Bacillus velezensis producing 2-decanol and 5-methyl-2-heptanol and application thereof

Abstract

The application discloses a Bacillus velezensis strain producing 2-decanol and 5-methyl-2-heptanol and application thereof, and belongs to the technical field of microorganisms.The application first isolates a Bacillus velezensis strain producing 2-decanol and 5-methyl-2-heptanol, the Bacillus velezensis strain is isolated from corn rhizosphere soil, is safe to use, and realizes green production and application of 2-decanol and 5-methyl-2-heptanol.The Bacillus velezensis strain has good bacteriostatic effect on various pathogenic bacteria and has broad-spectrum bacteriostatic activity.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a strain of Bacillus belye that produces 2-decyl alcohol and 5-methyl-2-heptanol and its applications. Background Technology

[0002] 5-Methyl-2-heptanol is an organic compound with a unique odor and chemical properties. Studies have shown that 5-methyl-2-heptanol possesses antibacterial activity and can be used to develop novel antibacterial drugs. It also functions as a pheromone in certain insects, and its application in pest control, such as trapping or disrupting mating behavior, is being investigated. Due to its distinctive aroma, 5-methyl-2-heptanol is also used in flavoring and is widely used in the food, beverage, and cosmetic industries. Because of its wide range of applications, the demand for 5-methyl-2-heptanol is substantial. Currently, the production of 5-methyl-2-heptanol mainly employs chemical synthesis methods; reports on the microbial production of 5-methyl-2-heptanol are relatively few.

[0003] 2-Decanol is a medium-chain fatty alcohol, currently mainly used in cosmetics, pesticide emulsifiers, and other fields. Studies have shown that 2-Decanol and its esters have inhibitory effects on pathogenic bacteria such as Staphylococcus aureus and can be used as antibacterial agents.

[0004] *Bacillus velezensis*, a novel species belonging to the genus *Bacillus*, is a Gram-positive aerobic bacterium with rod-shaped cells measuring 0.5 × (1.5–3.5) μm. It produces endospores and is widely distributed in nature, including water, soil, air, plant roots, plant surfaces, and animal intestines. Current research on *Bacillus velezensis* mainly focuses on its role in promoting plant and animal growth, antagonizing pathogens, inducing systemic resistance, identifying antibacterial substances and their gene clusters, and understanding its antagonistic mechanisms. Existing reports indicate that *Bacillus velezensis* exerts its antibacterial effects primarily through the secretion of lipopeptide antibiotics, polyketides, and antimicrobial proteins. However, there are no reports of *Bacillus velezensis* simultaneously producing 2-decyl alcohol and 5-methyl-2-heptanol. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a strain of Bacillus belyssus that produces 2-decyl alcohol and 5-methyl-2-heptanol and its applications.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a strain of Bacillus velezensis V328 that produces 2-decyl alcohol and 5-methyl-2-heptanol. This strain was deposited on March 3, 2025, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), with accession number CGMCCNo. 33695.

[0008] The main characteristics of Bacillus velezensis V328 of the present invention compared with those of previously reported Bacillus velezensis are as follows:

[0009] (1) It can produce high yields of 5-methyl-2-heptanol and 2-decanol;

[0010] (2) It has good antibacterial activity against special pathogens such as Fusarium equisetifolium (Fe), Fusarium graminearum (Fg), Fusarium pseudograminearum (Fp), Fusarium rotundifolium (Fs), Fusarium effusum (Fp), Fusarium acutatum, Fusarium fusiforme (Ff), and Fusarium moniliforme (Fm).

[0011] A second aspect of the invention provides the use of the aforementioned Bacillus velezensis V328 in the production of 2-decyl alcohol and 5-methyl-2-heptanol.

[0012] In a third aspect, the present invention provides a microbial agent containing the aforementioned Bacillus velezensis V328.

[0013] Preferably, the Bacillus velezensis V328 in the bacterial agent exists in the form of cultured live bacteria, bacterial suspension, or fermentation broth.

