Hybridoma cell strain secreting anti-bovine chloromonas monoclonal antibody, monoclonal antibody and its application

Abstract

The present application relates to the field of biotechnology, and particularly relates to hybridoma cell strains secreting anti-bovine no green algae monoclonal antibodies, monoclonal antibodies and application thereof. The present application discloses hybridoma cell strains secreting anti-bovine no green algae monoclonal antibodies H12F7 and 114C7 and two monoclonal antibodies secreted by the strains. The two monoclonal antibodies can specifically recognize antigen epitopes of different bovine no green algae strains, have significant broad spectrum and can be widely applied to the field of bovine no green algae detection. The present application further constructs a bovine no green algae detection system by combination of monoclonal antibody H12F7 and monoclonal antibody 114C7. The system significantly improves the specificity of bovine no green algae detection, can effectively distinguish target strains from non-target strains and avoid false positives. Meanwhile, the system has high sensitivity and a wide linear range, can accurately quantify bovine no green algae of different concentrations, meets diversified detection requirements and has good application prospect.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to hybridoma cell lines that secrete monoclonal antibodies against bovine green algae, monoclonal antibodies, and their applications. Background Technology

[0002] *Prototheca bovis* (P. bovis) is a eukaryotic microorganism belonging to the genus *Prototheca* in the family Chlorophyceae. It has a double cell wall, lacks chloroplasts, and its sporangia are approximately 7-30 μm in diameter. This microorganism is a significant pathogen causing mastitis in dairy cows. After infection, it persists in the animal's body, causing irreversible damage to mammary epithelial cells, often leading to clinical or subclinical mastitis. This results in decreased milk production, reduced fresh milk quality, and sometimes symptoms such as flocculent sediment and udder swelling. Furthermore, *Prototheca bovis* can also infect humans, dogs, and cats. In humans, clinical symptoms include skin infections and olecranon synovitis, posing a threat to public health.

[0003] Currently, methods for diagnosing mastitis in bovines without chlorophyll include traditional bacterial identification and quantitative real-time PCR (qPCR). However, traditional bacterial identification methods are time-consuming and have low sensitivity; while qPCR offers high sensitivity, it requires specialized equipment. Therefore, establishing a highly specific and sensitive antigen detection method would complement current nucleic acid detection methods and is of great significance for the rapid clinical diagnosis of mastitis in bovines without chlorophyll. The preparation of specific monoclonal antibodies is a crucial foundation for establishing such antigen detection methods.

[0004] Enzyme-linked immunosorbent assay (ELISA) is a targeted detection technique based on the specific binding of antigens and antibodies, offering advantages such as high sensitivity, strong specificity, and ease of operation. In veterinary medicine, double-antibody sandwich ELISA has become an important detection method for pathogens due to its strong anti-interference ability. However, there are currently no reports on monoclonal antibodies against bovine chlorophyll-free algae, which limits the application of ELISA technology in the detection of bovine chlorophyll-free algae. Summary of the Invention

[0005] In view of this, the present invention proposes a hybridoma cell line that secretes monoclonal antibodies against bovine green algae, the monoclonal antibodies, and their applications.

[0006] The technical solution of this invention is implemented as follows:

[0007] In a first aspect, the present invention provides a hybridoma cell line H12F7 that secretes monoclonal antibodies against bovine green algae. The hybridoma cell line H12F7 was deposited at the China Center for Type Culture Collection on April 3, 2025, with accession number CCTCC NO: C202529 and address at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0008] Secondly, the present invention provides an anti-bovine green algae monoclonal antibody H12F7 produced from the hybridoma cell line H12F7.

[0009] Thirdly, the present invention provides a hybridoma cell line 114C7 that secretes monoclonal antibodies against bovine green algae. The hybridoma cell line 114C7 was deposited at the China Center for Type Culture Collection on April 3, 2025, with accession number CCTCC NO: C202530, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0010] Fourthly, the present invention provides a monoclonal antibody 114C7 against bovine green algae produced from the hybridoma cell line 114C7.

[0011] Fifthly, the present invention provides the application of the monoclonal antibody H12F7 or monoclonal antibody 114C7 in the preparation of a kit for detecting bovine green algae. The method for detecting bovine green algae using the kit includes one of enzyme-linked immunosorbent assay (ELISA), immunohistochemistry, immunofluorescence assay, Western blotting, flow cytometry, and immunochromatography.

[0012] In a sixth aspect, the present invention provides a product for detecting bovine green algae, the product comprising the monoclonal antibody H12F7 or monoclonal antibody 114C7, and the product comprising one of a reagent, a test strip, and a kit.

[0013] In some specific embodiments, the product is a double-antibody sandwich ELISA detection kit; the kit components include: capture antibody H12F7 and detection antibody 114C7; the label for detection antibody 114C7 is selected from one of enzyme labels, fluorescent labels, biotin labels, radiolabels, and nanomaterial labels. In some specific embodiments, the kit components also include at least one of coating buffer, blocking buffer, chromogenic buffer, antibody dilution buffer, washing buffer, and stop solution.

[0014] In a seventh aspect, the present invention provides the application of the product for detecting bovine green algae in the detection of bovine green algae, wherein the application is not for disease diagnosis or treatment purposes.

[0015] Eighthly, the present invention also provides a method for detecting bovine chlorophyll-free algae, wherein the method is not for disease diagnosis or treatment purposes, and includes the following steps:

[0016] S1. Capture antibody H12F7 at a concentration of 5-20 μg / mL is coated onto a solid-phase support and incubated at 4℃ for 12-14 h.

[0017] S2, 30-40℃ sealing solution treatment for 1-2 hours;

[0018] S3. Add the sample to be tested and incubate at 30-40℃ for 1.5-2 hours;

[0019] S4. Add horseradish peroxidase (HRP) labeled detection antibody 114C7 (i.e. 114C7-HRP). Dilute 114C7-HRP with antibody dilution buffer at a ratio of 1: (1000-4000) and incubate at 30-40℃ for 45-60 min.

[0020] S5. Add the chromogenic substrate, and terminate the reaction after the chromogenic reaction is carried out in the dark. Detect the absorbance of the test sample and the negative control at 450 nm.

