Rs17771861 and application thereof in preparation of reagent for nasopharyngeal carcinoma prognosis prediction

By detecting the SNP site rs17771861 in the peripheral blood of patients with nasopharyngeal carcinoma, it provides the prognosis prediction of nasopharyngeal carcinoma, solves the problem of lack of prognostic markers in the prior art, and achieves the accuracy of individualized treatment and improves survival.

CN120485373APending Publication Date: 2025-08-15THE THIRD XIANGYA HOSPITAL OF CENT SOUTH UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510794405.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The lack of effective prognostic markers for nasopharyngeal carcinoma in the prior art leads to significant differences in prognostic outcomes after treatment and the inability to achieve precise treatment.

Method used

Using SNP site rs17771861 and its related kits, we provide prognosis prediction of nasopharyngeal carcinoma by detecting the SNP site genotype in peripheral blood, and formulate individualized treatment plans.

Benefits of technology

It improves the accuracy and survival rate of prognostic evaluation in patients with nasopharyngeal carcinoma, provides guidance for individualized treatment, is convenient for detection and simple for operation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the field of tumor medicine and the technical field of molecular biology and gene detection, and relates to application of rs17771861 in preparation of a nasopharyngeal carcinoma prognosis prediction marker, and the sequence of the SNP site rs17771861 is as shown in SEQ ID NO.1. The invention also relates to application of the SNP site rs17771861 in preparation of a nasopharyngeal carcinoma prognosis prediction marker. The invention provides an SNP (Single Nucleotide Polymorphism) marker rs17771861 related to nasopharyngeal carcinoma prognosis, application of the SNP marker rs17771861 and a detection kit capable of being used for nasopharyngeal carcinoma prognosis prediction, and the SNP marker rs17771861 is used for assisting in guiding individualized treatment and improving prognosis of tumor patients. After the kit disclosed by the invention is applied to clinical detection, prognosis of a patient can be evaluated before treatment, and a more positive and effective treatment scheme is formulated for the patient with poor prognosis, so that individualized treatment of the patient is realized, and the survival rate is increased. In addition, the kit only needs to detect peripheral blood, and has the characteristics of convenience in sampling, simplicity in operation, high timeliness and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of tumor medicine, molecular biology and gene detection technology, and relates to rs17771861 and its application in preparing a nasopharyngeal carcinoma prognosis prediction reagent. Background Art

[0002] Nasopharyngeal carcinoma (NPC) is a malignant tumor that arises from the mucosal epithelium of the nasopharynx and is one of the most common head and neck malignancies. Early-stage NPC can be treated with radiotherapy alone, while locally advanced patients require a combination of chemoradiotherapy and chemotherapy with platinum-based chemotherapy. However, clinical staging only reflects the anatomical structure invaded by the tumor, and patients with the same stage still have significant differences in prognostic outcomes after receiving similar treatment. Approximately 30% of patients still experience local recurrence or distant metastasis after treatment, resulting in a poor prognosis for NPC. The TNM system has significant limitations in predicting treatment outcomes. Therefore, providing effective prognostic markers for NPC is of great significance in helping to formulate accurate treatment plans and achieve precise treatment for patients.

[0003] Single nucleotide polymorphisms (SNPs) are DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. As third-generation genetic markers, SNPs play an important role in gene mapping and genetic disease research. With the development of SNP detection technology, it has become possible to study the relationship between variant sites and complex diseases in large populations. Based on the theories of oncological pharmacogenomics and radiogenomics, single nucleotide polymorphisms are one of the important factors that cause differences in tumor treatment responses. Studies have already identified genetic variations associated with the prognosis of lung cancer, ovarian cancer, breast cancer, prostate cancer, and other tumors. However, there are currently no SNPs that can be used clinically to predict the prognosis of nasopharyngeal carcinoma treatment. Summary of the Invention

[0004] The purpose of the present invention is to provide an application of rs17771861 in preparing a nasopharyngeal carcinoma prognosis prediction reagent.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions: The SNP site rs17771861, its sequence is shown in SEQ ID NO.1.