[0014] Furthermore, the bacterial suspension is prepared by the following method:

[0015] Bacillus velezensis V328 was inoculated into LB liquid medium and cultured in a constant temperature shaking incubator at 37°C and 180 rpm for 2-4 days. After centrifugation, the bacterial cells were collected and resuspended in sterile distilled water to prepare a bacterial suspension.

[0016] In a fourth aspect, the present invention provides the use of the above-mentioned Bacillus velezensis V328 or bacterial agent in the preparation of an antibacterial agent that inhibits the growth of pathogenic bacteria;

[0017] The pathogens are Fusarium oxysporum, Fusarium equisetifolium (Fe), Fusarium graminearum (Fg), Fusarium pseudograminearum (Fp), Fusarium rotundifolium (Fs), Fusarium lamellae (Fp), Fusarium acutatum, Fusarium fusiforme (Ff) and / or Fusarium moniliforme (Fm).

[0018] In a fifth aspect, the present invention provides the use of the above-mentioned Bacillus velezensis V328 or its inoculum in the prevention and control of maize root rot caused by Fusarium oxysporum.

[0019] In a sixth aspect, the present invention provides a method for preventing and controlling maize root rot, comprising the following steps:

[0020] Apply the above-mentioned microbial agent to the corn roots, irrigating each corn kernel with 20 ml.

[0021] A seventh aspect of the invention provides the use of 2-decyl alcohol and / or 5-methyl-2-heptanol in the preparation of antimicrobial agents that inhibit the growth of pathogenic bacteria; wherein the pathogenic bacteria are Fusarium oxysporum, Fusarium equisetifolium, Fusarium graminearum, Fusarium pseudograminearum, Fusarium rotundifolium, Fusarium effusum, Fusarium acutatum, Fusarium fusiforme, and / or Fusarium moniliforme.

[0022] In the above applications, preferably, the antibacterial agent is composed of 2-decyl alcohol and 5-methyl-2-heptanol in a mass ratio of 9:1.

[0023] The beneficial effects of this invention are:

[0024] (1) This invention is the first to isolate a strain of Bacillus velezensis that produces 2-decyl alcohol and 5-methyl-2-heptanol. This Bacillus velezensis was isolated from the rhizosphere soil of maize and is safe to use, thus realizing the green production and application of 2-decyl alcohol and 5-methyl-2-heptanol.

[0025] (2) The Bacillus velezensis of the present invention has a good antibacterial effect against a variety of pathogens and has broad-spectrum antibacterial activity.

[0026] (3) The active metabolites 2-decyl alcohol and 5-methyl-2-heptanol produced by Bacillus velezensis of the present invention have significant antibacterial activity against pathogens such as Fusarium oxysporum, Fusarium solani, Fusarium equisetifolium, Fusarium graminearum, Fusarium pseudograminearum, Fusarium moniliforme, Fusarium truncatum, Fusarium moniliforme, Fusarium moniliforme, and Fusarium acutatum. Attached Figure Description

[0027] Figure 1 The plate confrontation method was used to screen the antagonistic effects of various isolated strains on PDA plates.

[0028] Figure 2 Box plot of inhibition rate of each isolated strain screened by plate confrontation method.

[0029] Figure 3 Growth of strain V328 on LB plates.

[0030] Figure 4 Phylogenetic tree of strain V328 constructed based on 16S rDNA sequence.

[0031] Figure 5 Inhibitory effect of strain V328 on multiple pathogens.

[0032] Figure 6 Chromatograms and mass spectra of 2-decyl alcohol and 5-methyl-2-heptanol produced by strain V328; A: Chromatogram of 2-decyl alcohol, B: Mass spectrum of 2-decyl alcohol, the upper half of the image is the mass spectrum of 2-decyl alcohol in the V328 sample, and the lower half of the image is the theoretical mass spectrum of 2-decyl alcohol from the database, C: Chromatogram of 5-methyl-2-heptanol, D: Mass spectrum of 5-methyl-2-heptanol, the upper half of the image is the mass spectrum of 5-methyl-2-heptanol in the V328 sample, and the lower half of the image is the theoretical mass spectrum of 5-methyl-2-heptanol from the database.