[0021] The beneficial effects of the present invention include at least the following:

[0022] This invention provides hybridoma cell lines H12F7 and 114C7 that secrete monoclonal antibodies against bovine chlorophyll-free (Chlorella vulgaris) strains, and the monoclonal antibodies H12F7 and 114C7 secreted by them, respectively. The monoclonal antibodies H12F7 and 114C7 provided by this invention can specifically recognize antigenic epitopes of different bovine chlorophyll-free strains, exhibiting significant broad-spectrum activity and wide applicability in the detection of bovine chlorophyll-free.

[0023] This invention combines monoclonal antibodies H12F7 and 114C7 to construct a highly efficient detection system for *Chlorella vulgaris*. This system significantly improves detection specificity, effectively distinguishing target strains from non-target strains and avoiding false positives. Simultaneously, it exhibits high sensitivity and a wide linear range, accurately quantifying different concentrations of *Chlorella vulgaris* to meet diverse detection needs. This invention provides strong technical support for related fields such as environmental monitoring, food safety, bio-agriculture, biomedical research, and industrial water treatment, and has significant practical application value.

[0024] [Biological Preservation]

[0025] The hybridoma cell line H12F7 provided by this invention was deposited at the China Center for Type Culture Collection on April 3, 2025, with accession number CCTCC NO: C202529 and address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0026] The hybridoma cell line 114C7 provided by this invention was deposited at the China Center for Type Culture Collection on April 3, 2025, with accession number CCTCC NO: C202530, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 This is the reaction (10×) between monoclonal antibody and P. bovis bacterial surface antigen in this embodiment of the invention.

[0029] Figure 2 This invention relates to an optimization analysis of parameters in a bovine algae-free double-antibody sandwich ELISA detection system (S / N value = sample OD). 450 / Negative control OD 450 (n = 3 repeated experiments; the same applies below, and will not be repeated hereafter); Figure 2 A is an optimization of the H12F7 wrapping condition; Figure 2 B represents the optimization of the sealing solution concentration; Figure 2 C is an optimization of the confinement time; Figure 2 D represents the optimization of antigen incubation time; Figure 2 E represents the optimization of the incubation time for enzyme-labeled 114C7-HRP; Figure 2 F represents the optimization of the colorimetric reaction time;

[0030] Figure 3 This is the quantitative detection and specificity verification result of the double-antibody sandwich ELISA detection system for bovine algae-free plants in this embodiment of the invention; Figure 3 A is the concentration of bovine green algae and OD. 450 Linear regression analysis of values; Figure 3 B is the specificity verification of bovine green algae using the double-antibody sandwich ELISA method; Figure 4 This is an example of the parameter optimization analysis of the double-antibody sandwich ELISA detection system for raw milk in this invention embodiment; Figure 4 A represents the optimization of the milk sample dilution factor; Figure 4 B represents the concentration of bovine chlorophyll-free algae in milk samples and its relationship with OD. 450 Linear regression analysis of values;

[0031] Figure 5 This is an optimization analysis of the double-antibody sandwich ELISA detection system for raw milk in this embodiment of the invention; Figure 5 A represents the optimization of H12F7 coating conditions; 5B represents the optimization of blocking solution concentration. Figure 5 C is an optimization of the confinement time; Figure 5 D represents the optimization of milk sample incubation time; Figure 5 E represents the optimization of the incubation time for enzyme-labeled 114C7-HRP; Figure 5 F represents the optimization of the colorimetric reaction time. Detailed Implementation

[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0033] Materials and reagents:

[0034] The Hubei isolates of *Neopystrophyta bovis* in this application, PBHuB052, PBHuB005, PBHuB062, and PBHuB171, are all deposited at the China Center for Type Culture Collection (CCTCC), with accession numbers CCTCC NO: M2019978, CCTCC NO: M2019979, CCTCC NO: M2019980, and CCTCC NO: M2025719, respectively. The deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0035] SPF-grade female BALB / c mice (6-8 weeks old) were purchased from the Experimental Animal Center of Wuhan University (Ethics Review No.: WP20240220). SP2 / 0 mouse myeloma cells are preserved by the State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, and are available to the public from the State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University. The applicant promises to release the biological materials to the public within twenty years from the date of application. The biological materials provided will only be used to verify the relevant experiments, techniques, and conclusions involved in this application and may not be used for any other commercial purposes or unauthorized research. The recipient must strictly comply with this provision.

[0036] Microbial culture media: Sabouraud dextrose agar (SDA), Sabouraud dextrose broth (SDB), and trypticase-soy broth (TSB) were purchased from Qingdao Haibo Biotechnology Co., Ltd., with product numbers HB0253-81, HBPP0253-500, and HB4114, respectively.

[0037] Cell culture media: 100x penicillin and streptomycin-containing antibiotics and RPMI-1640 basal medium were purchased from Hycone, USA (catalog numbers SV30010 and SH30809.01, respectively); fetal bovine serum (FBS) was purchased from Excel (catalog number: FSP500). 50x hypoxanthine-aminopterin-thymidine (HAT) and 50x hypoxanthine-thymidine (HT) culture medium supplements were purchased from Sigma, USA (catalog numbers H0262 and H0137, respectively).

[0038] Chemical reagents: Horseradish peroxidase (HRP) was purchased from Beijing Solarbio Chemical Co., Ltd., product number: P8020. Sodium chloride (CAS: 7647145), anhydrous ethanol (CAS: 64175), formaldehyde (CAS: 50000), acetic acid (CAS: 64197), glacial acetic acid (CAS: 10000218), glycerol (CAS: 56815), imidazole (CAS: 288324), anhydrous sodium carbonate (CAS: 497198), dodecahydrate and disodium hydrogen phosphate (CAS: 10039324), potassium carbonate (CAS: 584087), potassium dihydrogen phosphate (7778770), ethylenediaminetetraacetic acid (CAS: 60004), Tween- 20 (CAS: 9005645), concentrated hydrochloric acid (CAS: 7647010), sodium hydroxide (CAS: 1310732), ammonium sulfate (CAS: 7783202), sodium acetate trihydrate (CAS: 6131904), dimethyl sulfoxide (CAS: 67685), sodium bicarbonate (CAS: 144558), sodium periodate (CAS: 7790285), sodium acetate (CAS: 127093), citric acid (CAS: 77929), and potassium chloride (CAS: 7447407) were all purchased from Sinopharm Chemical Reagent Co., Ltd.

