Method for obtaining long-styled and anther-adhered tomato flower by using CRISPR method and application

Abstract

The application discloses a method and application for obtaining a tomato flower with a long stigma and anther adhesion form by using a CRISPR method, and belongs to the technical field of biotechnology. The technical problem solved by the application is how to prepare a tomato with a long stigma and anther adhesion form. The method for obtaining a tomato flower with a long stigma and anther adhesion form disclosed by the application comprises the following steps: editing a coding gene of SlCER6 protein and a coding gene of SlMYB21 protein in a tomato to obtain a target tomato; the SlCER6 protein is a protein with an amino acid sequence of SEQ ID No. 2; and the SlMYB21 protein is a protein with an amino acid sequence of SEQ ID No. 4. The method can improve any tomato plant as a female parent, obtain a special flower type with a long stigma, anther adhesion and pollen inactivation, avoid artificial detasseling, facilitate heterologous pollination, reduce breeding cost and improve economic benefits.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method and application of obtaining tomato flowers with long stigmas and anther adhesion using the CRISPR method. Background Technology

[0002] Tomatoes are one of the most important vegetables globally. Currently, artificial pollination is widely used in tomato breeding to produce hybrids. Hybrid offspring exhibit advantages such as strong resistance and superior traits. However, the hybridization process requires artificial emasculation and pollination during flowering, which is complex, time-consuming, and results in high costs and low efficiency in hybridization breeding. Long stigma in tomatoes refers to an elongated stigma protruding from the anthers while the petals unfold normally. Anther adhesion in tomatoes refers to an abnormal wax metabolism during development, causing the petals and anthers to adhere tightly together through wax, preventing the anthers and pollen from drying, maturing, and being released normally, thus avoiding emasculation. This study utilizes these two special phenotypes to screen key regulatory genes and study the regulatory mechanism. By editing tomato plants using CRISPR technology, the maternal tomato hybrid seed production can exhibit a special flower shape with elongated stigmas and anther adhesion, facilitating machine identification and providing technical support for mechanical pollination and improving the efficiency of tomato breeding. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to prepare tomatoes with long stigmas and anthers in an adhesive morphology.

[0004] To solve the above-mentioned technical problems, the present invention first provides a method for preparing tomatoes, the method comprising: editing the coding genes of SlCER6 protein and SlMYB21 protein in tomatoes to obtain the target tomato;

[0005] The SlCER6 protein is either A1) or A2):

[0006] A1) The amino acid sequence of this protein is SEQ ID No. 2;

[0007] A2) A protein that has more than 98% identity with A1) and has the same function as the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, after substitution and / or deletion and / or addition of amino acid residues;

[0008] The SlMYB21 protein is either B1) or B2):

[0009] B1) The amino acid sequence of this protein is that of SEQ ID No. 4;

[0010] B2) A protein having more than 98% identity with and the same function as B1) by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in SEQ ID No. 4 in the sequence listing.

[0011] The phrase "more than 98% identity" refers to 98% or 99% identity. Identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity calculation for a pair of amino acid sequences, the identity value (%) can then be obtained.

[0012] In the above method, the SlCER6 protein-coding gene may be the DNA molecule of SEQ ID No. 1 in the sequence listing;

[0013] The gene encoding the SlMYB21 protein may be the DNA molecule listed as SEQ ID No. 3 in the sequence listing.

[0014] The above method can be implemented using the CRISPR / Cas9 method.

[0015] Specifically, the gRNA in the CRISPR / Cas9 method can target the reverse complementary sequences at positions 294-316 and 448-470 of SEQ ID No. 1 and positions 112-134 and 180-202 of SEQ ID No. 3.

[0016] In one embodiment of the present invention, the coding gene for the SlCER6 protein in the target tomato is missing positions 282-302 of SEQ ID No. 1; the genomic gene for the SlMYB21 protein is missing positions 839-1076 of SEQ ID No. 6, with position 1077 replaced by T and position 1079 replaced by T.

[0017] In one embodiment of the present invention, the coding gene for SlCER6 protein in the target tomato is deleted at positions 301-304 of SEQ ID No. 1; and the coding gene for SlMYB21 protein is deleted at positions 125-128.

[0018] The method for preparing tomatoes described herein, when applied to tomato fruit production, is also within the scope of protection of this invention.

[0019] The application of the method for preparing tomatoes in tomato hybridization breeding is also within the scope of protection of this invention.

[0020] The present invention also provides the application of substances that knock out the coding gene of the SlCER6 protein and substances that knock out the coding gene of the SlMYB21 protein in tomato fruit production, or in tomato hybridization breeding.

[0021] In the above applications, the substance that knocks out the gene encoding the SlCER6 protein can be either C1) or C2):

[0022] C1) gRNA used for editing the gene encoding the SlCER6 protein;

[0023] C2) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in C1);

[0024] The substance that knocks out the gene encoding the SlMYB21 protein can be either C3) or C4):

[0025] C3) gRNA used for editing the gene encoding the SlMYB21 protein;

[0026] C4) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in C3).

[0027] In one embodiment of the present invention, the target sequence of the gRNA used for editing the gene encoding the SlCER6 protein is the reverse complementary sequence of positions 294-316 and 448-470 of SEQ ID No. 1.

[0028] In one embodiment of the present invention, the target sequence of the gRNA used for editing the gene encoding the SlMYB21 protein is positions 112-134 and 180-202 of SEQ ID No. 3.

[0029] In one embodiment of the present invention, the recombinant vector is a pHSdbcas9i-gRNA-SlCER6 / SlMYB21 vector, which can transcribe four gRNAs that target the reverse complementary sequences at positions 294-316 and 448-470 of SEQ ID No. 1 and positions 112-134 and 180-202 of SEQ ID No. 3 in the tomato genome, respectively.

[0030] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.

[0031] The present invention also provides a set of compositions comprising the substance that knocks out the gene encoding the SlCER6 protein and the substance that knocks out the gene encoding the SlMYB21 protein.

[0032] The composition can be used for tomato fruit production or tomato hybridization breeding.

[0033] The method for preparing tomatoes according to the present invention can edit specific target genes SlCER6 and SlMYB21, which can improve any tomato plant used as the female parent, and obtain a special flower type with excessively long stigmas, anther adhesion, and pollen inactivation. This eliminates the need for artificial emasculation, facilitates heterologous pollination, reduces breeding costs, and improves economic benefits.

[0034] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0035] Figure 1 Observation of wild-type and ps-type using scanning electron microscopy - 2. Morphology of the anther exine during maturity, the inner wall of the petals during development, the anther cell exine during development, the anther cuticle, and pollen grains in the mutant. Note: A. Flower morphology and anther exine morphology after removing petals in wild-type and ps-2 mutants; B. Observation of petal inner wall morphology at various stages of flower development; C. Observation of anther exine morphology in wild-type and ps-2 mutants; D. Pollen morphology in wild-type and ps-2 mutants.