[0033] Figure 7 Results of the determination of the contents of 2-decyl alcohol and 5-methyl-2-heptanol in the metabolites of strain V328.

[0034] Figure 8 Inhibitory effects of different concentrations of 2-decyl alcohol and 5-methyl-2-heptanol on Fusarium oxysporum.

[0035] Figure 9 The inhibitory effects of 2-decyl alcohol and 5-methyl-2-heptanol, and their mixture in a mass ratio of 9:1, on other pathogens.

[0036] Figure 10 : Control effect of strain V328 on maize root rot; CK represents the control group using sterile water, FO represents the diseased group treated with Fusarium oxysporum spore suspension, and V328 represents the treatment group treated with both Fusarium oxysporum spore suspension and biocontrol strain V328 bacterial suspension; A represents the phenotype of biocontrol effect in pot experiments, B represents a magnified view of maize root system in pot experiments, C represents plant height and root length in pot experiments, and D represents CAT, POD, and PPO enzyme activities 7 days after inoculation with the pathogen. Detailed implementation method:

[0037] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0038] To enable those skilled in the art to more clearly understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments. If specific experimental conditions are not specified in the embodiments, they are generally based on conventional conditions or conditions recommended by the reagent company; the reagents, consumables, etc. used in the following embodiments, unless otherwise specified, can be obtained commercially. Wherein:

[0039] Pathogenic fungi: Fusarium oxysporum, Fusarium equiseti, Fusarium graminearum, Fusarium pseudograminearum, Fusarium solani, Fusarium proliferatum, Fusarium ariumacutatum, Fusarium fujikuroi, and Fusarium moniliformeSheld are all existing pathogenic fungi, provided by the National Key Laboratory of Wheat Breeding, Shandong Agricultural University, and stored in the laboratory at -80℃.

[0040] Soil samples used for testing: Field soil samples were taken from the Science and Technology Innovation Park of Shandong Agricultural University and stored in a 4°C refrigerator in the laboratory.

[0041] Maize seeds: Maize B73 inbred line, provided by Shandong Agricultural University, stored in a low-temperature, low-humidity seed storage cabinet.

[0042] Potato Dextrose Agar (PDA) (1000mL): 6.0g potato extract, 20.0g grapes, 20.0g agar, bring to a final volume of 1000mL, and sterilize at 121℃ for 20min.

[0043] LB liquid medium (1000mL): 10.0g tryptone, 5.0g yeast extract, 10.0g sodium chloride, bring to a final volume of 1000mL, and sterilize at 121℃ for 20min.

[0044] Potato glucose aqueous culture medium (PDB) (1000mL): 6.0g potato extract powder, 20.0g grapes, bring to a final volume of 1000mL, and sterilize at 121℃ for 20min.

[0045] The preparation steps for the pathogenic bacteria suspension are as follows: The pathogenic bacteria are inoculated onto PDA agar medium and activated by incubation at 28℃ for 7 days. Activated bacterial cakes are collected using a 6mm diameter colony punch and placed in 1000mL of potato dextrose syrup medium. The medium is then shaken and incubated on a shaker at 180r / min and 28℃ for 7 days. The fermentation broth is filtered to remove mycelia. The filtrate is then centrifuged at 5000r / min for 10 minutes. The spores are then resuspended in sterile water and the solution is adjusted to a final concentration of 10000 rpm. 6 CFU / ml.

[0046] 2-Decanol and 5-Methyl-2-heptanol were purchased from Shanghai Maclean Biochemical Technology Co., Ltd.; CAS number of 2-Decanol: 1120-06-5, CAS number of 5-Methyl-2-heptanol: 54630-50-1.