[0039] Reagent kits: Monoclonal antibody subtype identification kit was purchased from Bio-Long Biotech, China (catalog number: BF16001); Gram staining kit was purchased from Qingdao Haibo Biotechnology, Qingdao (catalog number: HB8278).

[0040] Example 1: Preparation of monoclonal antibodies against bovine green algae (Prototheca bovis, P. bovis)

[0041] 1. Immunogen preparation

[0042] (1) Preparation of group A immunogen:

[0043] PBHuB052, PBHuB005, PBHuB062, and PBHuB171 were cultured in SDB medium at 37°C and 180 rpm for 48 h. A portion of the bacterial culture was used for counting, and the remaining bacterial culture was inactivated overnight at 4°C by adding formaldehyde (final concentration 3% v / v). The cells were collected by centrifugation at 8000 rpm for 30 min, washed five times with PBS, and the bacterial concentration was adjusted to 5 × 10⁻⁶. 6 CFU / mL, four strains of bovine green algae were mixed in equal amounts to a final concentration of 2×10⁻⁶. 7 CFU / mL.

[0044] (2) Preparation of group B immunogens:

[0045] PBHuB052 was inoculated into SDB medium, and the culture conditions, counting, and inactivation methods remained unchanged, but the concentration was adjusted to 2×10⁻⁶. 7 The whole bacterial protein immunogen was prepared at CFU / mL and subjected to low-temperature, high-pressure disruption. The resulting immunogen was then stored at -80°C.

[0046] 2. Animal immunization and preparation of hybridoma cells

[0047] Immunogens A and B were emulsified with equal volumes of Freund's complete adjuvant and administered to five female BALB / c mice via subcutaneous injection at a dose of 0.2 mL per mouse. A total of five immunizations were performed, with 14-day intervals between each. Blood was collected from the orbital vein before each immunization, and serum was separated and coated with group A and group B antigen proteins, respectively. Titer was then detected by indirect ELISA.

[0048] Three days before hybridoma cell fusion, mice were given a booster immunization via intraperitoneal injection. After euthanasia, the spleens were harvested, and spleen cells were fused with SP2 / 0 mouse myeloma cells. Seven to ten days after fusion, the cells in 96-well plates were observed under a microscope. When the fused cells grew into cell clusters at the bottom, approximately one-quarter the size of each well, indirect immunofluorescence detection was performed. The incubated slides were observed under a fluorescence microscope; cells showing obvious green fluorescence were considered positive. The locations of positive wells were recorded. Hybridoma cell subcloning was performed using limiting dilution and flow cytometry. After four subcloning processes, ascites fluid was prepared.

[0049] Example 2: Identification of the biological characteristics of bovine monoclonal antibodies against green algae

[0050] I. Methods

[0051] 1. Monoclonal antibody subtype identification

[0052] Monoclonal antibodies in ascites fluid were identified using a monoclonal antibody subtype identification kit.

[0053] 2. Titer detection of monoclonal antibody in ascites

[0054] The bovine green algae whole bacterial protein was coated, and the ascites titers of the two monoclonal antibodies were determined by indirect ELISA. The ascites was serially diluted 2-fold starting from 1:200.

[0055] 3. Identification of monoclonal antibody binding to surface antigens using immunofluorescence assay (IFA)

[0056] (1) Preparation of antigen tablets:

[0057] *Chlorella vulgaris* was cultured in SDA medium at 37°C for 48 hours. Single colonies were scraped onto glass slides, spread evenly, and allowed to air dry. The slides were then fixed with pre-cooled acetone at 4°C for 10 minutes, washed three times with PBS for 5 minutes each time, and allowed to air dry.

[0058] (2) Antibody detection:

[0059] The purified monoclonal antibody was diluted 1000-fold and added to a glass slide. The slide was then placed in a humidified chamber and incubated at 37°C for 1 min. A negative control group was also prepared with PBS. The slide was removed and washed three times with PBS for 5 min each time. Fluorescein-labeled goat anti-mouse IgG secondary antibody was added, and the slide was placed in a humidified chamber, protected from light, and incubated at 37°C for 30 min. The slide was then washed three times with PBS for 5 min each time. After drying, the results were observed under a fluorescence inverted microscope.

[0060] 4. Monoclonal antibody specificity identification

[0061] The specificity of monoclonal antibodies was detected by indirect ELISA using whole-cell protein coatings of common bovine mastitis pathogens (Staphylococcus aureus, Streptococcus paramammatidis, Salmonella, Klebsiella pneumoniae, Pseudomonas aeruginosa, Escherichia coli, Cryptobacterium pyogenes) isolated and identified clinically, as well as bovine non-green algae.

[0062] II. Results

[0063] 1. Monoclonal antibody subtype identification

[0064] Positive cells selected by indirect ELISA after cell fusion were subcloned four times to obtain two hybridoma cell lines secreting monoclonal antibodies, named H12F7 and 114C7, respectively. H12F7 was selected from group A and 114C7 was selected from group B.

[0065] Hybridoma cells H12F7 that secrete monoclonal antibodies against bovine green algae were deposited at the China Center for Type Culture Collection on April 3, 2025, with accession number CCTCC NO: C202529 and address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0066] Hybridoma cells 114C7 that secrete monoclonal antibodies against bovine green algae were deposited at the China Center for Type Culture Collection (CCTCC) on April 3, 2025, with accession number CCTCC NO: C202530 and address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0067] The two monoclonal antibodies were identified using a monoclonal antibody subtype identification kit. The results showed that the heavy chain subtype of H12F7 monoclonal antibody was IgG3, and the heavy chain subtype of 114C7 monoclonal antibody was IgG1. The light chain subtypes of both were κ.

[0068] 2. Titer detection of monoclonal antibody in ascites

[0069] The ascites titer of the monoclonal antibody was detected by indirect ELISA, and the result was 1:12800.

[0070] 3. IFA verification of monoclonal antibody binding to surface antigen

[0071] IFA results showed that both monoclonal antibodies could bind to the surface of four bovine *Aureobasidium* strains: PBHuB052, PBHuB005, PBHuB062, and PBHuB171. Obvious fluorescence signals were observed under a fluorescence inverted microscope. The bacterial structure could be clearly observed under a 10× objective lens. Figure 1 ).