[0036] Figure 2 Observation of wild-type and ps-type using transmission electron microscopy - 2. Structure of the outermost waxy layer of the anther exowall in mutant anthers. Note: A. Morphology of the outermost cell wall of the anther during flower development (stages 1-6 represent bud lengths of 0.6cm, 0.8cm, and 1cm, and calyx opening angles of 30°, 45°, and 60°, representing 6 developmental stages; I: inner wall of petals, O: outer wall of petals); B. In ps - 2. Observation of intercellular morphology at the adhesion site of anthers and petals (I: inner wall of petal, O: outer wall of petal; red arrows: visible adhered and non-adhered parts).

[0037] Figure 3 Sequence analysis of knockout mutants.

[0038] Figure 4Phenotypic analysis of wild-type and SlCER6 single knockout, SlMYB21 single knockout, and SlCER6 and SlMYB21 double knockout. Note: Observation A uses CRISPR technology to observe flower phenotypes by single knockout of SlCER6, single knockout of SlMYB21, and double knockout of SlCER6 and SlMYB21. slcer6-#1, slcer6-#2, and slcer6-#9 represent CER-KO-1, CER-KO-2, and CER-KO-9, respectively. slmyb21-#12, slmyb21-#14, and slmyb21-#18 represent M21-KO-12, M21-KO-14, and M21-KO-18, respectively. slcer6 / slmyb21-#1, slcer6 / slmyb21-#3, and slcer6 / slmyb21- #6 represents CER / M21-KO-1, CER / M21-KO-3, and CER / M21-KO-6, respectively; B uses qPCR to detect the relative expression levels of CER family genes SlCER1, SlCER3, SlCER5, SlCER6, SlCER10, SlCER11, SlCER17, and SlCER20 in SlCER6 single knockout plants and SlCER6 and SlMYB21 double knockout plants; C determines the relative expression level of SlSHN3 in each line; D determines the relative expression level of SlSHN1 in each line; E determines the relative expression level of SlMYB21 in each line; F is a statistical analysis of the ratio of stamen to pistil length in each line. In B, CER / 21-KO-6 represents CER / M21-KO-6, and in CE, M-KO-14 and M-KO-18 represent M21-KO-14 and M21-KO-18, respectively.

[0039] Figure 5 Pollen viability analysis and relative expression levels of pollen development-related genes were detected in wild-type, CER-KO-2 / 9, M21-KO-14 / 18, and CER / M21-KO-3 / 6 lines. Note: A: Pollen viability detection in each line; B: Statistical analysis of pollen viability in each line, where M21-KO represents the average of M21-KO-14 and M21-KO-18, CER-KO represents the average of CER-KO-2 and CER-KO-9, and CER / M21-KO represents the average of CER / M21-KO-3 and CER / M21-KO-6; CG: Expression level analysis of pollen development-related genes in each line. In CG, M-KO-14 and M-KO-18 represent M21-KO-14 and M21-KO-18, respectively.

[0040] Figure 6Detection of changes in fruit morphology, seed morphology, fruit index, and relative expression levels of fruit development genes in wild-type, CER-KO-2 / 9, M21-KO-14 / 18, and CER / M21-KO-3 / 6 lines. A. Fruit morphology of each line; B. Seed quantity and morphology of each line, where M21-KO represents the average of M21-KO-14 and M21-KO-18, CER-KO represents the average of CER-KO-2 and CER-KO-9, and M21 / CER-KO represents the average of CER / M21-KO-3 and CER / M21-KO-6; C. Comparison and recording of fruit morphology of each line; D. Fruit width measurement results of each line; E. Fruit length measurement results of each line; F. Statistical analysis of fruit shape index of each line, fruit shape... The fruit shape index is the ratio of the fruit's longitudinal diameter (length) to its transverse diameter (width). [Using calipers or a ruler (accuracy at least 0.1 mm), the longitudinal diameter is the straight-line distance from the point of attachment of the fruit stalk to the top of the fruit, and the transverse diameter is measured at the widest point of the fruit (usually the middle). Measurements must be performed at least three times biologically replicated. When the fruit shape index = 1, the fruit is round (longitudinal diameter = transverse diameter); when the fruit shape index > 1, the fruit is oblong (longitudinal diameter > transverse diameter); when the fruit shape index < 1, the fruit is flat (longitudinal diameter < transverse diameter)]. The relative expression levels of fruit development-related genes in each GL strain were analyzed. In GL, M-KO-14 and M-KO-18 represent M21-KO-14 and M21-KO-18, respectively.

[0041] Figure 7 Verification of the interaction between SlCER6 and SlCSP proteins. A. Verification of interaction using BiFC assay; B. Verification of interaction using yeast two-hybrid assay; C. Verification of interaction using bimolecular luciferase assay; D. Verification of protein interaction using Co-IP technique. Detailed Implementation

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.

[0043] In the quantitative experiments described below, at least three replicates were performed. Data from the following examples were processed using GraphPadPrism 10 statistical software, and ANOVA was used. P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0044] pHSdbcas9i vector: Wuhan Boyuan Biotechnology Co., Ltd.

[0045] The ps-2 mutant was obtained from the CMRick Tomato Genetics Resource Center (https: / / tgrc-mvc.plantsciences.ucdavis.edu / Genes / search).

[0046] Example 1: Observation of wild-type and ps-type using scanning electron microscopy - 2. The anther exine during maturity, the inner wall of the petals during development, the anther cell exine during development, the anther cuticle, and the pollen grain morphology of the mutant.

[0047] Plants tested: Wild-type tomato MicroTom (WT), ps - 2 mutants.

[0048] Scanning electron microscopy was used to observe the morphology of the anther exwall, petal surface morphology near the anther, anther cell exwall morphology, and anther and pollen exwall morphology in WT and ps-2 plants after removing petals when the flower buds were 0.6 cm and 0.8 cm long and the calyx opening angle was 30° and 60°. Samples were cut into 2×5 mm strips using a double-edged razor blade; fixed with 2.5% pH 6.8 glutaraldehyde and incubated at 4°C for at least 1.5 h. The samples were washed 2-3 times with 0.1 mol pH 7.2 or pH 6.8 phosphate buffer, 10 minutes each time. Dehydration was performed once with 50%, 70%, and 90% ethanol, 10-15 minutes each time; followed by 2-3 times with 100% ethanol, 10-15 minutes each time. Replacement: Replace once with a 1:1 solution of 100% ethanol:tert-butanol; replace a second time with pure tert-butanol, each time for 15 minutes; place the sample in a freezer at -20°C for 30 minutes, then place it in a BS-2030 (HITACHI) freeze dryer for approximately 4 hours. Position the sample with the observation side facing up and attach it to the scanning electron microscope stage with conductive tape. Apply a coating using an ion sputtering system. Place the sample in the sample holder and use a Hitachi S-3400N tungsten filament scanning electron microscope.