[0047] Example 1: Isolation and Identification of Strains

[0048] 1. Isolation of bacterial strains:

[0049] Field soil and vermiculite were mixed at a 1:1 volume ratio. The field soil was sourced from the Shandong Agricultural University Science and Technology Innovation Park (36°94′N, 117°95′E). Corn was planted in a light incubator (China Xuneng) at a temperature of 28℃ / 25℃, a humidity of 30%, and a photoperiod of 16 hours of light / 8 hours of darkness. At the two-leaf-one-heart stage of the corn, a suspension of Fusarium oxysporum spores was inoculated, and rhizosphere soil was collected after 21 days of cultivation. The bacterial strain was isolated and purified from the rhizosphere soil using a dilution-spreading method.

[0050] A 6mm PDA bacterial cake containing 7-day-old *Fusarium oxysporum* was placed in the center of a PDA plate. Then, a strain purified from rhizosphere soil was placed 25mm from the center. This process was repeated three times. The plates were incubated upside down at 28°C for 6 days. The radial growth of *Fusarium oxysporum* in the control and experimental groups was measured. The inhibition rate of the isolated bacteria on the radial growth of *Fusarium oxysporum* was calculated as follows:

[0051] Inhibition rate = [(Coronavirus diameter of control group - Coronavirus diameter of treatment group) / Coronavirus diameter of control group] × 100%.

[0052] Candidate antagonistic bacteria were screened by evaluating the inhibition rate of each isolated bacterial strain against Fusarium oxysporum.

[0053] The antagonistic effects of each isolated strain on PDA are as follows: Figure 1 As shown; the calculated results of the inhibition rates of each isolated strain against Fusarium oxysporum are as follows. Figure 2 As shown. The strain V328, with the best antibacterial effect, was selected as the candidate biocontrol strain.

[0054] 2. Identification of the strain:

[0055] (1) Morphological identification:

[0056] Morphological observation of strain V328 was performed, and the results are as follows: Figure 3 As shown, the single colonies of strain V328 are round with a rough surface.

[0057] (2) Molecular biological identification:

[0058] The 16S rDNA of biocontrol bacterium V328 was amplified using universal primers (27-F: AGAGTTTGATCCTGGCTCAG, 1492-R: TACGACTTAACCCCAATCGC), and its nucleotide sequence is shown in SEQ ID No. 1. Species identification was performed using Ezbiocloud (https: / / www.ezbiocloud.net / ), and a phylogenetic tree was constructed using MEGA (v6.0). The results are as follows: Figure 4 As shown.

[0059] Based on the combined morphological and molecular biological identification results, strain V328 was identified as *Bacillus velezensis*. The isolated *Bacillus velezensis* V328 was deposited at the China General Microbiological Culture Collection Center, with the following deposit information:

[0060] Referenced biological material (strain): V328;

[0061] Suggested classification and nomenclature: Bacillus velezensis;

[0062] Registration number: CGMCCNo.33695;

[0063] Preservation date: March 3, 2025.

[0064] Example 2: Investigation of the antibacterial activity of Bacillus belyssus V328

[0065] The antibacterial effect of *Bacillus belyssus* V328 against *Fusarium equisetifolium*, *Fusarium graminearum*, *Fusarium pseudograminearum*, *Fusarium solani*, *Fusarium solani*, *Fusarium moniliforme*, *Fusarium acutatum*, *Fusarium fuciformis*, and *Fusarium moniliforme* was investigated using the plate confrontation method. The method is as follows:

[0066] Place a 6mm PDA cake containing 7-day-old pathogens in the center of a PDA plate. Then place Bacillus belye V328 at a distance of 25mm from the center. Repeat this process 3 times. Incubate the plates at 28°C with the plates inverted for 6 days.

[0067] The results are as follows Figure 5As shown in the figure. The results indicate that Bacillus belye V328 has antibacterial activity against a variety of pathogens.