[0072] 4. Monoclonal antibody specificity identification

[0073] The specific reactions of two monoclonal antibodies with whole bacterial proteins of bovine achlorella and seven clinically isolated common pathogens of bovine mastitis (Staphylococcus aureus, Streptococcus paramammatidis, Salmonella, Klebsiella pneumoniae, Pseudomonas aeruginosa, Escherichia coli, and Cryptococcus pyogenes) were detected by indirect ELISA.

[0074] The results (Table 1) showed that the two monoclonal antibodies could recognize bovine chlorophyll-free algae and did not bind to seven other common pathogens causing mastitis in dairy cows.

[0075] Table 1. Specificity identification of bovine chlorophyll-free monoclonal antibodies.

[0076]

[0077] Currently, there are no reports on monoclonal antibodies against bovine green algae, and research on the bovine green algae genome is in its early stages; therefore, no specific protein can be used as an immunogen.

[0078] To ensure the prepared monoclonal antibody can bind to the surface antigen of *A. bovis* and to increase the broad-spectrum recognition of different *A. bovis* strains, four *A. bovis* strains with different origins and high activity—PBHuB052, PBHuB005, PBHuB062, and PBHuB171—were selected as immunogens. PBHuB052, PBHuB005, and PBHuB062 were isolated from infected dairy cows in different regions, while PBHuB171 was isolated from environmental water. Furthermore, based on preliminary experimental results, the serum titer of mice immunized with PBHuB052 whole-cell protein reached 1:51200. To increase the likelihood of screening for monoclonal antibodies and to enhance the broad-spectrum recognition of different *A. bovis* strains, an additional mixed immunization group of equal amounts of PBHuB052, PBHuB005, PBHuB062, and PBHuB171 bacterial cells was added to the PBHuB052 whole-cell protein immunization group. IFA and specificity identification results showed that both monoclonal antibodies could bind to the surface antigen of bovine chlorophyll-free algae and showed no cross-reactivity with the seven bovine mastitis pathogens used in the experiment, providing important biological materials for establishing an immunological diagnostic method for bovine chlorophyll-free algae.

[0079] Example 3: Establishment of a double-antibody sandwich ELISA detection system for bovine algae-free organisms.

[0080] 1. HRP-labeled monoclonal antibody

[0081] (1) Dissolve 2.50 mg of HRP in 0.5 mL of deionized water, add 1 mL of 0.06 mol / L sodium periodate solution, stir gently for 20 min in the dark at room temperature, and the solution turns yellow-green.

[0082] (2) Add 1 mL of 0.16 mol / L ethylene glycol and place it on a shaker (120 r / min) for 1 h to terminate the oxidation reaction;

[0083] (3) Add 1 mL of monoclonal antibody with a concentration of 2.5 mg / mL to the activated HRP and dialyze overnight at 4°C in 0.05 mol / L carbonate buffer (pH 9.60);

[0084] (4) Add 0.2 mL of 4 mg / mL NaHB4 and let stand at 4℃ for 2 h;

[0085] (5) After adding an equal volume of 50% saturated ammonium sulfate solution (pH 7.20), let it stand at 4℃ for 30 min, centrifuge at 10000 r / min for 30 min, and retain the precipitate;

[0086] (6) Dissolve the precipitate in 0.02 mol / L PBS (pH 7.40) and dialyze with this buffer for 6-12 h, changing the buffer 3 times. If there is a precipitate, centrifuge at 10000 r / min at 4℃ for 15-30 min. The supernatant is the enzyme-labeled conjugate.

[0087] (7) Add BSA to the conjugate until the final protein concentration is 33 mg / mL and an equal volume of glycerol. After determining the working potency, aliquot the conjugate and store it at -20℃ for later use.

[0088] 2. Selection of capture antibodies and detection antibodies

[0089] (1) The monoclonal antibodies H12F7 and 114C7 were diluted to 10 μg / mL as capture antibodies, 100 μL / well, and coated overnight at 4°C.

[0090] (2) Discard the coating solution, add 300 μL of PBST to each well, wash 3 times; add 150 μL of 2% BSA to each well, and block at 37℃ for 3 h;

[0091] (3) Washing is the same as in step (2). After washing, add 100 μL of 1×10⁻⁶ solution to each well. 5 A mixture of four bovine green algae strains (equal amounts of PBHuB052, PBHuB005, PBHuB062, and PBHuB171) at CFU / mL was prepared, with PBS as a negative control, and incubated at 37°C for 1 h.

[0092] (4) Wash as in step (2), and after washing 5 times, add HRP-labeled H12F7 and 114C7 as detection antibodies respectively, dilute them to 1000 times with PBST, 100 μL per well, and incubate at 37°C for 1 h.

[0093] (5) Wash as in step (2), wash 5 times, add 100 μL of colorimetric solution to each well, react at room temperature in the dark for 20 min, add 50 μL of dilute hydrochloric acid to stop the reaction, measure the absorbance at 450 nm to determine the optimal capture antibody and detection antibody.

[0094] Results (see Table 2): Monoclonal antibody H12F7 was selected as the capture antibody; monoclonal antibody 114C7 was selected as the detection antibody.

[0095] Table 2 Screening results of capture antibodies and detection antibodies

[0096]

[0097] 3. Optimization of the double-antibody sandwich ELISA detection reaction system

[0098] (1) Optimization of working concentrations of capture and detection antibodies

[0099] The checkerboard titration method is used, and the steps are as follows:

[0100] (a) Dilute monoclonal antibody H12F7 to 20, 10, 5, 2.5, 1.25, 0.625, and 0.3125 μg / mL, 100 μL per well, and coat each well with the enzyme label strips in rows 1-7. Set up a blank control and coat overnight at 4°C.

[0101] (b) Discard the coating solution, wash three times with 300 μL of PBST per well, add 150 μL of 2% BSA and block at 37°C for 3 h;

[0102] (c) Washing is the same as in step (b), washing three times with 300 μL of PBST per well. Add 100 μL of 1×10⁻⁶ PBST to each of columns 1-6 of the enzyme-labeled strips. 5 CFU / mL bovine green algae mixed algae solution, 100 μL PBS was added to each of columns 7-12 of the enzyme label strip as a negative control, and incubated at 37℃ for 1 h;

[0103] (d) Washing is the same as in step (b). Wash each well with 300 μL of PBST 5 times, blot dry, and dilute 114C7-HRP to 1:500, 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000 and 1:64000. Add these 6 dilution gradients to columns 1-6 and 7-12 in sequence, and incubate at 37°C for 1 h.

