at room temperature (22 ± 2 °C) for 2 h, the absorbance was measured at 760 nm. A standard curve was plotted using gallic acid (0 - 1600 μg / mL) as the standard. The polyphenol content was expressed as mg GAE (GAE means Gallic acid Equivalent) / g of the sample.
[0032] To determine the optimal extraction temperature, solid-liquid ratio, extraction time, and extraction times, single-factor comparative experiments were carried out as follows: (1)Optimal extraction temperature The specific conditions of Step 2 were as follows: 1 g of pomegranate peel powder was accurately weighed into a 100 mL centrifuge tube, distilled water was added, the temperatures were set at 40, 50, 60, 70, and 80 °C respectively, the solid-liquid ratio was 1:60 g / mL, the extraction time was 0.5 h, the extraction times were 1 time, after extraction, it was centrifuged at 8000 rpm for 10 min, the supernatant was collected, the polyphenol content was determined, and the polyphenol extract powder was obtained by freeze-drying. Other steps were the same as above.
[0033] The results are shown in Figure 1 A, as can be seen from Figure 1 A, when the extraction temperature was 80 °C, the polyphenol content was the highest. Therefore, the optimal extraction temperature was 80 °C.
[0034] (2)Optimal extraction solid-liquid ratio The specific conditions of Step 2 were as follows: 1 g of pomegranate peel powder was accurately weighed into a 100 mL centrifuge tube, distilled water was added, the temperature was set at 80 °C, the solid-liquid ratios were 1:20, 1:30, 1:40, 1:50, and 1:60 g / mL respectively, the extraction time was 0.5 h, the extraction times were 1 time, after extraction, it was centrifuged at 8000 rpm for 10 min, the supernatant was collected, the polyphenol content was determined, and the polyphenol extract powder was obtained by freeze-drying. Other steps were the same as above.
[0035] The results are shown in Figure 1 B, as can be seen from Figure 1 B, when the solid-liquid ratio was 1:60 g / mL, the polyphenol content was the highest. Therefore, the optimal extraction solid-liquid ratio was 1:60 g / mL.
[0036] (3)Optimal extraction time The specific conditions for Step 2 are as follows: Accurately weigh 1 g of pomegranate peel powder into a 100 mL centrifuge tube, add distilled water, set the temperature at 80 °C, the solid-liquid ratio at 1:60 g / mL, the extraction times at 0.5 h, 1 h, 2 h, 4 h, and 6 h respectively, the extraction times at 1 time, centrifuge at 8000 rpm for 10 min after extraction, collect the supernatant, measure the polyphenol content, and freeze-dry to obtain polyphenol extract powder. Other steps are the same as above.
[0037] The results are shown in Figure 1 C. It can be seen from Figure 1 C that the extraction time has little effect on the polyphenol content, and the polyphenol contents obtained at each extraction time are close. Among them, when the extraction time is 0.5 h, the polyphenol content is the highest. Therefore, the optimal extraction time is 0.5 h.
[0038] (4) Optimal extraction times The specific conditions for Step 2 are as follows: Accurately weigh 1 g of pomegranate peel powder into a 100 mL centrifuge tube, add distilled water, set the temperature at 80 °C, the solid-liquid ratio at 1:60 g / mL, the extraction times at 0.5 h, 1 h, 2 h, 4 h, and 6 h respectively, the extraction times at 2 times, centrifuge at 8000 rpm for 10 min after extraction, collect the supernatant, measure the polyphenol content, and freeze-dry to obtain polyphenol extract powder. Other steps are the same as above.
[0039] The results are shown in Figure 1 D. Compared with Figure 1 C, it can be seen that the extraction times have little effect on the polyphenol content, and the polyphenol contents obtained by extracting 1 time and 2 times are close. In order to save time and cost, therefore, the optimal extraction times is 1 time.