[0049] The results are as follows Figure 1 As shown. Figure 1Figure A shows the flower morphology of WT and ps-2 at full bloom and the surface morphology of the anther exine near the petals. Observation revealed that in the wild-type flower, the petals were fully open at full bloom, with the anthers and petals separated without any adhesion. Scanning electron microscopy showed that the anther exine was smooth, with a villous structure between the anthers, interconnected and curving towards the style center. In contrast, the petals of the ps-2 flower failed to unfold, exhibiting irregular wrinkles, making it impossible to distinguish the anther and petal structures. Removing the outer petal-like tissue revealed a complete anther structure, but a large area of ​​the anther's back was connected to the petals. Even after removing the petals, petal tissue remained on the anthers. This indicates that the petals in ps-2 failed to unfold due to anther-petal adhesion, rather than a lack of anther or petal structure. To investigate the key period of petal-anther adhesion, scanning electron microscopy was used to observe different stages of flower development, such as... Figure 1 As shown in Figure B, Stages 1-4 represent four stages in flower development: bud length of 0.6cm, 0.8cm, and calyx opening angles of 30° and 60°, representing four separable stages. Observation revealed that the inner surface of wild-type petals showed shallow folds, clear lines, and no special clumps at each stage. However, observation of the inner wall of ps-2 petals showed that clumps gradually appeared from stage 3 onwards, with the folds covered in a network of clumps by stage 4. The exine of the wild-type anthers gradually developed into a dense network structure from stage 1, with clear lines, a regular structure, and outward protrusion. In contrast, the exine of the ps-2 anthers showed blurred lines from stage 3 onwards, with a thinning of the waxy layer and inward depression, which persisted until the petals could no longer be separated. Therefore, when the tomato flower grows to the point where the calyx opens to 30°, the reduced wax content between the petals and anthers prevents the formation of a regular and sufficient waxy layer, ultimately leading to the inability to separate the petals and anthers. Anther deformation and indentation also contribute to the adhesion. When focusing on observing the anthers, such as Figure 1 As shown in Figure C. In stage 3, the wild-type anther exines are regular, full, and have clear boundaries; the anther exines of all three PS-2 lines show obvious concavity. In stage 4, the wild-type anther exines are convex with a certain curvature, and the petals are open; the PS-2 anther exines show uneven wax distribution, concavity, and roughness, proving that stage 4 is the period when anther abnormalities begin compared to other stages. To investigate whether the flower morphology of PS-2 affects fertility, the morphology of pollen grains in mature anthers was observed after the appearance of stage 4. Figure 1 The results showed that wild-type pollen grains were plump and clearly structured; ps-2 pollen grains were clumped together, flattened-spherical in shape, and exhibited reduced viability. Conclusion: The failure of ps-2 petals to unfold was due to adhesion between the anthers and petals; both adhesion and indentation occurred when the calyx opened to 30°, worsening at 60°, after which separation was impossible; this adhesion prevented pollen grains from developing into their normal morphology and caused them to adhere together, thus losing their viability.

[0050] Example 2: Observation of wild-type and ps-type cells using transmission electron microscopy - 2. Structure of the outer wax layer of the anther cell wall in mutant anthers.

[0051] Plants tested: Wild-type tomato MicroTom (WT), ps - 2 mutants.

[0052] After removing the petals from the flower, trim the material into strips 3mm long and 1mm wide. For initial fixation, use 2.5% glutaraldehyde fixative for 2 hours or longer. Rinse three times with 0.1M phosphate buffer (pH 6.8), changing the solution 15 minutes each time. For post-fixation, use 1% osmium tetroxide fixative, followed by rinsing three times with 0.1M phosphate buffer (pH 6.8), changing the solution 15 minutes each time. The sample undergoes continuous dehydration: 50% ethanol for 15-20 minutes → 70% ethanol for 15-20 minutes → 90% ethanol for 15-20 minutes → 100% ethanol for 10 minutes each time, changing the solution twice (total 20 minutes) → 100% ethanol + 100% acetone (1:1) for 10 minutes → 100% acetone (room temperature) for 5-10 minutes. (The sample should be kept in a 4℃ refrigerator during the above steps). Impregnation: Pure acetone + embedding buffer (1:1) at room temperature using slow rotation embedding: embedding time depends on the sample. Polymerization: Approximately 3-9 days. After trimming, sections were prepared using an ultramicrotome, stained, and observed using a Hitachi H-7650 transmission electron microscope. The sections were then photographed.

[0053] The development of the anther exine and adhering parts was observed using scanning electron microscopy, and the results are as follows: Figure 2 As shown, stages 1-6 represent six developmental stages: bud lengths of 0.6cm, 0.8cm, and 1cm; and calyx opening angles of 30°, 45°, and 60°. I represents the inner wall of the petals, and O represents the outer wall. Red arrows indicate visible adhered and non-adhered portions. Observation reveals that during the development of wild-type flowers, the waxy layer of cells at the junction of I and O has regular serrated protrusions, gradually changing from smooth to sharp. The ps-2 waxy layer no longer develops in stage 3, forming a thinner, wavy shape instead of regular serrations. Adhesion begins after stage 4. Figure 2 Figure B shows that stage 4 exhibits partial adhesion, while stage 6 shows complete adhesion. As can be seen from the figure, insufficient wax, failing to form a complete surface covering the anther's outer wall and the petal's inner wall, leads to partial or complete adhesion between the petal and anther, forming irregular edges. Therefore, abnormal wax metabolism is the main cause of anther-petal adhesion.

[0054] Example 3: Phenotypic analysis of tomatoes with double knockout of SlCER6 and SlMYB21 genes.

[0055] In this embodiment, the SlCER6 and SlMYB21 genes were knocked out, and their phenotypes were analyzed. The CDS sequence of the SlCER6 gene is shown in SEQ ID No. 1, encoding the SlCER6 protein shown in SEQ ID No. 2; the genomic sequence of the SlMYB21 gene is shown in SEQ ID No. 6, and the CDS sequence is shown in SEQ ID No. 3, encoding the SlMYB21 protein shown in SEQ ID No. 4.

[0056] Using the clustered regularly spaced short palindromic repeats / CRISPR-associated protein 9 (CRISPR / Cas9) system, a CRISPR / Cas9 vector with double knockout of the SlCER6 and SlMYB21 genes was constructed. The sgRNAs of SlCER6 and SlMYB21 were designed via CRISPR-directweb (http: / / crispr.dbcls.jp). The two sgRNA units were then tandemly inserted into the Cas9 expression vector (pHSdbcas9i vector) via enzyme digestion and ligation. The tandemly inserted sequence unit structure is: sgRNA1-gRNA backbone-tRNA-sgRNA2.

