Application of circ0042819 in diagnosis and treatment of multiple myeloma
Through the detection and inhibition application of circ_0042819, the early diagnosis and treatment problems of multiple myeloma were solved, and the diagnosis and treatment effect of specific and highly expressed biomarkers in multiple myeloma was achieved, which significantly improved the prognosis of patients.
Patent Information
- Application Number
- CN202510562845.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art lacks effective multiple myeloma molecular markers, resulting in poor prognosis of treatment methods, prone to recurrence of the disease, and lack of early diagnosis and effective treatment methods.
circ_0042819 is used as a biomarker to diagnose multiple myeloma by detecting its expression level, and to treat multiple myeloma by inhibiting its expression. The expression of circ_0042819 is downregulated using shRNA or recombinant expression vectors to inhibit cell proliferation and promote cell death.
circ_0042819 is specifically highly expressed in multiple myeloma and can be used as a marker for diagnosis and prognosis evaluation. Downregulating its expression can effectively inhibit cell proliferation and promote cell death, and improve the therapeutic effect of multiple myeloma.
Smart Images

Figure CN120442794A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biological detection technology and relates to the application of circ_0042819 as a biomarker for multiple myeloma, and specifically to the application of circ_0042819 in the preparation of diagnostic reagents or kits and therapeutic pharmaceutical compositions for multiple myeloma. Background Art
[0002] Multiple myeloma (MM) is a common hematologic malignancy, ranking second in incidence among hematologic malignancies. It typically develops as a result of abnormal proliferation of plasma cells that produce excessive amounts of monoclonal immunoglobulins. Normal bone marrow is replaced by myeloma cells, leading to anemia, bone destruction, and renal impairment. Treatment options for MM include chemotherapy, radiotherapy, targeted therapy, and bone marrow transplantation, but the overall prognosis remains poor and the disease is prone to relapse. Therefore, identifying novel molecular markers for MM is crucial for improving patient survival and outcomes.
[0003] Circular RNA (circRNA) is a special type of non-coding RNA with a closed circular structure and no 5' cap or 3' poly (A) tail. It has multiple functions, such as acting as a miRNA sponge to regulate gene expression and participate in transcriptional and post-transcriptional regulation. Rapid progress has been made in tumor research, and a large number of studies have found that it is abnormally expressed in different tumors. For example, some circRNAs are upregulated in tumor tissues and can promote tumor cell proliferation, migration and invasion (Jun Zhang et al., CircRNA as an Achilles heel of cancer: characterization, biomarker and therapeutic modalities. J Transl Med. 2024;22(1):752.). Therefore, circRNA is expected to become a new biomarker and therapeutic target for tumor diagnosis, bringing new opportunities and challenges to tumor research and clinical treatment.
[0004] Circ_0042819 is a novel circRNA that has not yet been reported in tumors, particularly multiple myeloma. Whether Circ_0042819 expression is abnormal in multiple myeloma and whether it regulates the proliferation and cell death of multiple myeloma cells remains unclear. Summary of the Invention
[0005] The present invention is based on the above-mentioned research and aims to provide a biomarker for the diagnosis of multiple myeloma. It also aims to provide a new use of circ_0042819, namely, its use in the preparation of a diagnostic kit or therapeutic pharmaceutical composition for multiple myeloma.
[0006] The biomarker circ_0042819 is a circRNA, and the corresponding DNA nucleotide sequence is:
[0007] GCGATCTCCAACAGCATCTCCAAGCAATGTTTCATTTTACTCCGCCCAGAAGACAACATCAGGCTGGCTGTAAGACTGGAAAGTACTTACCAGAATCGAACACGCTATATGGTAGTGGTTTCAACTAATGGTAGACAAGACACTGAAGAAAGCATCGTCCTA GGAATGGATTTCTCCTCTAATGACAGTAGCACTTGTACCATGGGCTTAGTTTTGCCTCTCTGGAGCGACACGCTAATTCATTTGGATGGTGATGGTGGGTTCAGTGTATCGACGGATAACAGAGTTCACATATTCAAACCTGTATCTGTGCAGGCAATGTG (SEQ ID NO.1)
[0008] The present invention first analyzed the expression of circ_0042819 in multiple myeloma cell lines and tumor tissues through expression and survival analysis. The results showed that circ_0042819 is specifically highly expressed in multiple myeloma, and its high expression is associated with a poor prognosis in multiple myeloma, making it an independent prognostic factor for multiple myeloma patients. Next, the expression of circ_0042819 in multiple myeloma cells was inhibited, and the proliferation and cell death abilities of multiple myeloma cells were examined. The value of circ_0042819 in the precise diagnosis and treatment of multiple myeloma was analyzed. The results showed that downregulating circ_0042819 inhibited the proliferation of multiple myeloma cells and promoted the cell death of multiple myeloma cells. This provides a potential target for the clinical treatment of multiple myeloma and provides an effective molecule for diagnosis, treatment, and prognostic assessment.