[0040] Example 2 This example provides an enzymatic hydrolysis method for pomegranate peel polyphenol extract. Specifically, it is to perform enzymatic hydrolysis on the polyphenol extract powder obtained by the solvent distilled water extraction method. Among them, the method for obtaining the polyphenol extract powder by the solvent distilled water extraction method is as follows: 1. Dry the dried pomegranate peel shell at 50 °C, crush it with a high-speed universal pulverizer and sieve it with a 60-mesh sieve, and seal the obtained powder for later use. 2. Extract the polyphenol extract from the pomegranate peel powder with distilled water. The specific conditions are to accurately weigh 1 g of pomegranate peel powder into a 100 mL centrifuge tube, add distilled water, set the temperature at 80 °C, the solid-liquid ratio at 1:60 g / mL, the extraction time at 0.5 h, the extraction times at 1 time, centrifuge at 8000 rpm for 10 min after extraction, collect the supernatant, and freeze-dry to obtain polyphenol extract powder.
[0041] Perform enzymatic hydrolysis on the above polyphenol extract powder according to the following method. The specific steps are as follows: 1. Determine the optimal conditions for tannase to enzymatically hydrolyze the polyphenol extract The polyphenol extract was enzymatically hydrolyzed with tannase alone, and the specific steps were as follows: The above-mentioned polyphenol extract powder was added to a solvent, and tannase was added for enzymatic hydrolysis alone to obtain an enzymatic hydrolysis product. Among them, the enzyme activity of tannase was 300 U / g, the final concentration of polyphenols was 4 g / L, the tannase concentration was 0, 3, 9, 15, 21, 27 μg / mg polyphenols, the enzymatic hydrolysis time was 0, 30, 60, 120, 180, 240 min, the enzymatic hydrolysis temperature was 35 °C, the solvent was 0.1 mol / L disodium hydrogen phosphate - sodium dihydrogen phosphate (16 mL:84 mL), and the pH was 5.
[0042] The in vitro antioxidant activity of the enzymatic hydrolysis product was measured, and the measurement method was as follows: (1) Determination of DPPH radical scavenging ability: Prepare a 0.65 mM DPPH methanol solution with an absorbance adjusted to 0.70 ± 0.02. Pipette 100 μL of the DPPH methanol solution and mix it with 100 μL of the sample or blank solution in a 96-well plate. React at room temperature for 30 min under dark conditions. Measure its absorbance at 517 nm using a microplate reader. Using Trolox (10 - 30 μg / mL) as the standard, the antioxidant activity of the sample is expressed as the milligrams of Trolox required to achieve the same elimination rate (mg TE / mg polyphenol extract). The formula for calculating the DPPH radical scavenging ability: Scavenging rate % = [1 - (Ai - Aj) / Ac] × 100%, where: Ai is the absorbance of the sample plus DPPH reagent, Aj is the absorbance of the sample plus methanol, and Ac is the absorbance of the DPPH solution plus methanol.
[0043] (2) Determination of ABTS radical scavenging ability: Mix 5 mL of ABTS stock solution (7.0 mmol / L) with 88 μL of K2S2O8 (140 mmol / L), and let it stand for 12 - 16 hours to prepare an ABTS working solution. The ABTS working solution was diluted with 80% methanol to make the absorbance of the mixed solution at 734 nm be 0.70 ± 0.02. Then, add 200 μL of the ABTS solution and 20 μL of the sample solution to a 96-well plate, shake and mix evenly, and react for 6 min under dark conditions. Measure the absorbance at a wavelength of 734 nm. The antioxidant activity of the sample is expressed as the milligrams of Trolox required to achieve the same scavenging rate (mg TE / mg polyphenol extract). The formula for calculating the ABTS radical scavenging rate is as follows: Scavenging rate % = [1 - (Ai - Aj) / A0] × 100%, where: Ai is the absorbance of the ABTS and sample mixture, Aj is the absorbance of 80% methanol and the sample, and A0 is the absorbance of the ABTS solution and 80% methanol mixture.