[0068] Example 3: Identification and Activity Study of Key Metabolites of Bacillus belyssus V328

[0069] 1. Identification of key metabolites:

[0070] After activating the Bacillus belye V328 glycerol tubes, inoculate them into LB liquid medium at a volume ratio of 1%. Incubate at 37°C and 180 rpm for 3 days in a constant temperature shaking shaker. Centrifuge at 10,000 rpm for 10 minutes, collect the supernatant, filter the supernatant through a 0.22 μm filter membrane, and collect the filtrate as the supernatant for the fermentation of biocontrol bacterium V328, labeled as V328.

[0071] Another strain of Bacillus belye preserved in the laboratory was used to prepare the fermentation supernatant of the filtered bacteria using the same method described above, and labeled as NCK. LB liquid medium was used as a blank control and labeled as CK.

[0072] Samples of CK, NCK, and V328 were sent to Suzhou Panomics Biotechnology Co., Ltd. for metabolomics analysis. 1.0 mL of sample was placed in a 20 mL headspace vial; 10 μL of internal standard solution was added to the sample; the transferred sample was incubated at 60 °C for 10 min; before sample adsorption, the SPME extraction head was aged at 270 °C for 10 min; the aged SPME extraction head was transferred to the incubation chamber and the sample was adsorbed at 60 °C for 15 min; after adsorption, the SPME extraction head was transferred to the GC injection port and desorbed at 250 °C for 5 min; after injection, the SPME extraction head was aged at 270 °C for 10 min. 10 μL of n-alkane was placed in a 20 mL headspace vial for extraction and injection. The LECOPegasus BT 4D (LECO, St. Joseph, MI, USA) GC×GC-TOF-MS chromatographic system consists of an Agilent 8890A gas chromatograph (Agilent Technologies, Palo Alto, CA, USA), a two-stage jet modulator, and a split / splitless injection module. The mass spectrometry system is a high-resolution TOF mass spectrometer. The separation system is a DB-HeavyWax (30m × 250μm × 0.5μm) (Agilent, USA) column. High-purity helium is used as the carrier gas at a constant flow rate of 1.0 mL / min. The DB-Heavy Wax (30m × 250μm × 0.5μm) column was initially heated to 50℃ for 2 min, then increased to 240℃ at a rate of 5℃ / min and held for 5 min. The LECOPegasus BT 4D mass spectrometer detector (LECO, St. Joseph, MI, USA) has a mass transfer line temperature of 250°C, an ion source temperature of 250°C, a acquisition rate of 10 spectra / s, an electron impact source of 70 eV, a detector voltage of 1960 V, and a mass spectrometry scan range of 35-550 m / z.

[0073] A data matrix containing information such as CAS number (chemical abstracts service), molecular formula, retention time (rt), and peak area was obtained through annotation from the NIST 2022 database (https: / / webbook.nist.gov / chemistry / ). Missing values ​​in the original data were simulated (missing value recoding), and the minimum value halving method was used for imputation. To enable comparison of data of different magnitudes, internal standard normalization of the peak area was performed.

[0074] Metabolomics analysis identified two active ingredients: 2-decyl alcohol and 5-methyl-2-heptanol. Figure 6 The contents of 2-decyl alcohol and 5-methyl-2-heptanol in the metabolites were determined, and the results are as follows: Figure 7 As shown, the results indicate that Bacillus belye V328 can produce 2-decyl alcohol and 5-methyl-2-heptanol.

[0075] 2. Activity assessment of 2-decyl alcohol and 5-methyl-2-heptanol:

[0076] (1) Antibacterial effect against Fusarium oxysporum:

[0077] The antibacterial effect of 2-decyl alcohol at different concentrations (0 mg / ml, 1 mg / ml, 3 mg / ml, 5 mg / ml) on Fusarium oxysporum was investigated using the plate confrontation method.

[0078] The antibacterial effect of different concentrations (0 mg / ml, 0.05 mg / ml, 0.25 mg / ml, 0.5 mg / ml) of 5-methyl-2-heptanol on Fusarium oxysporum was investigated using the plate confrontation method.