[0009] Specifically, the present invention provides the following technical solutions:
[0010] In a first aspect, the present invention provides the use of circ_0042819 as a diagnostic marker. Specifically, the present invention provides the use of a reagent for detecting circ_0042819 in the preparation of a product for diagnosing or assisting diagnosis of multiple myeloma, or a product for prognostic assessment or assisting prognostic assessment of multiple myeloma.
[0011] Preferably, the reagent for detecting circ_0042819 is a reagent for detecting the expression level of circ_0042819 in a biological sample at the gene level; the kit contains the reagent for detecting the expression level of circ_0042819 in a biological sample.
[0012] More preferably, the reagent for detecting the expression of circ_0042819 in a biological sample comprises PCR primers that are specific for the circ_0042819 gene. The PCR primers that are specific for the circ_0042819 gene are shown in SEQ ID NOs. 2-3, and the primer sequences for the control GAPDH are shown in SEQ ID NOs. 4-5.
[0013] In a second aspect, the present invention provides a product comprising the above-mentioned substance for detecting circ_0042819, wherein the product has any one or more of the following uses: diagnosis or auxiliary diagnosis of multiple myeloma; prognosis assessment or auxiliary prognosis assessment of multiple myeloma.
[0014] The product is preferably a kit for detecting at the gene level, which is composed of a reverse transcription system, a primer system, and an amplification system. The primer system includes PCR primers as shown in SEQ ID NOs. 2-3 and SEQ ID NOs. 4-5:
[0015] circ_0042819-F primer: CTGGAGCGACACGCTAATTC (SEQ ID NO. 2);
[0016] circ_0042819-R primer: TGTTGGAGATCGCCACATTG (SEQ ID NO. 3);
[0017] GAPDH-F primer: CTTAGCACCCCTGGCCAAG (SEQ ID NO.4);
[0018] GAPDH-R primer: TGGTCATGAGTCCTTCCACG (SEQ ID NO. 5).
[0019] Furthermore, the biological sample is selected from any one of tumor tissue obtained by puncture or circulating tumor cells collected from the patient's blood. By collecting and detecting the level of circ_0042819 in tumor tissue or cells, early diagnosis and prognosis assessment can be achieved.
[0020] A third aspect of the present invention provides the use of circ_0042819 as a therapeutic target, and specifically provides the use of inhibiting or silencing circ_0042819 in the preparation of a drug for treating multiple myeloma.
[0021] Preferably, the substance that inhibits or silences circ_0042819 is shRNA that inhibits the expression of circ_0042819 or a recombinant expression vector or transgenic cell line containing the shRNA. The oligomerized single-stranded DNA is annealed into a double-stranded DNA. The double-stranded shRNA oligo sequence is as follows:
[0022] GATCCGCAATGTGGCGATCTCCAACACTCGAGTGTTGGAGATCGCCACATTGCTTTTTT (SEQ ID NO. 6);
[0023] AATTAAAAAAGCAATGTGGCGATCTCCAACACTCGAGGTGTTGGAGATCGCCACATTGCG (SEQ ID NO. 7).
[0024] In a fourth aspect, the present invention provides a pharmaceutical composition for treating multiple myeloma, comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient comprises a shRNA that inhibits the expression of circ_0042819 or a recombinant expression vector or a transgenic cell line comprising the shRNA, wherein the sequence of the shRNA is shown in SEQ ID NOs. 6-7.
[0025] The fifth aspect of the present invention provides a product comprising at least one of the second aspect, the third aspect and the fourth aspect. The product has at least one function among (1) to (3):
[0026] (1) Diagnosis and / or prevention of multiple myeloma;
[0027] (2) Inhibit the proliferation of multiple myeloma cells;
[0028] (3) Promote cell death in multiple myeloma cells.
[0029] The multiple myeloma cells are LP-1 and RPMI-8226 cells.