[0044] The in vitro antioxidant activity of the product obtained by enzymatically hydrolyzing the polyphenol extract with tannase alone is as Figure 2 shown in A and 2B, asFigure 2 As can be seen from Figure 1A and 2B, the optimal conditions for the enzymatic hydrolysis of polyphenol extracts by tannase alone are as follows: the enzyme concentration is 15 μg / mg, the hydrolysis time is 4 h, and the hydrolysis temperature is 35°C.
[0045] 2. Determine the optimal conditions for the enzymatic hydrolysis of polyphenol extracts by β-glucosidase The polyphenol extracts were enzymatically hydrolyzed with β-glucosidase alone, and the specific steps were as follows: the above-mentioned polyphenol extract powder was added to a solvent, and β-glucosidase was added for enzymatic hydrolysis alone. Among them, the enzyme activity of β-glucosidase was 200 U / g, the final concentration of polyphenols was 4 g / L, the concentration of β-glucosidase was 0, 5, 15, 25, 35, 45 μg / mg polyphenols, the hydrolysis time was 0, 30, 60, 120, 180, 240 min, the hydrolysis temperature was 45°C, the solvent was 0.1 mol / L disodium hydrogen phosphate-sodium dihydrogen phosphate (16 mL:84 mL), and the pH was 5.
[0046] The in vitro antioxidant activity of the enzymatic hydrolysis products was determined according to the above method.
[0047] The in vitro antioxidant activity of the products obtained by the enzymatic hydrolysis of polyphenol extracts with β-glucosidase alone is shown in Figure 2 Figures 1C and 2D. As can be seen from Figure 2 Figures 1C and 2D, the optimal conditions for the enzymatic hydrolysis of polyphenol extracts by β-glucosidase alone are as follows: the enzyme concentration is 35 μg / mg, the treatment time is 4 h, and the treatment temperature is 45°C.
[0048] 3. Comparison between single enzymatic hydrolysis and combined enzymatic hydrolysis Control group 1: The polyphenol extracts were enzymatically hydrolyzed with tannase alone. The conditions for the enzymatic hydrolysis of polyphenol extracts with tannase alone were as follows: the enzyme activity of tannase was 300 U / g, the enzyme concentration was 15 μg / mg, the hydrolysis times were 0, 30, 60, 120, 180, 240 min, the hydrolysis temperature was 35°C, the solvent was 0.1 mol / L disodium hydrogen phosphate-sodium dihydrogen phosphate, and the pH was 5.
[0049] Control group 2: The polyphenol extracts were enzymatically hydrolyzed with β-glucosidase alone. The conditions for the enzymatic hydrolysis of polyphenol extracts with β-glucosidase alone were as follows: the enzyme activity of β-glucosidase was 200 U / g, the enzyme concentration was 35 μg / mg, the hydrolysis times were 0, 30, 60, 120, 180, 240 min, the hydrolysis temperature was 45°C, the solvent was 0.1 mol / L disodium hydrogen phosphate-sodium dihydrogen phosphate, and the pH was 5.
[0050] Experimental group: polyphenol extract enzymatically hydrolyzed by tannase and β-glucosidase. The specific steps are as follows: Add the above-mentioned polyphenol powder into a solvent to prepare a polyphenol extract solution, and add tannase and β-glucosidase for combined enzymatic hydrolysis. Among them, the final concentration of the polyphenol extract is 4 g / L, the tannase concentration is 15 μg / mg polyphenol, the β-glucosidase concentration is 35 μg / mg polyphenol, the enzymatic hydrolysis time is 0, 30, 60, 120, 180, 240 min, the enzymatic hydrolysis temperature is 35 °C, the solvent is 0.1 mol / L disodium hydrogen phosphate-sodium dihydrogen phosphate (16 mL:84 mL), and the pH is 5.