[0006] The invention relates to the use of a reagent for detecting the SNP site rs17771861 in preparing a reagent for predicting the prognosis of nasopharyngeal carcinoma. The sequence of the SNP site rs17771861 is shown in SEQ ID NO.1.

[0007] Sequence of SNP site rs17771861 (SEQ ID NO. 1): CCAACATTTC CTATGCAGTA TGTCCACATA TATCTTTGTG TAACAGTGGT GCACATCCTTTAGAACTAAT GCTATGCAGA ACAGTTTGGG AAATGGTAAC CTGCTCCATG CACTCTCCTT ATTTGGCTGGTGAGTCACCA AAAAAAAAAA GCAAAATAGG AATTTTAAAC CCGACCTAAC TACAGTGAAA CTCAGAAATAC ACAAATTGCA ATGACCTTAA ACCCCAAGAA AAACAAGGCC TAAAATTATA GTAAATGCTTCGAGGGGCAA ATTGTCACCT GGTTTAGATG GAAACAGAGA TCTGAGCAGC CTGCTGTTTT TCAACATTATCTGAGCTGTC TCCTGGTTAG AGAAAAAGCT ATTTCCAACT GGACGCCCTC TGGTCATCAT TTACACTTCT The SNP site rs17771861 has a base mutation from T to C at its 201st position, that is, the overall survival and progression-free survival of subjects with homozygous or heterozygous genotypes of the rs17771861-C allele are significantly worse than those of subjects with homozygous genotypes of the T allele.

[0008] In one preferred embodiment, the reagent for detecting the SNP site rs17771861 includes an allele-specific probe, primer or chip.

[0009] In one preferred embodiment, the allele-specific probes are TaqMan® SNP Genotyping Assays.

[0010] In one preferred embodiment, the allele-specific probe is as follows: T allele probe TGAAACTCAGAAATATAC (SEQ ID NO: 4); C allele probe TGAAACTCAGAAATACAC (SEQ ID NO: 5).

[0011] In one preferred embodiment, the primers are as follows: Upstream primer: TGCACTCTCCTTATTTGGCTG (SEQ ID NO: 2); Downstream primer: TTGGGGTTTAAGGTCATTGC (SEQ ID NO: 3).

[0012] Based on the same inventive concept, the present invention also claims protection for the use of a kit for preparing a reagent for predicting the prognosis of nasopharyngeal carcinoma, wherein the kit includes a reagent for detecting the SNP site rs17771861.

[0013] In one preferred embodiment, the kit includes primers and allele-specific probes for detecting the SNP site rs17771861.

[0014] In one preferred embodiment, the primers are as follows: Upstream primer: TGCACTCTCCTTATTTGGCTG (SEQ ID NO: 2); Downstream primer: TTGGGGTTTAAGGTCATTGC (SEQ ID NO: 3).

[0015] In one preferred embodiment, the allele-specific probe is as follows: T allele probe TGAAACTCAGAAATATAC (SEQ ID NO: 4); C allele probe TGAAACTCAGAAATACAC (SEQ ID NO: 5).

[0016] In one preferred embodiment, the kit further comprises PCR buffer, dNTP, magnesium chloride, DNA polymerase and deionized water.

[0017] In another aspect, the present invention provides a method for using the above-mentioned kit, comprising the following steps: (1) Collect peripheral blood from the subjects and extract genomic DNA; (2) using the genomic DNA obtained in step (1) as a template, and performing PCR amplification using the kit; (3) The PCR product obtained in step (2) is treated with alkaline phosphatase and subjected to single-base extension, and then purified and subjected to mass spectrometry analysis to obtain the SNP site genotype data of the subject to be tested and predict the tumor prognosis of the subject to be tested.

[0018] That is, a base mutation from T to C occurs at position 201 of the SNP site rs17771861, that is, the overall survival and progression-free survival of subjects with homozygous or heterozygous genotypes of the rs17771861-C allele are significantly worse than those of subjects with homozygous genotypes of the T allele.