[0104] (e) Washing is the same as in step (b), wash 5 times with 300 μL of PBST per well, and develop color at room temperature in the dark for 15 min with 100 μL of colorimetric solution per well.

[0105] (f) Add 100 μL of stop solution to each well. Use a microplate reader to measure the absorbance at 450 nm, and select the concentration corresponding to the maximum S / N value as the optimal condition.

[0106] Results (see Tables 3 and 4): The working concentration of the capture antibody H12F7 was 5 μg / mL; the working dilution of the detection antibody 114C7 was 1:2000.

[0107] Table 3 Optimal working concentrations of capture antibodies in ELISA systems

[0108]

[0109]

[0110] Table 4 Optimal working concentrations of antibodies for detection in ELISA systems

[0111] 114C7-HRP dilution factor <![CDATA[Positive OD 450 value]]> <![CDATA[Negative OD 450 value]]> S / N 500 3.061 0.645 4.746 1000 2.058 0.444 4.635 2000 1.625 0.273 5.952 4000 1.062 0.275 3.861 8000 0.743 0.254 2.925 16000 0.411 0.182 2.258

[0112] (2) Optimization of capture antibody coating conditions

[0113] Experiments were conducted according to the parameters determined above. The coating conditions for the capture antibody were optimized by selecting 4℃ for 10h, 4℃ for 12h, 4℃ for 14h, 37℃ for 2h, and 37℃ for 4h. The OD value at 450nm was measured, and the condition corresponding to the maximum S / N ratio was selected as the optimal coating condition for the capture antibody.

[0114] result( Figure 2 A) The optimal conditions for coating the capture antibody are 4℃ for 12 hours.

[0115] (3) Optimization of closure conditions

[0116] The experiment was conducted according to the parameters determined above. Seven blocking solutions were selected: 0.5% BSA (bovine serum albumin), 1% BSA, 2% BSA, 1% SMP (skim milk powder), 5% SMP, 1% fetal bovine serum (FBS), and 5% fetal bovine serum. Five durations of 30 min, 60 min, 90 min, 120 min, and 150 min were selected as the optimal blocking conditions. The OD value at 450 nm was measured, and the condition corresponding to the maximum S / N ratio was selected as the optimal blocking condition.

[0117] result( Figure 2 B and Figure 2 C) The optimal sealing condition is 5% SMP for 60 min.

[0118] (4) Optimization of antigen incubation time

[0119] Experiments were conducted using the parameters determined above. The incubation time of the antigen was optimized by selecting 30 min, 60 min, 90 min, 120 min, 150 min, and 180 min. The time corresponding to the maximum S / N ratio was selected as the optimal incubation time for the antigen.

[0120] result( Figure 2 D) The optimal antigen incubation time is 120 min.

[0121] (5) Optimization of antibody incubation time

[0122] The experiment was conducted according to the parameters determined above. Five incubation times of 15 min, 30 min, 45 min, 60 min and 75 min were selected to optimize the incubation time of the detection antibody. The time corresponding to the maximum S / N value was selected as the optimal incubation time for the detection antibody.

[0123] result( Figure 2 E) The optimal incubation time for the detection antibody (114C7-HRP) is 45 minutes.

[0124] (6) Optimization of colorimetric reaction time

[0125] The experiment was conducted according to the parameters determined above. Five durations of 5 min, 10 min, 15 min, 20 min and 25 min were selected as the optimal time for the color development reaction. The duration corresponding to the maximum S / N value was selected as the optimal color development reaction time.

[0126] result( Figure 2 F) The optimal color development reaction time is 10 minutes.

[0127] Example 4: Specificity validation of the bovine algae-free double-antibody sandwich ELISA detection system

[0128] The specificity of this method was determined by detecting Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Streptococcus paramamosa, Salmonella, Pseudomonas aeruginosa, and Cryptococcus pyogenes using the established double-antibody sandwich ELISA detection system.

[0129] result( Figure 3 B) The double-antibody sandwich ELISA detection system for *Aureobasidium bovis* has high specificity for *Aureobasidium bovis* and can effectively distinguish it from other non-target bacteria.

[0130] Example 5: Linear range and sensitivity of the bovine algae-free double-antibody sandwich ELISA detection system.

[0131] The bovine algae were prepared at a ratio of 1×10 1 1×10 2 1×10 3 1×10 4 1×10 5 1×10 6 and 1×10 7 CFU / mL was used for dilution, and the logarithm of the algal concentration was plotted on the x-axis. OD 450 Using the vertical axis as the ordinate, a standard curve for the double-antibody sandwich ELISA detection system was established. The detection limit was determined by the average OD value of 10 blank controls plus three times the standard deviation, thus defining the linear range and sensitivity of the detection system.

[0132] result( Figure 3 A) The linear range of the bovine algae-free double-antibody sandwich ELISA detection system is 10–1 × 10⁻⁶. 6 CFU / mL; the limit of detection is 2.2 CFU / mL.

[0133] Example 6: Repeatability Validation of the Bovine Chlorella-Free Double Antibody Sandwich ELISA Detection System

[0134] (1) Intra-batch repeatability test

[0135] Take 5 ELISA plates from the same batch and add 1×105 CFU / mL of bovine green algae was used, with negative and blank controls set up. The experiment was conducted according to the parameters determined above, and the coefficient of variation (CV) within the same batch was calculated to evaluate the repeatability of the experiment.

[0136] (2) Inter-batch repeatability test

[0137] Take 5 ELISA plates from different batches, add 1×10 5 CFU / mL of bovine green algae was used, with negative and blank controls set up. The experiment was conducted according to the parameters determined above, and the coefficient of variation (CV) between different batches was calculated to assess the differences between batches.

[0138] Results (see Tables 5 and 6): The double-antibody sandwich ELISA detection system for bovine algae-free bacteria has a CV of less than 9% within the same batch and a CV of less than 10% between different batches.