[0079] The results are as follows Figure 8 And as shown in Tables 1 and 2.

[0080] Table 1: Inhibition rate of 5-methyl-2-heptanol against Fusarium oxysporum

[0081] Treatment concentration 0.05mg / ml 0.25mg / ml 0.5mg / ml Antibacterial rate 9.42％ 64.24％ 91.60％

[0082] Table 2: Antibacterial rate of 2-decyl alcohol against Fusarium oxysporum

[0083] Treatment concentration 1mg / ml 3mg / ml 5mg / ml Antibacterial rate 77.06％ 80.09％ 87.00％

[0084] The results showed that 2-decyl alcohol and 5-methyl-2-heptanol both had good antibacterial effects against Fusarium oxysporum.

[0085] (2) Antibacterial effect against other Fusarium species:

[0086] The effect of 2-decyl alcohol on other Fusarium species was investigated by adding 20 mg of 2-decyl alcohol to 20 ml of PDA medium using a pipette and shaking well to prepare a 0.5 mg / ml PDA medium. Using the PDA medium as a control, other Fusarium mycelial cakes (6 mm in diameter) were picked up with an inoculation needle and inoculated onto the prepared plate in a clean bench, ensuring that the mycelial side was facing down.

[0087] The effect of 5-methyl-2-heptanol on other Fusarium species was investigated by adding 10 mg of 5-methyl-2-heptanol to 20 ml of PDA medium using a pipette and shaking thoroughly to prepare a 0.5 mg / ml PDA medium. Using the PDA medium as a control, other Fusarium mycelial cakes (6 mm in diameter) were picked up with an inoculation needle and inoculated onto the prepared agar plate in a clean bench, ensuring the mycelial side was facing down.

[0088] Since Bacillus belye V328 can simultaneously produce 2-decyl alcohol and 5-methyl-2-heptanol, the antibacterial effect of the combination of 2-decyl alcohol and 5-methyl-2-heptanol was further investigated.

[0089] 2-Decanol and 5-methyl-2-heptanol were mixed at a mass ratio of 9:1, and the mixture was added to PDA medium to prepare a PDA medium with a concentration of 0.5 mg / ml; the PDA medium was used as a control. In a clean bench, other Fusarium mycelial cakes (6 mm in diameter) were picked up with an inoculation needle and inoculated into the above-prepared plates, ensuring that the mycelial side was facing down.

[0090] The antagonistic effects of 2-decyl alcohol and 5-methyl-2-heptanol on other Fusarium species are as follows: Figure 9 As shown in Table 3.

[0091] Table 3: Inhibition rates of 2-decyl alcohol and 5-methyl-2-heptanol, and their mixture at a mass ratio of 9:1, against other Fusarium species.

[0092]

[0093] The results showed that 2-decyl alcohol and 5-methyl-2-heptanol also had good antibacterial effects against various other Fusarium species. When 2-decyl alcohol and 5-methyl-2-heptanol were used in combination at the same concentration, their antibacterial effects against *Fusarium acutatum*, *Fusarium moniliforme*, *Fusarium solani*, and *Fusarium pseudograss* were significantly better than those of 2-decyl alcohol and 5-methyl-2-heptanol alone, demonstrating a synergistic effect.

[0094] Example 4: Control of maize root rot by Bacillus belyceta var. ...

[0095] 1. Test method:

[0096] Bacillus belye V328 bacterial suspension was inoculated into LB broth at a rate of 1% (v / v) and cultured at 37°C with shaking at 180 rpm for 3 days. The bacterial cells were collected by centrifugation at 5000 rpm for 3 min, resuspended in sterile water, and the absorbance was adjusted to OD using a spectrophotometer. 600 =1, and a suspension of Bacillus vesiculosus V328 was prepared.

[0097] Germinate the corn seeds, then put vermiculite into a small plastic pot. After the corn seeds germinate, select seeds with uniform growth and plant them in a light incubator (China Xuneng). The incubation temperature is 28℃ / 25℃, the humidity is 30%, and the photocycle is 16 hours of light / 8 hours of darkness.