[0019] Preferably, the PCR amplification program in step (2) is: 95°C, 2 min; 95°C, 30 s, 56°C, 30 s, 72°C, 1 min, 45 cycles; 72°C, 3 min; 4°C, ∞.

[0020] In summary, the beneficial effects of the present invention are: The present invention provides SNP markers associated with the prognosis of nasopharyngeal carcinoma and their applications, as well as a detection kit that can be used to predict the prognosis of nasopharyngeal carcinoma, to assist in guiding individualized treatment and improving the prognosis of tumor patients; the detection kit provided by the present invention can accurately predict the prognosis of tumor patients by detecting SNP sites on the peripheral blood DNA of nasopharyngeal carcinoma patients; after the kit of the present invention is applied to clinical testing, the prognosis of patients can be evaluated before treatment, and more active and effective treatment plans can be formulated for patients with poor prognosis, thereby realizing individualized treatment of patients and improving survival rate; in addition, the kit only requires peripheral blood testing, and has the characteristics of convenient sampling, simple operation, and high timeliness. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Figure 2 is the overall survival curve of nasopharyngeal carcinoma patients with different rs17771861 genotypes under the dominant model.

[0022] Figure 2 Figure 3 is the progression-free survival curve of nasopharyngeal carcinoma patients with different rs17771861 genotypes under the dominant model.

[0023] Figure 3 A nomogram for predicting 3-year and 5-year overall survival in patients with nasopharyngeal carcinoma.

[0024] Figure 4 Nomogram for predicting 3- and 5-year progression-free survival in patients with nasopharyngeal carcinoma.

[0025] Figure 3 and Figure 4 In the nomogram, age: over 60 years old -1; sex: male -1; EBV infection: positive -1; treatment regimen: radiotherapy alone -1, radiotherapy + induction / adjuvant chemotherapy -2, concurrent chemoradiotherapy -3, concurrent chemoradiotherapy + induction / adjuvant chemotherapy -4, radiotherapy + other treatments -5; rs17771861: no mutation -1.

[0026] Figure 5 Receiver operating characteristic curve for the comprehensive model predicting overall survival of patients with nasopharyngeal carcinoma.

[0027] Figure 6 Receiver operating characteristic curve for the comprehensive model predicting progression-free survival in patients with nasopharyngeal carcinoma.

[0028] Figure 7Receiver operating characteristic curve for the comprehensive model predicting overall survival in newly collected nasopharyngeal carcinoma patients.

[0029] Figure 8 Receiver operating characteristic curve for the comprehensive model predicting progression-free survival in newly collected nasopharyngeal carcinoma patients. DETAILED DESCRIPTION

[0030] The present invention is not limited to the following specific embodiments. Based on the disclosure of the present invention, a person skilled in the art may adopt a variety of other specific embodiments to implement the present invention. Any simple changes or modifications made to the design structure and concept of the present invention fall within the scope of protection of the present invention. It should be noted that the embodiments and features of the embodiments of the present invention may be combined with each other unless they conflict. Example 1

[0031] 1. Patient recruitment and follow-up The inventors recruited nasopharyngeal carcinoma patients from Jiangxi Cancer Hospital and selected 303 patients admitted to the hospital from April 2014 to July 2017 for follow-up. Patients included in the study met the following requirements: (1) first diagnosed with nasopharyngeal carcinoma after pathological examination; (2) no distant metastasis visible on imaging; (3) completed radical treatment; (4) no other concurrent tumors. Exclusion criteria: (1) did not meet the above inclusion criteria; (2) breastfeeding or pregnant patients; (3) combined with other serious medical diseases, such as cirrhosis, bleeding tendency, obvious arrhythmia and heart failure; (4) had a history of cancer, radiotherapy, chemotherapy or any other anti-tumor treatment before receiving treatment; (5) lack of follow-up information.