[0051] Control group: polyphenol extract without enzyme treatment. Among them, the final concentration of the polyphenol extract is 4 g / L, the treatment time is 0, 30, 60, 120, 180, 240 min, the temperature is 35 °C, the solvent is 0.1 mol / L disodium hydrogen phosphate-sodium dihydrogen phosphate (14 mL:84 mL), and the pH is 5.
[0052] Determine the in vitro antioxidant activity of the enzymatic hydrolysis products of each group according to the above method.
[0053] The in vitro antioxidant activity of the enzymatic hydrolysis products of each group is as Figure 2 shown in Figures E and 2F. Generally speaking, when the enzymatic hydrolysis time is 240 min, the in vitro antioxidant activity of the enzymatic hydrolysis products obtained by the experimental group is the highest. This shows that compared with single enzymatic hydrolysis, the combined enzymatic hydrolysis of polyphenol extract with tannase and β-glucosidase can improve the in vitro antioxidant activity of the enzymatic hydrolysis products.
[0054] Example 3 Identification method of components of enzymatically hydrolyzed polyphenol products Identify the components of the enzymatic hydrolysis products obtained during the enzymatic hydrolysis of the polyphenol extract by tannase, β-glucosidase, and combined enzymatic hydrolysis in Example 2. The identification method is as follows: Filter the enzymatic hydrolysis product sample with a 0.22 μm filter membrane, and use UPLC-ESI-QTOF-MS to detect the product composition in the filtrate.
[0055] Chromatographic conditions: The mobile phase is 0.1% formic acid aqueous solution (A) and acetonitrile (B). The gradient elution program is: 0 - 8 min, 90% A; 8 - 40 min, 75% A; 40 - 50 min, 10% A; stop after running for 4 min. The flow rate is 0.3 mL / min, the column temperature is 35 °C, and the injection volume is 2 μL.
[0056] Mass spectrometry conditions: The ion source is an ESI negative ion source; the scanning mass number range is m / z 100 - 3200; the drying gas temperature is 320 °C; the drying gas flow rate is 8 L / min; the sheath gas temperature is 350 °C; the sheath gas flow rate is 12 L / min; the nebulizer pressure is 40 psi; the capillary voltage for negative ions is 3500 V; the declustering voltage is 380 V; the collision energies are 20, 40, 60 V; the acquisition mode is Full scan AutoMS / MS.
[0057] The identification results are shown in Tables 1 - 3. Among them, Table 1 corresponds to the tannase-hydrolyzed polyphenol extract group, Table 2 corresponds to the β-glucosidase-hydrolyzed polyphenol extract group, and Table 3 corresponds to the combined enzyme-hydrolyzed polyphenol extract group. From the changes in the peak areas in the tables, the changes in the relative contents of substances can be seen. As can be seen from Tables 1 - 3, the contents of macromolecular polyphenols such as punicalagin and punicalin in the enzymatic hydrolysis products of the combined enzyme-hydrolyzed polyphenol extract group are significantly lower than those in other groups, and the contents of small-molecule ellagic acid, gallic acid, etc. are significantly increased, indicating that the combined enzymatic hydrolysis has the best effect.
[0058] Table 1 Note: In Tables 1 - 3, punicaloside a and punicalagin are isomers, and pedunculagin a and pedunculagin b are isomers.
[0059] Table 2 Table 3 Example 4 Application of Enzymatically Hydrolyzed Polyphenol Extract in Oxidative Stress Mice The enzymatic hydrolysis products obtained by enzymatically hydrolyzing for 240 min in the experimental group, control group 1, and control group 2 in Example 2 were used for the oxidative stress mouse experiment. The animal experiment flow chart is as Figure 3 shown, and the specific scheme is as follows: 1. Animal model design: Using 60 8-week-old male ICR mice as experimental subjects, after 7 days of adaptive feeding, they were randomly divided into 6 groups according to body weight, with 10 mice in each group.