[0057] tRNA sequence: aacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgca;

[0058] gRNA backbone: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC;

[0059] Target of SlCER6:

[0060] ①AGGGTACTCTGCACGTAACGGGG (i.e., the reverse complementary sequence of positions 294-316 of SEQ ID No. 1);

[0061] ②GTCTCCATTGTTGGCGTTGGAGG (i.e., the reverse complementary sequence of positions 448-470 of SEQ ID No. 1);

[0062] Target of SlMYB21:

[0063] ①AACTCTCTAGCTAAATCTGCTGG (i.e., bits 112-134 of SEQ ID No. 3);

[0064] ②TCTTCGACCTGATGTCAGGAGGG (i.e., bits 180-202 of SEQ ID No. 3).

[0065] The pBK2-Cas9-U6, linearized by Eco3 1I digestion, was ligated with the above-mentioned unit structure using T4 ligase to obtain recombinant vectors pHSdbcas9i-gRNA-SlCER6 / SlMYB21, pHSdbcas9i-gRNA-SlCER6, and pHSdbcas9i-gRNA-SlMYB21. These vectors were transformed into *E. coli*, and after bacterial culture identification, the correct plasmids were transformed into GV3101 cells. Further Agrobacterium-mediated tomato genetic transformation was then performed to obtain knockout lines.

[0066] Specifically, the pHSdbcas9i-gRNA-SlCER6 / SlMYB21 vector can transcribe four gRNAs targeting the reverse complementary sequences at positions 294-316 and 448-470 of SEQ ID No. 1 and positions 112-134 and 180-202 of SEQ ID No. 3 in the tomato genome, respectively; the pHSdbcas9i-gRNA-SlCER6 vector can transcribe gRNAs targeting the reverse complementary sequences at positions 294-316 of SEQ ID No. 1 and positions 448-470 of SEQ ID No. 1 in the tomato genome; and the pHSdbcas9i-gRNA-SlMYB21 vector can transcribe gRNAs targeting positions 112-134 of SEQ ID No. 3 and positions 180-202 of SEQ ID No. 3 in the tomato genome.

[0067] After introducing pHSdbcas9i-gRNA-SlCER6 / SlMYB21, pHSdbcas9i-gRNA-SlCER6, and pHSdbcas9i-gRNA-SlMYB21 into Agrobacterium GV3101, the wild-type tomato MicroTom plants (WT) were genetically transformed using an Agrobacterium-mediated stable transformation system. Among them, three SlCER6 / SlMYB21 double knockout mutants obtained by genetic transformation using pHSdbcas9i-gRNA-SlCER6 / SlMYB21 were CER / M21-KO-1, CER / M21-KO-3, and CER / M21-KO-6; three SlCER6 knockout mutants obtained by genetic transformation using pHSdbcas9i-gRNA-SlCER6 were CER-KO-1, CER-KO-2, and CER-KO-9; and three SlMYB21 knockout mutants obtained by genetic transformation using pHSdbcas9i-gRNA-SlMYB21 were M21-KO-12, M21-KO-14, and M21-KO-18. Sequencing revealed the sequence changes in each knockout mutant as follows: Figure 3 As shown.

[0068] The SlCER6 gene in CER-KO-2 has a 21bp deletion, specifically positions 282-302 of SEQ ID No. 1.

[0069] In CER-KO-9, there is a 1bp insertion in the SlCER6 gene, with a T inserted between positions 300-301 of SEQ ID No. 1;

[0070] In M21-KO-14, there is a 1bp insertion in the SlMYB21 gene, with a T inserted between positions 195 and 196 of SEQ ID No. 3;

[0071] In M21-KO-18, there is a 1bp insertion in the SlMYB21 gene, with an A inserted between positions 195 and 196 of SEQ ID No. 3;

[0072] In CER / M21-KO-3, the SlCER6 gene has a 21bp deletion, specifically positions 282-302 of SEQ ID No. 1; the SlMYB21 gene has base substitutions and deletions, specifically positions 839-1076 of SEQ ID No. 6, where CTCAATTGTGAAAGACTCTGAGCTCACTAAGTGAACGTGAACTTGAACTTGAACTTGAACTAATCTATTCAACATGTATCTTGGTATTCTTTTGTTACATGTAAAAGAAAATTGTTTAATTTTCTAACATATTATATATCTATGTCTTTGTTTCTTTAGGTCTCAAACGTACTGGAAAAAGTTGTAGACTCCGATGGCTAAATTATCTTCGACCTGATGTCAGGAGGGGTAATATT is deleted, and positions 1077-1079, where A is replaced with TCT (i.e., in CDS, position 211 of SEQ ID No. 3 is replaced with T, and position 213 of SEQ ID No. 3 is replaced with T).

[0073] In CER / M21-KO-6, the SlCER6 gene has a 4bp deletion, specifically positions 301-304 of SEQ ID No. 1; the SlMYB21 gene has a base deletion, specifically positions 125-128 of SEQ ID No. 3, specifically the AATC.

[0074] Phenotypes such as Figure 4As shown in Figure A, gRNA designed for SlCER6 was transformed into tomato plants. Compared with the control WT, SlCER6 knockout resulted in anther and petal adhesion without opening. SlMYB21 knockout alone caused the style to elongate beyond the anther tube. Plants with both SlCER6 and SlMYB21 knockouts exhibited stigma elongation and petal closure. The expression levels of effective CER family members in the anthers during full bloom were examined in SlCER6 single knockout and SlCER6 / SlMYB21 double knockout plants. Significant downregulation of the relative expression levels of SlCER3, SlCER10, SlCER11, and SlCER17 was found, along with downregulation of SlCER1, SlCER6, and SlCER20, while upregulation of SlCER5 was observed. This suggests that SlCER6 gene editing may induce a decrease in the expression levels of multiple CERs, or that SlCER6 knockout may inhibit the expression of other genes through some mechanism. Therefore, the relative expression levels of SlSHN3 and SlSHN1 genes in anthers were detected in SlCER6 and SlMYB21 plants, which were knocked out individually and twice. SlSHN1 is a transcriptional activator of wax synthesis. Its overexpression in tomatoes can increase the content of chlorophyll a, b and total chlorophyll, promote wax synthesis and thus improve drought tolerance. The SlSHN3 gene is involved in regulating the formation of the cuticle, regulating the expression of wax synthesis-related genes, and enhancing the drought resistance of fruits. Figure 4 C and D show that both were significantly downregulated in all lines, except for SlSHN1, whose downregulation was not significant in SlMYB21 knockout plants, indicating that wax synthesis is negatively regulated to some extent. Interestingly, Figure 4 The results showed that SlMYB21 was significantly downregulated in all lines during the full bloom period, indicating that there is a certain regulatory relationship between the SlCER6 gene and the SlMYB21 gene. Figure 4 The ratio of stamens to pistils in each strain was statistically analyzed, indicating that knocking out SlCER6 does not affect stigma length, while knocking out SlMYB21 causes stigma elongation. Double knockout also showed that the stigma was longer than the anther. Therefore, it can be concluded that double knockout of both SlCER6 and SlMYB21 genes using the CRISPR-Cas9 system can yield plants with closed anthers and elongated stigmas.