[0032] 2. Blood Sample Collection and DNA Extraction 3-5 mL of peripheral blood samples were collected from nasopharyngeal carcinoma patients after admission and before treatment using EDTA tubes. The samples were centrifuged at 3000 g and 4°C for 10 min, and the upper plasma layer was discarded to obtain a blood cell pellet.

[0033] DNA was extracted using the Wizard® Genomic DNA Purification Kit, following the kit's instructions. Samples qualified if their DNA concentration was greater than 20 ng / μL, their OD260 / OD280 ratio was between 1.6 and 2.2, their OD260 / OD230 ratio was greater than 0.6, and no absorption peak at OD230 nm was observed.

[0034] 3. Genotyping Genotyping was performed using the Illumina Infinium Global Screening Array-24 v1.0 (GSA) array according to the Infinium HTS Assay Reference Guide, detecting a total of 688,783 SNPs. The main experimental procedures are as follows (the reagents listed are those included with the Illumina Infinium Global Screening Array-24 v1.0 (GSA) array): (1) Amplification of genomic DNA: Add 4 μL of DNA sample (20 ng / μL) to a DNA sample plate containing 20 μL of MA1, then add 4 μL of 0.1 M NaOH solution to denature the DNA. After shaking, add 34 μL of MA2 solution and 38 μL of MSM solution. After shaking, place the DNA sample plate in a 37°C hybridization oven and incubate overnight (20-24 h).

[0035] (2) Enzyme fragmentation of amplified products: Add 25 μL of FMS solution to the amplified products for enzyme digestion reaction to obtain fragmented DNA.

[0036] (3) Precipitation: Add 4.50 μL of PM1 solution and 155 μL of 100% isopropanol to the sample plate, centrifuge and discard the supernatant to obtain the fragmented DNA precipitate.

[0037] (4) Resuspension: Add 23 μL of RA1 solution to the sample plate and incubate in a 48°C hybridization oven for 1 h to allow the fragmented DNA precipitate to fully dissolve.

[0038] (5) Hybridization of DNA sample with chip: Add 14 μL of DNA sample to the sample well of the chip, then place the chip into the chip slot and incubate in a hybridization oven at 48°C for 16-24 h.

[0039] (6) Cleaning the chip: Use Wash Rack, PB1 solution, etc. to clean the chip.

[0040] (7) Single base extension and fluorescent staining: The solutions required for single base extension are RA1, LX1, LX2, EML, and 1 mM EDTA. The solutions required for staining are XC3, SML, XC3, ATM, XC3, SML, XC3, ATM, XC3, SML, and XC3. For the experimental procedures of single base extension and fluorescent staining, please refer to the Infinium HTS Assay Reference Guide.

[0041] (8) Chip scanning: Use the iSCAN system to scan the chip and collect fluorescence signals.

[0042] (9) Data analysis and genotyping: GenomeStudio software was used to analyze the fluorescence signal and obtain genotype data.

[0043] 4. Data quality control and genotype filling The raw genotype data were systematically quality-controlled using PLINK software (version 1.9) according to the following criteria to filter out unqualified sites and samples. SNP exclusion criteria: (1) SNP detection rate < 95%; (2) minor allele frequency (MAF) < 0.05; (3) severe deviation from Hardy-Weinberg equilibrium (HWE), HWE P Value <1×10 -4 ; (4) located on sex chromosomes. Sample exclusion criteria: (1) sample detection rate <95%; (2) wrong sex; (3) heterozygosity greater than 6 times the standard deviation; (4) relatedness, PI-HAT>0.25; (5) population stratification, principal component analysis (PCA) greater than 4 times the standard deviation.

[0044] For the quality-controlled loci, 1000 Genomes Phase 3 was used as the reference genome, and genotypes were imputed by chromosome interval using IMPUTE2 software. After imputation, quality control was performed again using PLINK software (version 1.9) with the following filtering conditions: (1) INFO < 0.8; (2) SNP detection rate < 95%; (3) MAF < 0.05; (4) HWE P value < 1 × 10 -4 ; (5) Sample detection rate <95%; (6) Heterozygosity rate greater than 6 times the standard deviation; (7) Population stratification, PCA greater than 4 times the standard deviation.