[0139] Table 5. Batch-to-batch reproducibility of the bovine green algae-free double-antibody sandwich ELISA method

[0140] Serial Number Positive ± SD negative ± SD Blank ± SD 1 1.062±0.078 0.175±0.020 0.175±0.012 2 1.059±0.034 0.174±0.013 0.171±0.011 3 1.045±0.032 0.171±0.012 0.168±0.014 4 1.086±0.042 0.195±0.015 0.167±0.012 5 1.077±0.034 0.177±0.013 0.168±0.011 coefficient of variation 2.71％ 8.10％ 4.27％

[0141] Table 6. Batch-to-batch reproducibility of the bovine green algae-free double-antibody sandwich ELISA method

[0142] Serial Number Positive ± SD negative ± SD Blank ± SD 1 1.082±0.167 0.183±0.011 0.182±0.005 2 1.100±0.125 0.181±0.005 0.180±0.010 3 1.057±0.120 0.178±0.002 0.185±0.018 4 1.183±0.133 0.174±0.019 0.169±0.024 5 1.081±0.127 0.176±0.021 0.171±0.012 coefficient of variation 7.36％ 9.20％ 9.00％

[0143] Example 7: Optimization of the dilution factor of raw milk samples in a double-antibody sandwich ELISA detection system.

[0144] Milk samples were collected from raw milk at dairy farms. In double-antibody sandwich ELISA detection, milk sample dilution is used to reduce matrix effects and non-specific binding, thereby improving detection accuracy and sensitivity. Following the established double-antibody sandwich ELISA detection system, a gradient dilution method was used to process milk samples. By comparing the S / N values ​​of milk samples at different dilution ratios (0-100 times), the minimum dilution ratio was determined to most closely approximate the algal count in the milk sample, thus reducing the false negative rate. The specific method is as follows:

[0145] (1) Dilute monoclonal antibody H12F7 to 10 μg / mL, 100 μL per well, coat the enzyme strips in rows 1-8, and incubate overnight at 4℃.

[0146] (2) Discard the coating solution, wash each well with 300 μL of PBST 3 times, add 150 μL of 5% SMP, and block at 37°C for 1 h;

[0147] (3) Washing is the same as in step (2), washing three times with 300 μL of PBST per well. Dilute the whole milk with PBST at 0, 10, 20, 30, 40, 50, 60, 70, 80, 90, and 100 times. Add bovine chlorophyll-free algae to the diluted milk samples and adjust the concentration to 1 × 10⁻⁶. 5 CFU / mL, add 100 μL of artificially infected milk sample at each dilution to the first 4 rows of the enzyme labeling strips in columns 1-11, and add 100 μL of negative milk sample at each dilution to the enzyme labeling strips in columns 5-8 of columns 1-11 as negative controls, and incubate at 37℃ for 2 h.

[0148] (4) Wash as in step (2), wash 5 times with 300 μL PBST per well, pat dry, dilute 114C7-HRP 2000 times, and incubate at 37°C for 1 h;

[0149] (5) Washing is the same as in step (2), wash 5 times with 300 μL PBST per well, and develop color in 100 μL colorimetric solution per well at room temperature in the dark for 15 min;

[0150] (6) Add 100 μL of stop solution to each well. Use an ELISA reader to measure the absorbance at 450 nm. Select the lowest dilution factor corresponding to an S / N value greater than 2.1 as the optimal condition.

[0151] result( Figure 4 A) The optimal dilution factor for milk samples is 20-fold.

[0152] Example 8: Optimization of reaction conditions for a double-antibody sandwich ELISA detection system for raw milk.

[0153] (1) Optimization of working concentrations of capture and detection antibodies

[0154] Referring to the method in Example 5, the optimal working concentrations of the capture antibody (monoclonal antibody H12F7) and the detection antibody (114C7-HRP) in the milk system were re-determined using checkerboard titration. The specific steps are briefly described below:

[0155] The concentration range of monoclonal antibody H12F7 was expanded to 40 to 0.625 μg / mL for coating, the blocking solution was changed to 5% SMP, the artificially infected milk sample was diluted 20 times, and the remaining steps were the same as above. Finally, the concentration combination corresponding to the largest S / N value was selected as the optimal condition.

[0156] Results (see Tables 7 and 8) The optimal working concentration of the capture antibody is 10 μg / mL; the optimal working concentration of the detection antibody is 1:4000.

[0157] Table 7 Optimization of working concentration of capture antibody H12F7 based on bovine milk matrix

[0158]

[0159] Table 8 Optimal dilution optimization of detection antibody 114-HRP based on bovine milk matrix

[0160] 114C7-HRP dilution factor <![CDATA[Positive OD 450 value]]> <![CDATA[Negative OD 450 value]]> S / N 500 2.658 1.609 1.652 1000 2.179 1.099 1.983 2000 1.755 0.958 1.832 4000 1.430 0.383 3.734 8000 0.697 0.312 2.234 16000 0.530 0.252 2.103

[0161] (2) Optimization of capture antibody coating conditions

[0162] The selected coating conditions are as follows: Figure 5 A. For the remaining steps, refer to the relevant part in Example 5, and select the condition corresponding to the maximum S / N value as the optimal coating condition for capturing antibodies.

[0163] result( Figure 5 A) The optimal conditions for coating the capture antibody are 4℃ for 14 hours.

[0164] (3) Optimization of closure conditions

[0165] The selected coating conditions are as follows: Figure 5 For steps B and 5C, refer to the relevant parts in Example 5 for the remaining steps, and select the condition corresponding to the maximum value of S / N as the optimal closure condition.

[0166] result( Figure 5 B and 5C) The optimal sealing conditions are 5% SMP incubation at 37°C for 120 min.

[0167] (4) Optimization of antigen incubation time

[0168] Following the previous optimization process, different incubation times were selected to optimize the antigen (artificially infected milk sample). The incubation time range was adjusted, and the remaining steps were the same as above. The time corresponding to the maximum S / N ratio was selected as the optimal incubation time for the antigen.

[0169] result( Figure 2 E) The optimal incubation time for the antigen (artificially infected milk sample) is 37°C for 90 minutes.

[0170] (5) Optimization of antibody incubation time

[0171] Under the established optimal conditions, the incubation time for the detection antibody was further optimized. The selected incubation time range was the same as that for the antigen incubation time optimization described above; the remaining steps are omitted. The time corresponding to the maximum S / N ratio was selected as the optimal incubation time for the detection antibody.