[0030] Compared with the prior art, the present invention has the following beneficial effects:
[0031] The present invention discloses the application of a novel circRNA, circ_0042819, in the diagnosis and treatment of hepatocellular carcinoma. This biomarker is a novel circRNA, and its corresponding DNA nucleotide sequence is shown in SEQ ID NO. 1. This novel circRNA is stably circularized in multiple myeloma and is significantly highly expressed in multiple myeloma.
[0032] This invention discloses for the first time the application of circ_0042819 in the diagnosis or prognostic assessment of multiple myeloma. By analyzing the relationship between circ_0042819 and disease progression, it is known that circ_0042819 can be used as a marker for the diagnosis and prognostic assessment of multiple myeloma.
[0033] This invention discloses for the first time the application of inhibiting circ_0042819 in the prevention and treatment of multiple myeloma. By targeted downregulation of circ_0042819 expression in multiple myeloma, the proliferation ability of multiple myeloma cells can be inhibited and tumor cell death can be promoted, ultimately improving or treating multiple myeloma.
[0034] The present invention also provides shRNA targeting circ_0042819 and a recombinant expression vector or transgenic cell line containing the same. By constructing a lentivirus that targets and interferes with the novel circ_0042819 and transfecting multiple myeloma cells, it has been confirmed that the lentivirus carrying the specific interference sequence can stably knock down the expression of circ_0042819 in multiple myeloma cells, inhibit the proliferation ability of multiple myeloma cells, and promote tumor cell death, ultimately improving or treating multiple myeloma.
[0035] In terms of detection technology, the detection of circ_0042819 is essentially a quantitative PCR test based on the expression of blood cell genes. It is characterized by ease of use, sensitivity, good specificity, and high reproducibility, and is increasingly being used in clinical testing. The basic detection method used in this paper is real-time fluorescence quantitative PCR, which has high sensitivity and accuracy, is widely used clinically, and has a well-established testing technology.
[0036] In terms of efficacy, the marker circ_0042819 involved in this study is specifically and significantly expressed in the bone marrow of multiple myeloma patients (P < 0.05), suggesting its potential as a diagnostic and / or prognostic marker for multiple myeloma. Downregulation of circ_0042819 can inhibit the proliferation of multiple myeloma cells and promote their cell death. Therefore, its clinical reference value and credibility are high, and it possesses significant clinical significance and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 The structural identification of circ_0042819 as a circular RNA is shown: A is the chromosomal genomic location of circ_0042819 and a schematic diagram of its circularization; B is the sequencing result of the circ_0042819 linker sequence; C is the circularization detection of circ_0042819.
[0038] Figure 2 Figure 3 shows circ_0042819 as a diagnostic and / or prognostic marker for multiple myeloma: A shows the expression of circ_0042819 in 60 multiple myeloma patients and 50 healthy controls; B shows the progression-free survival of 30 multiple myeloma patients.
[0039] Figure 3 It shows that downregulation of circ_0042819 can inhibit the proliferation of multiple myeloma cells and promote the death of multiple myeloma cells: A is the detection of circ_0042819 expression level in multiple myeloma cells (LP-1, RMPI-8226) transfected with lentiviral vector constructed by circ_0042819 interference; B is the proliferation of multiple myeloma cells after downregulation of circ_0042819; C is the death of multiple myeloma cells after downregulation of circ_0042819. DETAILED DESCRIPTION
[0040] The present invention will be described in detail below with reference to the embodiments and the accompanying drawings, but the implementation of the present invention is not limited thereto.
[0041] All reagents and starting materials used in the present invention are commercially available or can be prepared according to literature methods. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed according to conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to conventional conditions or conditions recommended by the manufacturer.
[0042] Example 1: Structural Identification of circ_0042819 as a Circular RNA
[0043] circRNA has a stable circular structure, while mRNA does not have this feature. Treatment with the nuclease exonuclease RNase R can degrade most mRNA, but it is difficult to degrade circRNA. The above principle was used to detect the stability of circRNA and its parent gene mRNA. The specific method is as follows: refer to the kit instructions, use the RNA extraction kit to extract total RNA from human cells or tissues, add RNase R (4U / uL) to the total RNA, digest it at 37°C for 15 minutes, and obtain cDNA using the reverse transcription kit. Design divergent primers and convergent primers for circ_0042819 to PCR amplify the cDNA obtained above. The amplified product was subjected to agarose gel electrophoresis. The reverse transcription system and conditions are shown in Table 1 below (Acryl Reverse Transcription Kit):
[0044] Table 1 Reverse transcription system
[0045]
[0046] The reverse transcription reaction conditions were: 37°C, 15 min; 85°C, 5 s; 4°C, .