[0045] 5. Correlation Analysis The primary endpoint of this study was overall survival (OS), defined as the time from the first hospitalization after initial diagnosis to death (the last follow-up date was used for patients lost to follow-up, and the end of follow-up date was used for patients still alive at the end of the study). A secondary endpoint was progression-free survival (PFS), defined as the time from the first hospitalization after initial diagnosis to tumor progression (recurrence, metastasis) or death (from any cause), whichever occurred first. A univariate Cox proportional hazards regression model was used in SPSS (version 26.0) to identify clinical factors that significantly influenced the endpoint (P < 0.05). These clinical factors were included as covariates in subsequent association analyses. Subsequently, association analyses were performed using the "gwasurvivr" package in R (v.4.1.2) based on the Cox proportional hazards regression model. Clinical factors that influence survival, including age, clinical stage, and EBV infection, were adjusted as covariates.

[0046] The significance standard was set at P < 1.0 × 10 -6 In the association results of overall survival, P < 1.0 × 10 -6 (See Table 1), there were 7 significant sites in progression-free survival (See Table 2).

[0047] Table 1 SNPs significantly associated with overall survival in patients with nasopharyngeal carcinoma SNP chromosome Allele MAF value HR (95% CI) rs17771861 6 T / C 0.08 <![CDATA[9.13×10 -10 ]]> 6.06 (3.41-10.80) rs35701774 6 T / C 0.09 <![CDATA[5.99×10 -7 ]]> 4.48 (2.49-8.07) rs117835995 9 G / A 0.11 <![CDATA[9.67×10 -7 ]]> 3.67 (2.18-6.18) Table 2 SNPs significantly associated with progression-free survival in nasopharyngeal carcinoma patients SNP chromosome Allele MAF value HR (95% CI) rs6817509 4 C / T 0.13 <![CDATA[6.89×10 -8 ]]> 3.13 (2.07-4.74) rs4512037 4 C / T 0.13 <![CDATA[8.29×10 -8 ]]> 3.11 (2.06-4.72) rs6814800 4 A / G 0.14 <![CDATA[2.48×10 -7 ]]> 2.99 (1.97-4.53) rs11414663 4 CA / C 0.14 <![CDATA[2.48×10 -7 ]]> 2.99 (1.97-4.53) rs7697977 4 C / T 0.14 <![CDATA[2.07×10 -7 ]]> 3.00 (1.98-4.55) rs6447506 4 C / G 0.15 <![CDATA[5.41×10 -7 ]]> 2.90 (1.91-4.40) rs17771861 6 T / C 0.11 <![CDATA[4.69×10 -8 ]]> 4.59 (2.66-7.93) The results showed that only rs17771861 was significantly associated with the overall survival of nasopharyngeal carcinoma patients (HR=6.06, 95% CI:3.41-10.80, P =9.13×10 -10 ), and this site also had a genome-wide significant correlation with progression-free survival (HR=4.59, 95% CI: 2.66-7.93, P =4.69×10 -8 ).

[0048] The association analysis between rs17771861 and the prognosis of nasopharyngeal carcinoma patients was performed, and the results are shown in Table 3. Figure 1 and Figure 2 shown.

[0049] Table 3 Results of association analysis between rs17771861 and prognosis of nasopharyngeal carcinoma patients

[0050] The results showed that compared with patients who were homozygous for the major T allele, patients who were homozygous or heterozygous for the minor rs17771861-C allele had a significantly improved overall survival (HR=7.57, 95% CI: 3.82-15.03, P =6.96×10 -9 ) and progression-free survival (HR=4.43, 95% CI: 2.51-7.83, P =2.79×10 -7 ) are poor.

[0051] These results indicate that the polymorphism of rs1777186 is significantly associated with the prognosis of patients with nasopharyngeal carcinoma and can be used as a prognostic marker.