[0060] 2. The grouping is as follows: Blank control group (BC): Gavage with distilled water and intraperitoneal injection of 0.9% saline; Oxidative stress group (OS): Gavage with distilled water and intraperitoneal injection of D-galactose (150 mg / kg); Polyphenol extract group (PP): gavaged with the pomegranate peel polyphenol extract extracted with distilled water in Example 1 (50 mg / kg), intraperitoneally injected with D-galactose (150 mg / kg); Tannase enzymatically hydrolyzed polyphenol extract group (TE): gavaged with the polyphenol extract obtained in Control Group 1 (enzymatically hydrolyzed with tannase alone) (50 mg / kg), intraperitoneally injected with D-galactose (150 mg / kg); Glycosidase enzymatically hydrolyzed polyphenol extract group (GE): gavaged with the polyphenol extract obtained in Control Group 2 (enzymatically hydrolyzed with β-glucosidase alone) (50 mg / kg), intraperitoneally injected with D-galactose (150 mg / kg); Combined enzymatic hydrolysis polyphenol group (ME): gavaged with the polyphenol extract obtained in the experimental group (enzymatically hydrolyzed with tannase and β-glucosidase) (50 mg / kg), intraperitoneally injected with D-galactose (150 mg / kg).
[0061] 3. After the experiment, all mice were fasted but given water for 12 h, blood was collected from the eye socket, and after standing for 2 h after blood collection from the eye socket, centrifuged at 3000 rpm for 10 min at 4°C, the serum was aspirated and aliquoted, and stored at -80°C for further testing. Tissues such as the liver, heart, and spleen were taken and stored at -80°C for standby, and part of the liver was stored in 4% paraformaldehyde for standby to observe the liver morphology.
[0062] 4. The liver stored in 4% paraformaldehyde was sent for testing of HE staining sections and immunohistochemistry of Nrf2, HO-1, and NQO1 proteins.
[0063] 5. According to the kit instructions, the levels of antioxidant indexes in the serum and liver of mice were detected.
[0064] 6. The expression of antioxidant-related genes in the liver was determined. RNA was extracted according to the steps of the RNA extraction kit and reverse transcribed into cDNA, and real-time fluorescence quantitative PCR was performed according to the Takara kit instructions.
[0065] Gene Nrf2: forward primer (5’→3’) CAGCCATGACTGATTTAAGCAG, reverse primer (5’→3’) CAGCTGCTTGTTTTCGGTATTA; Gene HO-1: forward primer (5’→3’) TCCTTGTACCATATCTACACGG, reverse primer (5’→3’) GAGACGCTTTACATAGTGCTGT; Gene NQO1: forward primer (5’→3’) GAAGACATCATTCAACTACGCC, reverse primer (5’→3’) GAGATGACTCGGAAGGATACTG; Gene Sod1: Forward primer (5’→3’) GGGTTCCACGTCCATCAGTAT, reverse primer (5’→3’) CTTTCCAGCAGTCACATTGC; Gene Sod2: Forward primer (5’→3’) CCAGGAGCAAAACCAAGAAC, reverse primer (5’→3’) TGCAACTGGTTTCTGTTGGT; Gene GCLC: Forward primer (5’→3’) GATTAGGCTGCCCTGGGTTCA, reverse primer (5’→3’) GGCTTGGAACGTTACCTGGG; Gene GCLM: Forward primer (5’→3’) TAAATCCCGATGAAAGAG, reverse primer (5’→3’) AACAGGAGGTGAAGCAAT; Gene β-actin: Forward primer (5’→3’) ACGGCCAGGTCATCACTATTG, reverse primer (5’→3’) TGGATGCCACAGGATTCCA; 7. According to the immunohistochemical results, the proportion of positive area was statistically analyzed using ImageJ software.