[0075] The primers used for gene expression level detection are as follows:

[0076] SlCER1: CTCGAGAATCATTCACAACCAG and CTCGAGAATCATTCACAACCAG;

[0077] SlCER3: CCGACATACCACAGTCTACACC and TGCTCTTTCATCTGTACTTGTCCT;

[0078] SlCER5: GCGCATTCTTGAAAGGTCGG and CTCTGCTTCACCTCTCGCAG;

[0079] SlCER6: ACTCTGCACAAATTTGGTAACAC and CCTTCCTTTCGCCTCGATGT;

[0080] SlCER10: CACTCCATCGATTTGGTAACACG and ACACACGATCACCCCTTCTG;

[0081] SlCER11:TCTGCGTTGACATAAGGGGT and AACAGCAACAAGGGGTTCCT;

[0082] SlCER17: GTGCATACACACAGGTGGGA and TGCTGCCTCTGTTACTTCATCA;

[0083] SlCER20: CCAACACCTTTCTCTTTCTGCC and AGCTGTTGGCTTTCCCCTGT;

[0084] SlSHN3: GGAACATTTGAGACAGCAGAGG and GTTTTCGCAACTTGTCCACTC;

[0085] SlSHN1: ATGGTACAGGCAAAGAAGTTCAG and TAATTCCTGTTGAGGAGTTCCTC;

[0086] SlMYB21: TGCTGGTCTCAAACGACTG and TAGCCATCGGAGTCTACAAC.

[0087] Example 4: Using DAPI staining, pollen viability analysis and the effect of pollen on fruit development were observed in wild-type, CER-KO-2 / 9, M21-KO-14 / 18, and CER / M21-KO-3 / 6 lines.

[0088] Plants to be tested: CER / M21-KO-3, CER / M21-KO-6, CER-KO-2, CER-KO-9, M21-KO-14, M21-KO-18.

[0089] Prepare a 5-15 μg / ml DAPI solution by adding an appropriate amount of DAPI aqueous solution to PBS. Add 1 / 10 of the culture medium volume of the DAPI solution to the cell culture medium. Incubate pollen cells at 37°C for 10-20 min. Wash the cells twice with PBS or a suitable buffer. Observe using a fluorescence microscope; the DAPI excitation wavelength is 360-400 nm.

[0090] Prepare a homogeneous pollen suspension by placing pollen in an appropriate amount of PBS. Add PI (1 mg / mL) stock solution to the pollen suspension to achieve a final PI concentration of 50-100 μg / mL, and mix gently. Incubate at room temperature in the dark for 15-30 minutes to allow the dye to fully penetrate the pollen cells and bind to nucleic acids. Place a drop of the stained pollen suspension on a glass slide and cover with a coverslip.

[0091] Select appropriate excitation and emission filters. PI typically emits pollen at around 617nm under excitation at approximately 535nm. Randomly select three fields of view and count the number of viable and non-viable pollen grains.

[0092] The results are as follows Figure 5 As shown:

[0093] Pollen was co-stained with DAPI and PI, and the fluorescence of each color was observed using a fluorescence microscope. Blue DAPI staining represented all pollen, while red PI staining represented inactive pollen. Overlapping the two stains allowed for observation and statistical analysis of pollen viability. Figure 5 It can be seen that, compared to the wild type, the pollen viability of plants with only SlCER6 knockout is around 17%, and that of plants with only SlMYB21 knockout is around 42%, while the pollen survival rate of plants with both SlCER6 and SlMYB21 knockout is around 8% (e.g., Figure 5 (B) This indicates that knocking out SlMYB21 can significantly reduce pollen viability, and the combined knockout of SlCER6 will further reduce pollen viability.

[0094] qPCR was used to detect the expression levels of pollen development-related genes in anthers. This study aimed to demonstrate that single knockout of SlCER6, single knockout of SlMYB21, and double knockout of SlCER6 / SlMYB21 affect pollen development, and to elucidate the reasons for their influence. Five genes were detected: SlMYB72, SlMYB80, SlHTH1, SlACOS1, and SlHB8. The primers used are as follows:

[0095] SlMYB72: ACTTCCCAAGTATGCTGGTCT and ATCTTTCGGGCAAGTGAGCA;

[0096] SlMYB80: TTGGCGGGTGGATAGAGTTG and GGTCAGCTTACGCACACCT;

[0097] SlHTH1: TAGCTCATGTTGGAACCCCTTC and CTCTCGCAAACGTCGAATATGG;

[0098] SlACOS1: CGTCCCCGAAGAAATCACCGA and CACTGGCTCAGTACCCATTTCCC;

[0099] SlHB8:AGCTGCTATGGCACGTCAAT and ATCCAACGGGCAAGAGTCTG.

[0100] Plants overexpressing SlMYB72 exhibited abnormal pollen development, premature tapetum degradation, and increased expression of some autophagy-related genes. SlMYB80 pollen and tapetum showed tissue-specific expression. Figure 5 Figures C and D show that SlMYB72 and SlMYB80 were strongly downregulated in both single and double knockout lines, especially in SlCER6 knockout plants, indicating that knocking out these genes affects the pathways containing SlMYB72 and SlMYB80. The cuticle of the anther epidermis is crucial for male reproductive development. In rice, OsHTH1 is highly expressed in the anther epidermis and binds cuticle monomers in anther epidermal cells. The relative expression of OsHTH1 was significantly decreased in both single SlMYB21 knockout and SlCER6 / SlMYB21 double knockout. Knockout of SlMYB21 leads to pollen sterility, possibly due to a defect in the epidermal cell cuticle, while single SlCER6 knockout does not affect this process. Other studies have found that slacos1 mutants exhibit reduced pollen quantity and viability, abnormal pollen morphology, leading to pollen development defects and decreased fruit set. Therefore, the reduced pollen viability caused by SlMYB21 knockout may be due to decreased SlACOS1 gene expression, while SlCER6 knockout increases SlACOS1 expression, indicating that SlCER6 and SlMYB21 reduce pollen viability through different pathways. Overexpression of the HD-Zip III family transcription factor SlHB8 results in premature tapetal PCD, leading to pollen abortion; SlHB8 knockout has no such effect. SlHB8 expression was significantly reduced in SlCER6 knockout and SlMYB21 / SlCER6 double knockout plants, indicating that the loss of SlCER6 and SlMYB21 genes leads to decreased SlHB8 expression and pollen abortion, but SlMYB21 knockout alone does not cause a decrease in SlHB8 expression (e.g., Figure 5 (G).

[0101] Example 5: Observation and analysis of fruit morphology, seed morphology, seed number and fruit index of wild type, CER-KO-2 / 9, M21-KO-14 / 18 and CER / M21-KO-3 / 6 lines.

[0102] To further determine the effect of this double-knock technique on the development of self-pollinated fruits, fruit index and morphological measurements were performed on each strain in this embodiment. The plants tested were: CER / M21-KO-3, CER / M21-KO-6, CER-KO-2, CER-KO-9, M21-KO-14, and M21-KO-18.