[0052] Example 2 Preparation of a SNP kit for auxiliary prognosis prediction of nasopharyngeal carcinoma The SNP kit is used for genotyping using Taqman-MGB probe typing technology / MassARRAY. The kit contains a set of SNP-specific primers (primer sequences are SEQ ID NO:2 and SEQ ID NO:3) and specific fluorescent probes (fluorescent probe pair sequences are SEQ ID NO:4 and SEQ ID NO:5).

[0053] Upstream primer: TGCACTCTCCTTATTTGGCTG (SEQ ID NO: 2); Downstream primer: TTGGGGTTTAAGGTCATTGC (SEQ ID NO: 3).

[0054] SEQ ID NO: 4: T allele probe TGAAACTCAGAAATATAC; SEQ ID NO: 5: C allele probe TGAAACTCAGAAATACAC.

[0055] The kit also contains common reagents required for PCR techniques, such as dNTPs, MgCl2, double-distilled water, and Taq enzyme (Agena Bioscience, Inc). These common reagents are well known to those skilled in the art. Standards and controls (such as genotyping standards and blank controls) may also be included. Specifically, the PCR reaction system of the present invention is: 0.5 μL of cDNA template, 2.5 μL of PCR Mix, 0.5 μL of upstream and downstream primer mixes, and 1.5 μL of double-distilled water, for a total reaction volume of 5 μL.

[0056] The main experimental process of MassARRAY technology is as follows (according to Agena MassARRAY ®iPLEX ReagentsUser Guide): (1) Primer synthesis: Based on the above primer design, the primers were purified by PAGE method.

[0057] (2) PCR amplification: The gene fragment containing the SNP site was amplified from gDNA. The amplification system was as follows: 0.5 μL of cDNA template, 2.5 μL of PCR Mix, 0.5 μL of upstream and downstream mixed primers, and 1.5 μL of double-distilled water. The total volume of each reaction system was 5 μL. The standard PCR protocol was followed, and the product length was between 100 and 200 bp. The PCR amplification reaction program was set as follows: 95°C, 2 min; 95°C, 30 s, 56°C, 30 s, 72°C, 1 min, 45 cycles; 72°C, 3 min; 4°C, ∞.

[0058] (3) Alkaline phosphatase reaction: After the PCR reaction, the PCR product was treated with SAP (shrimp alkaline phosphatase, Agena Bioscience, Inc.) to remove free dNTPs in the system. The SAP reaction program was set as follows: 37°C for 40 min; 85°C for 5 min; and 4°C for ∞.

[0059] (4) Single base extension reaction: After the alkaline phosphatase treatment, the single base extension reaction was performed according to the program in the ddNTP system. The single base extension reaction program was set as follows: 94℃, 30s; 94℃, 5s, 52℃, 5s, 80℃, 5s, 40 cycles (52℃, 5s, 80℃, 5s, 5 cycles); 72℃, 3min; 4℃, ∞.

[0060] (5) Resin purification and spotting: The extension product is purified using resin and then transferred to the SpectroCHIP chip for spotting to obtain a spotted chip.

[0061] (6) Mass spectrometry detection and data output: The spotted chip was analyzed using a MALDI-TOF mass spectrometer (Agena Bioscience, Inc.), and genotyping data were obtained using TYPER4.0 software.

[0062] This kit only requires peripheral blood and no other tissue samples. It detects SNPs using the most streamlined and specific primers, and then uses the SNP spectrum to assist in predicting the prognosis of nasopharyngeal carcinoma. It is not only stable and easy to detect, but also accurate, greatly improving the sensitivity and specificity of disease prognosis prediction. Therefore, using this kit can help guide more effective individualized treatment.

[0063] Example 3 Establishment of a prognostic prediction model for nasopharyngeal carcinoma To further investigate the predictive performance of this SNP, a multivariate Cox regression analysis was performed to integrate clinical factors and genetic predictors to construct a prognostic model for NPC. A nomogram was constructed using the "rms" package in R for the optimal prediction model for overall survival and progression-free survival in the 303 patients in Example 1.