[0047] The PCR system and conditions are shown in Table 2 below (PCR kit from Acryl).
[0048] Table 2 PCR system
[0049]
[0050] Amplification conditions were: 98°C for 10 s, 60°C for 15 s, and 68°C for 1 min. These three steps were repeated for 40 cycles.
[0051] The primer sequences used in the PCR reaction are shown in Table 3:
[0052] Table 3 PCR primer sequences
[0053]
[0054] The results showed that both circ_0042819 and the linear parent gene mRNA could be amplified in cDNA using convergent primers, while divergent primers could specifically amplify circRNA from cDNA, confirming that the target DNA fragment sequence can be transcribed to form the circRNA described in the present invention: circ_0042819, and circ_0042819 can resist digestion by RNaseR.
[0055] Example 2: circ_0042819 as a diagnostic and / or prognostic marker for multiple myeloma
[0056] To clarify the expression and specificity of circ_0042819 in multiple myeloma, we used real-time quantitative reverse transcription-PCR (qRT-PCR) to detect circ_0042819 expression in 60 normal control samples and 50 samples from multiple myeloma patients. Tumor specimens from all patients were confirmed as having multiple myeloma by a pathologist. The reverse transcription system and conditions are shown in Table 1. The RT-PCR system and conditions are shown in Table 4 (RT-PCR kit from Acryl).
[0057] Table 4 RT-PCR system
[0058]
[0059] Amplification conditions were as follows: 94°C for 30 s, 55-60°C for 30 s, and 72°C for 1 min. These three steps were repeated for 40 cycles.
[0060] The primer sequences used in the PCR reaction are shown in Table 5:
[0061] Table 5 qRT-PCR primer sequences
[0062]
[0063] Subsequently, survival curve analysis of multiple myeloma patients was performed to evaluate whether circ_0042819 could be used as an independent prognostic factor. The median expression of circ_0042819 was used as the cut-off value (HTseq-Count) for the two groups (low expression and high expression) of circ_0042819 in multiple myeloma samples.
[0064] The results are as follows Figure 2 As shown, the results showed that the expression of circ_0042819 in multiple myeloma patients was higher than that in normal controls ( Figure 2 A) Combined with the overall survival analysis results of multiple myeloma patients, patients with high expression of circ_0042819 had a shorter progression-free survival compared with patients with low expression of circ_0042819 ( Figure 2 B) High expression of circ_0042819 was found to be associated with poor prognosis in multiple myeloma and was an independent prognostic factor for multiple myeloma patients.
[0065] Example 3: Downregulation of circ_0042819 can inhibit the proliferation of multiple myeloma cells and promote the death of multiple myeloma cells
[0066] To further clarify the function and mechanism of circ_0042819 in the progression of multiple myeloma, we first constructed the sh-circ_0042819 plasmid and packaged it with lentivirus. The oligo single-stranded DNA was annealed into a double-stranded shRNA oligo sequence:
[0067] GATCCGCAATGTGGCGATCTCCAACACTCGAGTGTTGGAGATCGCCACATTGCTTTTTT (SEQ ID NO. 6);
[0068] AATTAAAAAAGCAATGTGGCGATCTCCAACACTCGAGGTGTTGGAGATCGCCACATTGCG (SEQ ID NO. 7).
[0069] The cells to be tested were infected with the relevant lentivirus (MOI = 50). After 24 hours of infection, the culture medium was replaced with new complete medium and cultured for another 24 hours. Stable transfectants were selected with 5 μg / ml puromycin. The cells were collected and the efficiency of downregulating circ_0042819 was detected by RT-PCR ( Figure 3 A) The results showed that the downregulation efficiency of circ_0042819 was approximately 40%-50%, indicating that the shRNA-circ_0042819 stable transfectant was successfully constructed.
[0070] Afterwards, we used the CCK8 method to detect the effect of circ_0042819 on the proliferation of multiple myeloma cells.
[0071] The CCK8 detection method is as follows:
[0072] 100 μl of the cell suspension to be tested in each group was collected and inoculated into a 96-well plate, with 2,000 cells per well. 10 μl of CCK-8 reagent was added to the wells at 0, 12, 24, 36, 48, 60, 72, and 96 hours after infection. The plates were incubated at 37°C in the dark for 1 hour. The absorbance was measured at 450 nm.