[0103] The results are as follows Figure 6 As shown. Figure 6 The results from data A show that single knockout of SlMYB21 yielded seeds, but the number was significantly lower than that of the wild type; single knockout of SlCER6 also yielded very few seeds, and the seeds were not properly developed; double knockout of both SlCER6 and SlMYB21 resulted in seedless fruits. Seed count statistics are as follows: Figure 6 As shown in Figure B, this trend is consistent with the pollen viability trend, indicating that the adhesion between the petals and anthers leads to a decrease in pollen viability, which further inhibits fruit development. Figure 6 The results showed that the fruit morphology of the single knockout of SlMYB21 did not change significantly, the fruit of the single knockout of SlCER6 became smaller, and the fruit of the double knockout plant was significantly smaller. The double knockout fruit was wrapped by wrinkled anthers and petals and matured late, indicating that the absence of SlCER6 caused the petals and anthers to stick together during the flowering period and continue until fruit set. Figure 6 Figures D and E show that knocking out SlCER6 alone significantly reduced fruit length and width, while knocking out SlMYB21 alone had little effect on fruit length and width. Double knocking out of both SlCER6 and SlMYB21 significantly reduced both fruit length and width. Single knocking out had no significant effect on the fruit shape index, while double knocking out resulted in narrower and longer fruits. The mature fruits of single knocking out SlMYB21 clearly retained the decayed pistil at the tail end. This is because the stigma elongates during the flowering period in the SlMYB21 knockout line, and under natural pollination conditions, the ovary naturally swells, keeping the stigma still on the fruit. Double knocking out fruits also exhibit this characteristic. These findings indicate that double knocking out of SlCER6 and SlMYB21 prevents tomato flowers from self-pollinating. Therefore, creating hybrid female parents with elongated stigmas and eliminating the need for male stamen removal could be beneficial.

[0104] The expression levels of the genes SlARF5, SlARF8, SlIAA9, SlIAA19, SlKLUH, and SlABCG20 in anthers were detected using qPCR. The primers used are as follows:

[0105] SlARF5:ATTAGTTCTGAGTTGTGGC and GGTATCTGTGAAGTTGCTG;

[0106] SlARF8: ATTTCTCACAGACACCACCC and GCACTAACAAACACACTCCAG;

[0107] SlIAA9: TGGCCACCCATTCGATCTTTTAG and CGCAACACACATTAGTTTGCAG;

[0108] SlIAA19: TTAGCATGGATGGAGCACCG and CCTCCAATGCTTCTCCAATTCC;

[0109] SlKLUH: GGACCGATACTGTGGCCATT and ATCGGTTCCAACTTCAGCGT;

[0110] SlABCG20: CGATGCCTTCTCATTCCTCAAG and TCGCCACCATAACATTGCAC.

[0111] SlARF5 is a crucial component of auxin signaling during tomato fruit development and is essential for the interaction between auxin and gibberellin. Inhibition of SlARF5 affects cell division and expansion; SlARF5-induced inhibition results in smaller fruits with fewer seeds or no fruit at all. Our results show that SlARF5 expression is downregulated in both single-knockout and double-knockout lines. In Arabidopsis, the arf6 / arf8 double mutant has short stamen filaments, indehiscent anthers, and immature pistils. Jasmonic acid (JA) levels are extremely low in the double mutant flowers, and the expression of some JA biosynthetic pathway genes is downregulated, suggesting that ARF8 and ARF6 may regulate JA levels and affect fertility. ARF8 is an auxin-responsive transcription factor that works synergistically with ARF6 to have a key impact on flower development and maturation. This example also shows that SlARF8 expression is downregulated in both single-knockout and double-knockout lines. In tomatoes, the loss-of-function mutant of the SlAGL6 gene can produce normal but seedless fruits even without fertilization. SlKLUH is significantly upregulated in the mutant ovules, and its expression increases in the integument after fertilization in the wild type. Overexpression of SlKLUH in transgenic plants leads to enlarged ovules and integuments and parthenogenesis, indicating that SlAGL6 may prevent the formation of unfertilized fruits by inhibiting SlKLUH. The results of this example show that SlKLUH expression is downregulated in both single and double knockout lines of SlCER6, and upregulated in the single knockout line of SlMYB21. IAA9 plays a negative regulatory role in auxin response; downregulation of the SlIAA9 gene affects stamen development, inhibits self-pollination, and thus alters the normal fruit set program. In this example, the SlIAA9 gene is upregulated in both single and double knockout lines of SlCER6, and downregulated in the single knockout line of SlMYB21. The SlIAA9 gene belongs to the Aux / IAA family of transcription factors. Studies have found that inhibiting SlIAA9 expression can induce parthenocarpy in tomatoes. SlIAA9, along with four auxin A response factors (SlARF5, SlARF7, SlARF8a, and SlARF8b), inhibits fruit initiation. ABCG20 belongs to the ABC transporter family. Studies have reported that silencing ABCG20 reduces seed production; in this example, both single and double knockout of SlABCG20 significantly reduced expression levels.

[0112] Example 6: Verification of the interaction between SlCER6 and SlCSP proteins.

[0113] 1. Screening of interacting proteins

[0114] The CDS sequence of SlCER6 was constructed into the BD vector and used as bait to screen yeast cDNA libraries. Recombinant Y2Hgold yeast strain containing the pGBDT7-SlCER6 vector was mixed with Y187 yeast containing a flower tissue cDNA library at a cell ratio of 2.5:1 (bait:library). After centrifugation and collection of bacteria, the mixture was cultured in YCM liquid medium, collected again, vacuum filtered onto a hydrophilic membrane, incubated overnight, and then placed in 10 ml of 1M sorbitol. The membrane was vortexed vigorously, collected again, and resuspended in ddH2O. The bacteria were then spread on SD-Trp / -Leu / -His selection medium. Positive colonies that grew after 4-6 days were identified by high-throughput sequencing. Single colonies grown on SD-Trp / -Leu / -His medium were identified by PCR, resulting in 5 candidate proteins. These were sequenced, and Blast alignment with the NCBI database revealed one chloroplast stem-loop binding protein of 41 kDa, which is SlCSP, a protein with NAD-dependent isomerase / dehydratase domains. The sequence of this protein was amplified by PCR and is shown in SEQ ID No. 5. The primer sequences used are as follows:

[0115] BD-SlCER6-F: CATGGAGGCCGAATTCCCGGGGATGCCAGAACCAGTCCCAAA;

[0116] BD-SlCER6-R: CTAGTTATGCGGCCGCTGCAGTTAGAGCTTGACAATCTCTGGGAT.