[0064] A nomogram for predicting overall survival and progression-free survival was constructed by integrating clinical factors and genetic factors, as shown in Figure 2. Figure 3 and Figure 4 As shown. The variables included in the prediction model are age, gender, clinical stage, EBV infection, treatment regimen, and rs17771861 genotype. In the nomogram, the different states of each variable correspond to a single score, namely the Points in the figure. The total score can be obtained by adding up all the variable scores, which is the Total Points in the figure. Draw a straight line based on the Total Points. The straight line intersects with the scale line of the 3-year / 5-year survival probability below, and the patient's 3-year / 5-year overall survival or progression-free survival probability can be directly read. Draw the ROC curves of the comprehensive model to predict overall survival and progression-free survival, as shown below. Figure 5 and Figure 6 The results showed that the ROC curve AUC values ​​of the comprehensive model for predicting overall survival and progression-free survival were 0.79 and 0.73, respectively ( Figure 5 and Figure 6 ), indicating that the model has good prediction performance.

[0065] Example 4 To verify the predictive performance of the prognostic model, 139 patients admitted from Hunan Cancer Hospital between January and August 2016 were recruited and followed up. The inclusion and exclusion criteria were the same as those in Example 1. The kit of Example 2 and the model of Example 3 were used to predict the new 139 samples, and the ROC curves of the comprehensive model for predicting overall survival and progression-free survival were drawn, as shown in Figure 2. Figure 7 and Figure 8 The results showed that the ROC curve AUC values ​​of the comprehensive model for predicting overall survival and progression-free survival were 0.81 and 0.74, respectively ( Figure 7 and Figure 8 ), indicating that the model is reliable.

[0066] It should be noted that the above embodiments are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. A person skilled in the art would be able to make other variations or modifications based on the above description. It is not possible to enumerate all embodiments here. Any obvious variations or modifications arising from the technical solution of the present invention remain within the scope of protection of the present invention.

Claims

1. SNP site rs17771861, characterized in that Its sequence is shown in SEQ ID NO.

1.

2. Use of a reagent for detecting the SNP site rs17771861 in the preparation of a reagent for predicting the prognosis of nasopharyngeal carcinoma, characterized in that: The sequence of SNP site rs17771861 is shown as SEQ ID NO.

1.

3. The use according to claim 2, characterized in that The reagents for detecting the SNP site rs17771861 include allele-specific probes, chips or primers.

4. The use according to claim 3, characterized in that The allele-specific probes are TaqMan® SNP Genetyping Assays.

5. The use according to claim 3, characterized in that Allele-specific probes are as follows: T allele probe TGAAACTCAGAAATATAC (SEQ ID NO: 4); C allele probe TGAAACTCAGAAATACAC (SEQ ID NO: 5).

6. The use according to claim 3, characterized in that The primers are as follows: Upstream primer: TGCACTCTCCTTATTTGGCTG (SEQ ID NO: 2); Downstream primer: TTGGGGTTTAAGGTCATTGC (SEQ ID NO: 3).

7. Use of a kit for preparing a reagent for predicting the prognosis of nasopharyngeal carcinoma, characterized in that: The kit includes a reagent for detecting the SNP site rs17771861.

8. The use according to claim 7, characterized in that The kit comprises primers for detecting the SNP site rs17771861 and an allele-specific probe.

9. The use according to claim 7, characterized in that The primers are as follows: Upstream primer: TGCACTCTCCTTATTTGGCTG (SEQ ID NO: 2); Downstream primer: TTGGGGTTTAAGGTCATTGC (SEQ ID NO: 3); Allele-specific probes are as follows: T allele probe TGAAACTCAGAAATATAC (SEQ ID NO: 4); C allele probe TGAAACTCAGAAATACAC (SEQ ID NO: 5).

10. The use according to claim 7, characterized in that The kit also includes PCR buffer, dNTPs, magnesium chloride, DNA polymerase and deionized water.

Citation Information

Cited By

  • Application of mutant gene in prediction of lung cancer immunotherapy related thrombocytopenia

    CN121137154A