[0098] Select corn seedlings with basically uniform growth and perform the following treatment:

[0099] CK: Inoculate the roots with 20ml of sterile water at the two-leaf-one-heart stage of corn;

[0100] FO: At the two-leaf-one-heart stage of corn, inoculate the roots with a 10ml spore suspension of Fusarium oxysporum, using 10ml of a 10% concentration per corn plant. 6 CFU / ml Fusarium oxysporum spore suspension;

[0101] V328: During the two-leaf-one-heart stage of corn, the roots are simultaneously inoculated with Fusarium oxysporum spore suspension and Bacillus vesiculosus V328 bacterial suspension: 10 ml of 10% concentration is inoculated per corn plant. 6 Inoculate 20 ml of Bacillus vesiculosus V328 bacterial suspension with a CFU / ml Fusarium spore suspension.

[0102] Other treatment conditions were kept consistent across all treatment groups. Seven days after inoculation with the pathogen, the activities of CAT, POD, and PPO enzymes were measured. After 21 days of culture, plant height and root length were recorded and root phenotypes were photographed.

[0103] 2. Test Results:

[0104] result Figure 10 As shown, the corn roots in the pathogen-inoculated group exhibited browning, rot, and severely inhibited root growth, specifically with significantly shorter root lengths compared to the control group. However, the corn roots in the treatment group showed no pathological changes and exhibited normal morphology and structure. Furthermore, their root lengths were not significantly different from the control group (CK) and were significantly longer than the FO group (Tukey's multiple comparisons test, P<0.05). These pot experiment results indicate that biocontrol agent V328 can significantly improve corn root browning and rot induced by Fusarium oxysporum and can significantly alleviate root growth inhibition caused by Fusarium oxysporum.

[0105] The biocontrol agent V328 of this invention can significantly reduce the severity of plant root rot, indicating that biocontrol agent V328 has a preventive or control effect on maize root rot caused by Fusarium oxysporum.

[0106] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A strain of Bacillus belye ( Bacillus velezensis V328, with accession number CGMCCNo.33695.

2. The Bacillus velezensis of claim 1, Bacillus velezensis ) V328 for the production of 2-decanol and 5-methyl-2-heptanol.

3. A microbial agent, characterized in that, The bacterial agent contains the Bacillus belye as described in claim 1 ( Bacillus velezensis V328.

4. The microbial agent according to claim 3, characterized in that, The bacterial agent contains Bacillus belye (B. belye). Bacillus velezensis V328 exists in the form of cultured live bacteria, bacterial suspension, or fermentation broth.

5. The microbial agent according to claim 4, characterized in that, The bacterial suspension was prepared by the following method: Bacillus berberis ( Bacillus velezensis V328 was inoculated into LB liquid medium and cultured in a constant temperature shaking incubator at 37°C and 180 rpm for 2-4 days. After centrifugation, the bacterial cells were collected and resuspended in sterile distilled water to prepare a bacterial suspension.

6. The Bacillus belesiensis as described in claim 1 ( Bacillus velezensis The use of the bacterial agent described in V328 or claim 3 in the preparation of a bacteriostatic agent that inhibits the growth of pathogenic bacteria; The pathogens are *Fusarium oxysporum*, *Fusarium equisetifolium*, *Fusarium graminearum*, *Fusarium pseudograminearum*, *Fusarium rotundifolium*, and *Fusarium moniliforme*. Fusarium acutatum, Fusarium fusiforme and / or Fusarium moniliforme.

7. The Bacillus belesiensis as described in claim 1 ( Bacillus velezensis V328 or the fungal agent according to claim 3 is effective in preventing and controlling fungal infections caused by Fusarium oxysporum (V328 or V328). Fusarium oxysporum Application in corn root rot caused by ) 8. A method for controlling corn root rot, characterized in that, Includes the following steps: The microbial agent of claim 5 is applied to the corn root system.

Images