[0117] 2. Bimolecular luciferase (BiFC) verification of protein interactions

[0118] SlCER6-Myc-YFPn-BamH-F:gagctcggtacccggggatccATGCCAGAACCAGTCCCAAA;

[0119] SlCER6-Myc-YFPn-BamH-R:catgtcgactctagaggatccGAGCTTGACAATCTCTGGGATGA;

[0120] SlCSP-HA-YFPc-BamH-F:gagctcggtacccggggatccATGGCTAGTTTGGTTGCTATTCAA;

[0121] SlCSP-HA-YFPc-BamH-R: catgtcgactctagaggatccGCTCTGGGGAACTAGTTTCTTTTC.

[0122] Using cDNA from flower tissue as a template, PCR products containing SlCER6 were obtained by performing PCR with SlCER6-Myc-YFPn-BamH-F and SlCER6-Myc-YFPn-BamH-R, and fragments containing SlCSP were obtained by performing PCR with SlCSP-HA-YFPc-BamH-F and SlCSP-HA-YFPc-BamH-R.

[0123] pCAMBIA1300-35S-Myc-YFPN-MCS-35S-Hyg was digested with restriction endonuclease BamHI. The resulting linearized vector was then homologously recombinated with a fragment containing SlCER6. The resulting recombinant plasmid with the correct sequence was designated pCAMBIA1300-SlCER6-MYC-YFPn. pCAMBIA1300-35S-HA-YFPC-MCS-35S-Hyg was digested with restriction endonuclease BamHI. The resulting linearized vector was then homologously recombinated with a fragment containing SlCSP. The resulting recombinant plasmid with the correct sequence was designated pCAMBIA1300-SlCSP-HA-YFPc.

[0124] pCAMBIA1300-SlCER6-MYC-YFPn, pCAMBIA1300-SlCSP-HA-YFPc, pCAMBIA1300-HA-YFPc, and pCAMBIA1300-Myc-YFPn were introduced into GV3101(pSoup-p19) Agrobacterium to obtain four recombinant Agrobacterium species: GV3101(pSoup-p19) / pCAMBIA1300-SlCER6-MYC-YFPn, GV3101(pSoup-p19) / pCAMBIA1300-SlCSP-HA-YFPc, GV3101(pSoup-p19) / pCAMBIA1300-HA-YFPc, and GV3101(pSoup-p19) / pCAMBIA1300-Myc-YFPn.

[0125] One day before infecting tobacco leaves, 4-week-old tobacco seedlings were transferred to the dark for incubation. On the day of transformation, they were thoroughly watered and brought back to light. Different recombinant Agrobacterium species were inoculated into 5 ml of LB broth containing appropriate antibiotics, while Agrobacterium species transformed with empty plasmids were simultaneously propagated. The cultures were incubated overnight at 28°C and 200 rpm. The next day, the overnight cultures were transferred to 20 ml of fresh LB broth containing antibiotics, 10 mmol / L MES, and 40 mmol / L AS, respectively, and incubated overnight at 28°C and 200 rpm. The cultures were collected by centrifugation at 4000×g for 10 min and then analyzed with 10 mmol / L... Resuspend the bacterial culture in MgCl2, add AS to a final concentration of 200 μmol / L, and mix equal volumes of GV3101(pSoup-p19) / pCAMBIA1300-SlCER6-MYC-YFPn and GV3101(pSoup-p19) / pCAMBIA1300-SlCSP-HA-YFPc bacterial cultures. Equal volumes of Agrobacterium-p19) / pCAMBIA1300-Myc-YFPn and GV3101(pSoup-p19) / pCAMBIA1300-SlCSP-HA-YFPc bacterial suspensions were mixed. Equal volumes of GV3101(pSoup-p19) / pCAMBIA1300-HA-YFPc and GV3101(pSoup-p19) / pCAMBIA1300-Myc-YFPn bacterial suspensions were mixed as a blank control. After injecting each Agrobacterium-p19 mixture, the mixtures were incubated at room temperature for 3 hours. Two tobacco leaves from each plant were injected and labeled. On the third day, YFP fluorescence was detected using a Leica TCS-SP8 confocal microscope. The results were photographed.

[0126] The results are as follows Figure 7 As shown in Figure A: Tobacco mesophyll cells co-transformed with pCAMBIA1300-SlCER6-MYC-YFPn and pCAMBIA1300-SlCSP-HA-YFPc plasmids exhibit yellow fluorescence. Tobacco mesophyll cells co-transformed with pCAMBIA1300-SlCER6-MYC-YFPn and pCAMBIA1300-HA-YFPc, pCAMBIA1300-MYC-YFPn and pCAMBIA1300-SlCSP-HA-YFPc, and pCAMBIA1300-MYC-YFPn and pCAMBIA1300-HA-YFPc plasmids showed no signal.

[0127] 3. Recursive Validation for Document Screening

[0128] The sequence obtained from screening a tomato mixed tissue yeast cDNA library using BD-SlCER6 as bait was compared with the NCBI database and found to be SlCSP. Yeast plasmids were extracted using the Proton Yeast Genomic DNA Extraction Kit (PT1267). The extracted AD-SlCSP and BD-SlCER6 were co-transformed into Y187 cells. The carrier DNA was incubated at 95°C for 3 min, then quickly removed and placed on ice for 3 min, repeating this process once more. 100 μl of thawed Y187 competent cells were taken, and 2-5 μg of the target plasmid, 10 μl of carrier DNA, and 500 μl of PEG / LiAc were added sequentially. The mixture was pipetted and incubated at 30°C for 30 min, mixing 6-8 times every 15 min. The tube was then incubated at 42°C for 15 min (mixing 6-8 times at 7.5 min). The tube was centrifuged at 5000 rpm for 40 s, the supernatant was discarded, and the cells were resuspended in 400 μl of ddH2O, centrifuged for 30 s, and the supernatant was discarded. Resuspend in 50 μl ddH2O and plate on SD-Trp-Leu. Pick single colonies growing on the plate and inoculate them into 5 ml SD-Trp-Leu liquid medium. Incubate at 30℃ and 200 rpm with shaking for 2-3 days. Collect the colonies at 4000 rpm for 5 min and centrifuge. Dilute serially with sterile water and spot onto SD / -Trp / -His / -Leu.

[0129] The results are as follows Figure 7 As shown in Figure B: pGBKT7-SlCER6 and pGADT7-SlCSP vectors were constructed, and the interaction between the two proteins was verified using yeast two-hybrid assays. pGBKT7-53 and pGADT7-T were used as positive controls, and pGBKT7-SlCER6 and pGADT7 empty vectors were used as negative controls. Both vectors were transformed into Y187 yeast strain. The transformed strains were plated onto SD / -Trp / -leu medium to obtain positively transformed yeast strains. The strains were shaken in SD / -Trp / -leu liquid medium, and 1 μL of the strain was spotted onto SD / -Trp / -His / -Leu triple-deficient medium. Both the positive control and experimental groups showed normal growth, demonstrating the interaction between SlCER6 and SlCSP proteins (e.g., ...). Figure 7 (B) The results of the vector swapping were still consistent with the interaction between SlCER6 and SlCSP proteins.