[0172] result( Figure 2 E) The optimal incubation time for the detection antibody (114C7-HRP) is 60 minutes at 37°C.

[0173] (6) Optimization of colorimetric reaction time

[0174] Based on the optimal conditions determined in the above experiments, only the color development time was optimized. The selected color development time range is the same as described above, and the other steps are omitted. The time corresponding to the maximum S / N value was selected as the optimal color development reaction time.

[0175] result( Figure 2 E) The optimal color development reaction time is 10 minutes.

[0176] Example 9: Determination of the linear range and sensitivity of a double-antibody sandwich ELISA detection system for raw milk.

[0177] The bovine algae were prepared at a ratio of 1×10 1 1×10 2 1×10 3 1×10 4 1×10 5 1×10 6 and 1×10 7 The CFU / mL sample was diluted and added to raw milk to simulate infected samples. A standard curve was established using the same method as the linear range and sensitivity determination in Example 5 above, but applied to the double-antibody sandwich ELISA detection system for raw milk established in Example 8 to determine its linear range and sensitivity.

[0178] result( Figure 4 B) The linear range of the double-antibody sandwich ELISA detection system for raw milk is 1×10⁻⁶. 3 ~1×10 5 CFU / mL; the limit of detection is 199.5 CFU / mL.

[0179] Example 10: Repeatability test of the double-antibody sandwich ELISA detection system for raw milk

[0180] (1) Intra-batch repeatability test

[0181] Refer to the intra-batch repeatability test method in Example 6, but use the double-antibody sandwich ELISA detection system for raw milk to perform the experiment and calculate the coefficient of variation within the same batch.

[0182] (2) Inter-batch repeatability test

[0183] Similar to the intra-batch repeatability experiment described above, but different batches were used for the experiment, and the coefficient of variation between different batches was calculated to evaluate the batch-to-batch repeatability of the double-antibody sandwich ELISA detection system for raw milk.

[0184] Results (Tables 9 and 10) The double-antibody sandwich ELISA detection system for raw milk showed a CV of less than 9% within the same batch and a CV of less than 10% between different batches.

[0185] Table 9. Batch-to-batch reproducibility of the double-antibody sandwich ELISA method using raw milk matrix.

[0186] Serial Number Positive ± SD negative ± SD Blank ± SD 1 1.212±0.054 0.448±0.018 0.382±0.020 2 1.181±0.079 0.423±0.037 0.389±0.018 3 1.183±0.026 0.432±0.028 0.385±0.021 4 1.151±0.114 0.445±0.072 0.380±0.020 5 1.178±0.078 0.422±0.037 0.397±0.029 coefficient of variation 6.01％ 8.81％ 5.25％

[0187] Table 10. Batch-to-batch reproducibility of the double-antibody sandwich ELISA method using raw milk matrix.

[0188] Serial Number Positive ± SD negative ± SD Blank ± SD 1 1.237±0.170 0.464±0.065 0.455±0.037 2 1.212±0.197 0.459±0.064 0.449±0.036 3 1.191±0.089 0.443±0.042 0.399±0.028 4 1.263±0.270 0.458±0.065 0.446±0.039 5 1.228±0.104 0.479±0.069 0.474±0.051 coefficient of variation 9.90％ 8.79％ 9.30％

[0189] Example 11: Application of a double-antibody sandwich ELISA detection system for raw milk

[0190] This embodiment established and verified the sensitivity and specificity of the double-antibody sandwich ELISA detection system for raw milk, and compared the results with traditional separation and identification methods and real-time quantitative PCR methods.

[0191] Milk samples were taken from raw milk from dairy farms in the field, and a negative control was set up simultaneously.

[0192] 1. Pretreatment of milk samples

[0193] (1) Obtain the sample to be tested by centrifugation and defatting method.

[0194] Take 5 mL of milk sample, set the temperature to 12℃, and centrifuge at 4200g for 5 min. Remove the milk fat from the surface of the milk and take 2 mL of the lower layer. Centrifuge again at high speed, set the temperature to 12℃, and centrifuge at 14000g for 1 min. Resuspend the precipitate in sterile PBS.

[0195] (2) Obtaining the sample to be tested by direct dilution method

[0196] Mix the milk sample thoroughly, take 1 mL, and dilute it 20 times with sterile 1×PBST.

[0197] 2. Traditional separation and identification methods

[0198] Take 100 μL of uniformly mixed milk sample and spread it evenly on SDA medium. After 48–72 h, pick colonies with similar morphology to bovine green algae and inoculate them on PIM differential medium. After purification, pick single colonies, stained with Gram, and observe the morphology under an oil immersion microscope for preliminary determination. Incubate single colonies in SDB liquid medium for 24 h, and use the bacterial solution as a template for 18S rRNA amplification. Send the PCR product for sequencing and perform BLAST homology analysis on the sequencing results in the NCBI database.

[0199] The PCR reaction procedure is as follows:

[0200] Reaction Procedure Temperature / Time Pre-variation 95℃, 5min transsexual 95℃,30s annealing 54℃,30s Extend (repeat 30 times) 72℃,30s Final extension 72℃, 5min

[0201] The primer sequences are as follows:

[0202] Primer name Sequence (5'-3') 18S rRNA-F ATTATTATGAGTTTTATCTTGGCTCAG 18S rRNA-R AAAATTAATCCAACCGCAGATTCT

[0203] The reaction system is as follows:

[0204] Components volume 18S rRNA-F 1.00μL 18S rRNA-R 1.00μL Ex Taq DNA polymerase 0.20μL 10× buffer solution 2.50μL dNTP 2.00μL bacterial solution 1.00μL <![CDATA[ddH2O]]> To final 25.00μL

[0205] 3. Real-time quantitative PCR method

[0206] The reaction procedure for real-time PCR is as follows:

[0207] Reaction Procedure Temperature / Time Pre-variation 95℃,30s transsexual 95℃,5s annealing 59℃,50s Extend (repeat 40 times) 72℃,30s Final extension 72℃, 10min

[0208] The primer sequences are as follows:

[0209] Primer name Sequence (5'-3') cob-5-F CTAGTTATTCAAGTCCTCG cob-5-R AATTACTGTAGCACCCC

[0210] The reaction system is as follows:

[0211] Components volume cob-5-F 0.80μL cob-5-R 0.80μL SYBR Green Premix Ex Taq II 12.50μL template 1.00μL RNase-Free Water To final 25.00 μL

[0212] A sample is considered positive if its CT value is less than 35.