[0066] The changes in body weight and organ indices of oxidative stress mice were as Figure 4 shown. Among them, Figure A shows the changes in body weight of mice in each group, Figure B shows the changes in heart index (mg heart / g body weight), Figure C shows the changes in liver index (mg liver / g body weight), and Figure D shows the changes in spleen index (mg spleen / g body weight). It Figure 4 can be shown that during the feeding period, the body weight of mice did not increase significantly, and there were no significant differences among groups. The organ indices of the OS group were slightly lower than those of the BC group. After treatment with polyphenol extract, the organ indices increased slightly. Moreover, the organ indices of the ME group were higher than those of the PP, TE, and GE groups, but the overall changes were not large and there were no significant differences, indicating that D-galactose caused less damage to mice.
[0067] The HE staining section of the liver of oxidative stress mice was as Figure 5 shown. It Figure 5 can be shown that the hepatocytes in the BC group were arranged orderly around the central vein and there was no inflammation. In contrast, the hepatocytes in the OS group were disorderly arranged, with irregular cell morphology and damaged cell barriers, and a large number of inflammatory infiltrations were also observed. After treatment with polyphenol extract, the cell disorder in the liver sections was alleviated to varying degrees. Among them, the hepatocytes in the ME treatment group were relatively intact and the inflammation improved better. It can be intuitively seen from the HE staining diagram the protective effect of polyphenol extract on oxidative damage in mice, and the ME group can better prevent liver damage induced by D-galactose in mice.
[0068] The changes in antioxidant-related indicators in the serum of oxidative stress mice are as follows Figure 6 shown. Among them, Figure A is the activity of superoxide dismutase (SOD), Figure B is the activity of catalase (CAT), and Figure C is the content of malondialdehyde (MDA). It can be Figure 6 illustrated that the action of D-galactose on organisms can cause damage to the body, leading to a decrease in the activity of antioxidant enzymes and an increase in the content of malondialdehyde in the body. After treatment with polyphenol extract, the activity of antioxidant enzymes increases and the content of malondialdehyde decreases, indicating that polyphenol extract can relieve D-galactose-induced oxidative damage. Moreover, the combined enzymolysis polyphenol extract shows a stronger effect, which can significantly increase the levels of SOD and CAT in the serum ( p <0.05), and can significantly inhibit the content of MDA ( p <0.05).
[0069] The changes in antioxidant-related indicators in the liver of oxidative stress mice are as follows Figure 7 shown. Among them, Figure A is the content of malondialdehyde (MDA), Figure B is the activity of superoxide dismutase (SOD), Figure C is the activity of glutathione peroxidase (GPx), Figure D is the total antioxidant capacity (T-AOC), and Figure E is the activity of catalase (CAT). It can be Figure 7 illustrated that D-galactose can cause an increase in the content of MDA in the liver and a decrease in the activity of antioxidant enzymes. After the polyphenol extract acts on oxidative damage mice, it can effectively reduce the content of toxic substances such as malondialdehyde and increase the activity of antioxidant-related enzymes. The effect of the combined enzymolysis polyphenol extract is the best.
[0070] The expression of antioxidant-related genes in the liver of oxidative stress mice is as follows Figure 8 shown. Figure A is Nrf2, Figure B is NQO1, Figure C is HO-1, Figure D is Sod1, Figure E is GCLC, Figure F is Sod2, and Figure G is GCLM. It can be Figure 8 illustrated that the polyphenol extract acting on oxidative damage mice can effectively up-regulate the expression levels of Nrf2 and its downstream genes. The up-regulation effect of ME on genes such as Nrf2 is more obvious, showing better antioxidant capacity.
[0071] The expression of antioxidant-related proteins in the liver of oxidative stress mice is as follows Figures 9 - 12 shown. Among them, Figures 9 - 11 are the immunohistochemical images of antioxidant-related proteins Nrf2, HO-1, and NQO1 respectively, Figure 12 and A, B, and C are the statistical graphs of the expression levels of Nrf2, HO-1, and NQO1 proteins respectively. It can be Figures 9 - 12 illustrated that the change trends of Nrf2, NQO1, and HO-1 proteins are basically consistent with the change trends of their gene expression levels, further verifying the role of polyphenol extract in relieving oxidative stress.