[0130] 4. Bimolecular fluoresceinase (LUC) verification of protein interactions

[0131] 1) Constructing a carrier

[0132] Using the recombinant plasmid pCAMBIA1300-SlCER6-MYC-YFPn as a template, PCR amplification was performed using SlCER6-nLuc-BamH1-F and SlCER6-nLuc-BamH1-R to obtain a fragment containing SlCER6. Using the recombinant plasmid pCAMBIA1300-SlCSP-HA-YFPc as a template, PCR amplification was performed using SlCSP-cluc-F and SlCSP-cluc-R to obtain a fragment containing SlCSP. Primer sequences are as follows:

[0133] SlCER6-nLuc-BamH1-F: cgagctcggtacccgggatccATGCCAGAACCAGTCCCAAA;

[0134] SlCER6-nLuc-BamH1-R: gccgggccctctagaggatccGAGCTTGACAATCTCTGGGATGA;

[0135] SlCSP-cluc-F:ccggggcggtacccgggatccATGGCTAGTTTGGTTGCTATTCAA;

[0136] SlCSP-cluc-R: gccgggccctctagaggatccGCTCTGGGGAACTAGTTTCTTTTC.

[0137] 2) The pCAMBIA1300-cluc vector was digested with BamH1, and the resulting linear plasmid was homologously recombined with the fragment containing SlCSP. The resulting recombinant plasmid with the correct sequence was denoted as 35S-SlCSP-LUCc. The pCAMBIA1300-nluc vector was digested with BamH1, and the resulting linear plasmid was homologously recombined with the fragment containing SlCER6. The resulting recombinant plasmid with the correct sequence was denoted as 35S-SlCER6-LUCn.

[0138] Four recombinant Agrobacterium species were obtained by introducing the 35S-SlCSP-LUCc, 35S-SlCER6-LUCn, pCAMBIA1300-cluc, and pCAMBIA1300-nluc vectors into Agrobacterium GV3101 (pSoup-p19).

[0139] The four recombinant Agrobacterium strains were used to infect tobacco leaves according to the method in step 2. Each tobacco leaf was divided into four areas for injection. The experimental groups consisted of a 1:1 volume ratio mixture of 35S-SlCER6-LUCn and 35S-SlCSP-LUCc infection solutions with the same OD600 value. The other two were mixed in pairs as negative controls. After mixing, the mixtures were allowed to stand at room temperature for 3 hours, then injected onto the back of the leaves. The ambient temperature remained constant, and the leaves were treated in darkness for 12 hours before being exposed to light again.

[0140] 3) Transient expression of tobacco proteins

[0141] 48 hours after tobacco infection, the leaves were sprayed with luciferase substrate: 1 mM potassium luciferate (Beijing Boao Tuoda Technology Co., Ltd., product number DL11717G) + 0.01% Triton X-100 (Beijing Boao Tuoda Technology Co., Ltd., product number T6200G). After 0.5 hours in the dark, the fluorescence was detected by a fully automated chemiluminescence monitoring system (Tianneng).

[0142] The results are as follows Figure 7 As shown in Figure C: Protein-protein interaction was demonstrated using a bimolecular luciferase assay. The vectors 35S-SlCER6-LUCc and 35S-SlCSP-LUCn were constructed, with 35S-LUCc / 35S-LUCn, 35S-LUCc / 35S-SlCSP-LUCn, and 35S-SlCER6-LUCc / 35S-LUCn serving as negative controls. The results showed that SlCER6 and SlCSP proteins interact (e.g., ...). Figure 7 (C). Thus, through yeast two-hybrid experiments, BiFC experiments, and LUC experiments, it has been repeatedly confirmed that the interacting protein of SlCER6 is an SlCSP protein. Similarly, experiments using Co-IP also show that the interacting protein of SlCER6 is an SlCSP protein (e.g., ...). Figure 7 (D). This indicates that the SlCER6 protein regulates energy metabolism through its interaction with the SlCSP protein.

[0143] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for preparing tomatoes, comprising: The target tomato was obtained by knocking out the genes encoding SlCER6 and SlMYB21 proteins in tomatoes. The SlCER6 protein is either A1) or A2) below. A1) The amino acid sequence of this protein is SEQ ID No. 2; A2) A protein that has more than 98% identity with and has the same function as A1) by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in SEQ ID No.2 in the sequence listing; The SlMYB21 protein is either B1 or B2). B1) The amino acid sequence of this protein is that of SEQ ID No. 4; B2) A protein having more than 98% identity with and the same function as B1) by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in SEQ ID No. 4 in the sequence listing.

2. The method according to claim 1, characterized in that: The SlCER6 protein-coding gene is the DNA molecule listed as SEQ ID No. 1 in the sequence listing; The gene encoding the SlMYB21 protein is the DNA molecule listed as SEQ ID No. 3 in the sequence listing.

3. The method according to claim 1, characterized in that: The method is implemented using the CRISPR / Cas9 approach.

4. The method according to claim 3, characterized in that: The gRNA in the CRISPR / Cas9 method targets the inverse complementary sequences of positions 294-316 and 448-470 of SEQ ID No. 1 and positions 112-134 and 180-202 of SEQ ID No.

3.

5. The method according to any one of claims 1-4, characterized in that: The coding gene for the SlCER6 protein in the target tomato contains a deletion at positions 282-302 of SEQ ID No. 1; the coding gene for the SlMYB21 protein contains a deletion at positions 839-1076 of SEQ ID No. 6, a substitution of position 1077 with T, and a substitution of position 1079 with T. Alternatively, the gene encoding the SlCER6 protein in the target tomato may have a deletion at positions 301-304 of SEQ ID No. 1; or a deletion at positions 125-128 of SEQ ID No.

3.

6. The application of the method according to any one of claims 1-5 in tomato fruit production.

7. The application of the method according to any one of claims 1-5 in tomato hybridization breeding.

8. The application of substances that knock out the gene encoding the SlCER6 protein of claim 1 and substances that knock out the gene encoding the SlMYB21 protein of claim 1 in tomato fruit production, or in tomato hybridization breeding.

9. The application according to claim 8, characterized in that: The substance that knocks out the gene encoding the SlCER6 protein as described in claim 1 is either C1) or C2). C1) gRNA used for editing the gene encoding the SlCER6 protein; C2) An expression cassette, recombinant vector, or recombinant microorganism containing the gRNA nucleic acid molecule described in C1); The substance that knocks out the gene encoding the SlMYB21 protein in claim 1 is either C3) or C4). C3) gRNA used for editing the gene encoding the SlMYB21 protein; C4) An expression cassette, recombinant vector, or recombinant microorganism containing the gRNA nucleic acid molecule described in C3).

10. A composition comprising the substance of claim 8 or 9 that knocks out the gene encoding the SlCER6 protein and the substance of claim 9 that knocks out the gene encoding the SlMYB21 protein.

Images