[0213] 4. Detection of test samples obtained by centrifugation and defatting method using double-antibody sandwich ELISA detection system 1 (hereinafter referred to as: System 1).

[0214] (1) Coat with 5 μg / mL monoclonal antibody H12F7, 100 μL per well, 4℃ for 12 h;

[0215] (2) Discard the coating solution, wash three times with 300 μL PBST per well, pat dry, and block with 150 μL 5% SMP per well at 37°C for 1 h.

[0216] (3) Discard the blocking solution, wash three times with 300 μL PBST per well, pat dry, resuspend the milk precipitate in 100 μL sterile PBS per well, and incubate at 37°C for 2 h.

[0217] (4) Discard the sample, wash five times with 300 μL PBST per well, pat dry, add 100 μL of 2000-fold diluted 114C7-HRP to each well, and incubate at 37℃ for 45 min;

[0218] (5) Discard the detection antibody, wash five times with 300 μL PBST per well, pat dry, mix equal volumes of solution A and solution B, add 100 μL to each well, and react at room temperature in the dark for 10 min.

[0219] (6) Add 50 μL of stop solution to each well to terminate the colorimetric reaction. Measure the absorbance at 450 nm using an ELISA reader; a S / N ratio greater than 2.1 indicates a positive result.

[0220] 5. Detection of directly diluted samples using the double-antibody sandwich ELISA detection system 2 (hereinafter referred to as: System 2).

[0221] (1) Coat with 10 μg / mL monoclonal antibody H12F7, 100 μL per well, 4℃ for 14 h;

[0222] (2) Discard the coating solution, wash three times with 300 μL PBST per well, blot dry, add 150 μL 5% SMP per well, and block at 37°C for 2 h.

[0223] (3) Discard the blocking solution, wash three times with 300 μL PBST per well, pat dry, add 100 μL of 20-fold diluted milk sample per well, and incubate at 37°C for 1.5 h;

[0224] (4) Discard the sample, wash five times with 300 μL PBST per well, pat dry, add 100 μL of 4000 times diluted 114C7-HRP to each well, and incubate at 37℃ for 1 h;

[0225] The color development and termination of (5) and (6), as well as the result determination, are the same as those in System 1.

[0226] The results of the four detection methods are summarized below:

[0227]

[0228]

[0229] The results show that System 1 has a positive concordance rate of 94.12% and a negative concordance rate of 99.27% ​​with traditional isolation and identification methods, and a positive concordance rate of 86.49% and a negative concordance rate of 99.25% with quantitative real-time PCR. System 2 has a positive concordance rate of 88.24% and a negative concordance rate of 97.81% with traditional isolation and identification methods, and a positive concordance rate of 81.08% and a negative concordance rate of 97.76% with quantitative real-time PCR. Both ELISA systems have the potential for clinical or field testing. The centrifugation-defatted system (System 1) has a higher concordance rate with traditional bacterial culture and quantitative real-time PCR, making it more suitable as a precise detection method. The direct dilution system (System 2) has a high concordance rate and simpler sample processing, making it suitable as a rapid screening tool.

[0230] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A hybridoma cell line H12F7 that secretes monoclonal antibodies against bovine chlorophyll-free algae, characterized in that, The hybridoma cell line H12F7 was deposited at the China Center for Type Culture Collection on April 3, 2025, with accession number CCTCC NO: C202529, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. A monoclonal antibody against bovine achlorophyll-free algae, characterized in that, Produced from the hybridoma cell line H12F7 as described in claim 1.

3. A hybridoma cell line 114C7 that secretes monoclonal antibodies against bovine chlorophyll-free algae, characterized in that, The hybridoma cell line 114C7 was deposited at the China Center for Type Culture Collection on April 3, 2025, with accession number CCTCC NO: C202530, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

4. A monoclonal antibody against bovine achlorella-free bacteria, characterized in that, Produced from the hybridoma cell line 114C7 as described in claim 3.

5. The use of the anti-bovine chlorophyll-free monoclonal antibody according to claim 2 or 4 in the preparation kit, characterized in that, The kit is for detecting bovine green algae, and the method for detecting bovine green algae using the kit includes one of the following: enzyme-linked immunosorbent assay (ELISA), immunohistochemistry, immunofluorescence assay, Western blotting, flow cytometry, and immunochromatography.

6. A product for detecting the absence of green algae in bovine tissue, characterized in that, The product comprises the anti-bovine aeruginosa monoclonal antibody as described in claim 2 or 4; the product is a kit.

7. The product according to claim 6, characterized in that, The product is a double-antibody sandwich ELISA detection kit; the kit components include: capture antibody and detection antibody; The capture antibody is the anti-bovine green algae monoclonal antibody as described in claim 2; The detection antibody is the anti-bovine aeruginosa monoclonal antibody as described in claim 4, and the detection antibody is an antibody labeled with horseradish peroxidase.

8. The product according to claim 7, characterized in that, It also includes at least one of coating buffer, blocking solution, colorimetric solution, antibody diluent, washing solution and stop solution.

9. The application of the product according to any one of claims 6-8 in the detection of bovine anemones, characterized in that, For purposes other than disease diagnosis or treatment.

10. A method for detecting the absence of green algae in bovine tissue, characterized in that, The method is not for disease diagnosis or treatment purposes and includes the following steps: S1. Coat the capture antibody onto the solid-phase support at a concentration of 5-20 μg / mL and incubate at 4℃ for 12-14 h. S2, 30-40℃ sealing solution treatment for 1-2 hours; S3. Add the sample to be tested and incubate at 30-40℃ for 1.5-2 hours; S4. Add horseradish peroxidase-labeled detection antibody, which is diluted 1: (1000-4000) times with antibody dilution buffer and incubated at 30-40℃ for 45-60 min. S5. Add the chromogenic substrate, stop the reaction after the colorimetric reaction is carried out in the dark, and detect the absorbance of the test sample and the negative control at 450 nm. The capture antibody is the anti-bovine non-chlorophyll monoclonal antibody as described in claim 2; The detection antibody is the anti-bovine achlorella monoclonal antibody as described in claim 4.

Images