[0072] In summary, according to the above experimental data, on the one hand, the present invention uses tannase and β-glucosidase to jointly enzymatically hydrolyze polyphenol extracts. Compared with single-enzyme treatment of polyphenols, the effect of joint enzymatic hydrolysis is better, and the content of small molecular substances in the obtained polyphenol products is higher, which can significantly improve the antioxidant activity of pomegranate peel polyphenol extracts. On the other hand, the joint enzymatic hydrolysis of polyphenol extracts has an obvious improvement effect on the oxidative damage of oxidative stress mice, indicating that polyphenol extracts have good antioxidant and anti-inflammatory activities and have broad application prospects.
[0073] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, makes equivalent substitutions or changes, and should be covered within the protection scope of the present invention.
Claims
1. A method for enzymatically hydrolyzing pomegranate peel polyphenol extract by using tannase and β-glucosidase in combination, characterized in that, It includes the following steps: S1. Crush pomegranate peels to obtain pomegranate peel powder; add the pomegranate peel powder to water, and perform heating extraction to obtain pomegranate peel polyphenol extract; S2. Add the pomegranate peel polyphenol extract to a solvent, add tannase and β-glucosidase to perform combined enzymatic hydrolysis on the pomegranate peel polyphenol extract to obtain an enzymatic hydrolysis product of pomegranate peel polyphenol extract.
2. The method according to claim 1, wherein In S1, the solid-liquid ratio of pomegranate peel powder to water is 1:20 - 1:60 g / mL, the heating extraction temperature is 40 - 80 °C, the heating extraction time is 0.5 - 6 h, and the number of heating extraction times is 1 - 2 times.
3. The method according to claim 1, characterized in that In S1, the solid-liquid ratio of pomegranate peel powder to water is 1:60 g / mL, the heating extraction temperature is 80 °C, the heating extraction time is 0.5 h, and the number of heating extraction times is 1 time.
4. The method according to claim 1, characterized in that, In S2, the solvent is a mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate with a concentration of 0.05 - 0.15 mol / L, pH 4.5 - 5.5, the enzyme activity of tannase is 250 - 500 U / g, the enzyme activity of glucosidase is 150 - 250 U / g, the concentration of tannase is 3 - 27 μg / mg, the concentration of β-glucosidase is 5 - 45 μg / mg, the combined enzymatic hydrolysis time is 0.5 - 4 h, and the combined enzymatic hydrolysis temperature is 35 - 45 °C.
5. The method according to claim 1, characterized in that, In S2, the solvent is a mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate with a concentration of 0.1 mol / L, pH 5.0, the enzyme activity of tannase is 300 U / g, the enzyme activity of glucosidase is 200 U / g, the concentration of tannase is 15 μg / mg, the concentration of β-glucosidase is 35 μg / mg, the combined enzymatic hydrolysis time is 4 h, and the combined enzymatic hydrolysis temperature is 35 °C.
6. A pomegranate peel polyphenol extract enzymatic hydrolysate, characterized in that, Prepared by using the method described in any one of claims 1 to 5.