[0073] The CCK8 assay results showed that after downregulating circ_0042819, the proliferation rate of multiple myeloma cells slowed down significantly ( Figure 3 B), indicating that high expression of circ_0042819 can promote the proliferation of multiple myeloma cells.
[0074] Next, we used cell staining and flow cytometry to detect the effect of circ_0042819 on multiple myeloma cell death. The steps are as follows:
[0075] Following the previously described method to downregulate circ_0042819 in multiple myeloma cells, we harvested the cells and washed them twice with PBS. The cell suspension was then transferred to flow cytometry tubes. 0.5–1 μl of SYTOX™ Green nucleic acid stain was added to each tube and briefly vortexed. The cells were then incubated at room temperature in the dark for 30 minutes. Following the incubation period, 400 μl of PBS was added to each tube, and the cells were analyzed using flow cytometry.
[0076] Flow cytometry results showed that compared with the control group, the cell death in the circ_0042819 down-regulation group was more, further indicating that down-regulation of circ_00428194 could promote the death of multiple myeloma cells ( Figure 3 C).
[0077] These results indicate that circ_0042819, a circular RNA with a stable ring structure, is specifically overexpressed in multiple myeloma. Its high expression is associated with poor prognosis in multiple myeloma and serves as an independent prognostic factor for multiple myeloma patients. Downregulating circ_0042819 inhibits the proliferation of multiple myeloma cells and promotes their cell death. These results suggest a close correlation between circ_0042819 and the development and progression of multiple myeloma tumors, suggesting its potential use as a biomarker for tumor diagnosis, treatment selection, and prognostic assessment.
[0078] Any undescribed parts of the present invention are the same as or implemented using existing technologies. The applicant declares that the present invention uses the above-mentioned embodiments to illustrate the detailed methods of the present invention, but the present invention is not limited to the above-mentioned detailed methods, that is, it does not mean that the present invention must rely on the above-mentioned detailed methods to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary ingredients, selection of specific methods, etc., all fall within the scope of protection and disclosure of the present invention.
Claims
1. Use of a reagent for detecting the expression level of circ_0042819 in the preparation of a multiple myeloma diagnosis or prognosis assessment kit, characterized in that: The nucleic acid sequence of circ_0042819 is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that The reagent for detecting the expression level of circ_0042819 is a reagent for detecting the expression amount of circ_0042819 in a biological sample at the gene level; the kit contains a reagent for detecting the expression amount of circ_0042819 in a biological sample.
3. The use according to claim 2, characterized in that The reagent for detecting circ_0042819 in a biological sample is selected from one or more detection techniques or methods: in situ hybridization, Northern blot, RT-PCR, and real-time quantitative PCR.
4. The use according to claim 3, characterized in that The reagent for detecting the expression level of circ_0042819 in a biological sample comprises PCR primers, nucleic acid membrane strips or preparations that are specific for detecting the circ_0042819 gene.
5. The use according to claim 4, characterized in that The PCR primer sequences that are specific for detecting the circ_0042819 gene are shown in SEQ ID NOs. 2-3.
6. A multiple myeloma diagnosis, treatment or prognosis assessment kit, characterized in that: The kit contains reagents for detecting the content of circ_0042819 in biological samples.
7. The kit according to claim 6, characterized in that The kit is composed of a reverse transcription system, a primer system and an amplification system. The primer system includes PCR primers shown as SEQ ID NOs. 2-3 and SEQ ID NOs. 4-5.
8. Use of substances that inhibit or silence circ_0042819 in the preparation of products for the treatment of multiple myeloma.
9. The use according to claim 8, characterized in that The substance that inhibits or silences circ_0042819 is an RNA interference molecule or antisense oligonucleotide, a small molecule inhibitor, or a substance that implements lentiviral vector infection or gene knockout that inhibits the expression of circ_0042819. The DNA nucleotide sequence corresponding to the shRNA is shown in SEQ ID NO. 6~7.
10. A pharmaceutical composition for treating multiple myeloma, characterized in that: The invention comprises an active component and a pharmaceutically acceptable carrier, wherein the active component is a substance for inhibiting the expression level of circ_0042819, and the DNA nucleotide sequence corresponding to the substance is shown in SEQ ID NO. 6-7.