7. A method for improving the in vitro and in vivo antioxidant activities of pomegranate peel polyphenol extract, characterized in that, It includes the following steps: (1) Crush pomegranate peels to obtain pomegranate peel powder; add the pomegranate peel powder to water, set the extraction temperature at 40 - 80 °C, the solid-liquid ratio at 1:20 - 1:60 g / mL, the extraction time at 0.5 - 6 h, the number of extraction times at 1 - 2 times. After extraction, centrifuge and collect the supernatant to obtain pomegranate peel polyphenol extract; measure the polyphenol content in the pomegranate peel polyphenol extract, and determine the optimal extraction conditions based on the polyphenol content in the pomegranate peel polyphenol extract; (2) Add the pomegranate peel polyphenol extract obtained under the optimal extraction conditions to a solvent, perform separate enzymatic hydrolysis on the pomegranate peel polyphenol extract with tannase and β-glucosidase respectively, and perform combined enzymatic hydrolysis on the pomegranate peel polyphenol extract with tannase and β-glucosidase to obtain tannase enzymatic hydrolysis product, β-glucosidase enzymatic hydrolysis product and combined enzymatic hydrolysis product respectively, and measure the in vitro antioxidant activity and changes in the material components of each enzymatic hydrolysis product; Among them, the conditions for separate enzymatic hydrolysis with tannase include: the solvent is a mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate with a concentration of 0.1 mol / L, pH 5, the enzyme activity of tannase is 300 U / g, the concentration of tannase is 0 - 27 μg / mg polyphenol, the enzymatic hydrolysis time is 0 - 240 min, and the enzymatic hydrolysis temperature is 35 °C; The conditions for the enzymatic hydrolysis by β-glucosidase alone include: the solvent is a mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate at 0.1 mol / L, pH 5, the enzyme activity of β-glucosidase is 200 U / g, the concentration of β-glucosidase is 35 μg / mg, the enzymatic hydrolysis time is 0 - 240 min, and the enzymatic hydrolysis temperature is 45°C; The conditions for the combined enzymatic hydrolysis include: the solvent is a mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate at 0.1 mol / L, pH 5, the enzyme activity of tannase is 300 U / g, the enzyme activity of glucosidase is 200 U / g, the concentration of tannase is 15 μg / mg, the concentration of β-glucosidase is 35 μg / mg, the enzymatic hydrolysis time is 0 - 240 min, and the temperature of the combined enzymatic hydrolysis is 35°C; (3) The pomegranate peel polyphenol extract obtained in step (1) is respectively applied to oxidative stress mice together with the enzymatic hydrolysis products of tannase, β-glucosidase, and the combined enzymatic hydrolysis product in step (2), and the changes in antioxidant activities of the four substances in the mice are respectively measured; (4) Compare the in vitro antioxidant activities, changes in substance components, and changes in in vivo antioxidant activities of the enzymatic hydrolysis products of tannase, β-glucosidase, and the combined enzymatic hydrolysis product. Determine the optimal enzymatic hydrolysis conditions based on the enzymatic hydrolysis product with the largest change, and treat pomegranate peel under the optimal enzymatic hydrolysis conditions to obtain pomegranate peel polyphenols with high antioxidant activities in vitro and in vivo.
8. The method according to claim 7, wherein In step (1), the optimal extraction conditions include: the extraction temperature is 80°C, the solid-liquid ratio is 1:60 g / mL, the extraction time is 0.5 h, the extraction times is 1 time, and the polyphenol content is determined by the Folin-Ciocalteu method.
9. The method according to claim 7, wherein In step (2), the in vitro antioxidant activity is determined by the DPPH radical scavenging ability and the ABTS radical scavenging ability, and the changes in the relative contents of polyphenol components in the samples before and after enzymatic hydrolysis are determined by UPLC-ESI-QTOF-MS; In step (3), the changes in in vivo antioxidant activity are reflected by measuring the body weight changes, organ indices, serum and liver antioxidant indices, and the expression of antioxidant-related genes and proteins in mice.
10. The method according to claim 7, wherein In step (4), the optimal enzymatic hydrolysis conditions include: the solvent is a mixed solution of disodium hydrogen phosphate - sodium dihydrogen phosphate at 0.1 mol / L, pH 5, the enzyme activity of tannase is 300 U / g, the enzyme activity of glucosidase is 200 U / g, the concentration of tannase is 15 μg / mg, the concentration of β-glucosidase is 35 μg / mg, the time of the combined enzymatic hydrolysis is 4 h, and the temperature of the combined enzymatic hydrolysis is 35°C.
Citation Information
Patent Citations
Preparation technology of antifatigue active pomegranate peel polyphenol
CN106860490A
Cited By
Macadamia nut processing method based on endogenous component conversion
CN121369654A
Macadamia nut processing method based on endogenous component transformation
CN121369654B